A tobacco drought-responsive gene NtPMT2 and its application

Abstract

The present invention belongs to the field of molecular biology, and discloses that the NtPMT2 gene negatively regulates the drought tolerance of tobacco. Using K326 as the background, knockout lines pmt2-21 and pmt2-22 of this gene were obtained by using the CRISPR / Cas9 technology. After 26 days of natural drought treatment and 12 days of rehydration, the recovery of the two knockout lines was significantly stronger than that of K326, and the survival rate was significantly increased; the degree of wilting shown by mannitol-simulated water stress was significantly lower than that of K326. Under drought stress, the contents of malondialdehyde, hydrogen peroxide, and superoxide anion in the leaves of the two knockout lines were significantly lower than those of the wild type; the activities of superoxide dismutase and peroxidase were significantly higher than those of the wild type; the net photosynthetic rate, transpiration rate, intercellular carbon dioxide concentration, stomatal conductance, and electron transfer efficiency were all significantly higher than those of the wild type. It can be seen that knocking out this gene can significantly improve the drought tolerance of tobacco. The present invention can be used for the cultivation and identification of new drought-tolerant tobacco varieties.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology, and particularly relates to a tobacco drought-responsive gene NtPMT2 and its application. Background Art

[0002] Tobacco is an important leaf economic crop, and water is a major environmental factor restricting the growth, development, yield and quality of tobacco. In recent years, seasonal drought has occurred in many tobacco-growing areas in China, resulting in a decline in tobacco leaf yield and quality. Therefore, breeding new tobacco varieties with strong drought tolerance is of great significance to reduce the impact of drought. At present, exploring key functional genes and improving new varieties through molecular breeding means such as molecular marker-assisted selection or gene editing is an effective and feasible approach.

[0003] Drought stress can lead to the accumulation of reactive oxygen species (ROS) in plants. The accumulated ROS mainly include hydrogen peroxide (H 2 O 2 ), superoxide anion radical (O2.-), alkoxy radical (RO), etc. The accumulation of excessive ROS leads to membrane lipid peroxidation, generating a large amount of malondialdehyde (MDA). MDA reacts with proteins on the membrane, causing damage to the cell membrane, increasing membrane permeability and resulting in ion leakage. Superoxide dismutase (SOD) is the first key antioxidant enzyme to function in the ROS scavenging system. It can timely scavenge reactive oxygen species and free radicals to improve the resistance of plants to adversity. POD can convert superoxide into inactive substances, thereby eliminating the damage of superoxide to cells. Peroxidase can also improve cell signals to promote the repair of cells against oxidative damage. Proline is an important osmotic regulatory substance accumulated by plants during drought stress. Under normal growth conditions, the proline content in plants is usually not high, but after experiencing drought stress, proline accumulates in large amounts to prevent osmotic stress from causing damage to plants. When plants are stressed, the stomatal conductance on the leaf surface will change, affecting the gas exchange inside and outside the leaf and the intensity of plant transpiration. Transpiration affects the absorption of soil water and inorganic salts by plants and the water transport in plants. The photosynthetic capacity is the basis for determining the accumulation degree of plant dry matter. As an important substrate for photosynthesis, the intercellular concentration of carbon dioxide is a limiting factor for photosynthesis. The maximum carboxylation efficiency (Vcmax), the maximum electron transport efficiency (Jamax) and the triose phosphate utilization rate (TPU) jointly describe the three rate-limiting processes of the response of photosynthetic assimilation to CO2 concentration (ACi curve). They determine the photosynthetic capacity of plant leaves and are very important in evaluating crop traits.

[0004] The S-adenosyl-L-methionine-dependent methyltransferases (SAMs) superfamily consists of nearly 57 protein families with different domains and plays an important role in plant development. They catalyze protein methylation, and S-adenosylmethionine (SAM) is an important intermediate metabolite that can participate in many biochemical reactions in the body as a methyl donor, propylamine donor, and precursor of thiol compounds, such as the synthesis of nucleic acids, proteins, phospholipids, and vitamins, and also participates in the interconversion of sulfur-containing compounds such as cysteine, glutathione, polyamines, coenzyme A, and taurine. Phosphoethanolamine N-methyltransferase PMT, whose full name is S-adenosylmethionine:phosphoethanolamine methyltransferase, belongs to the S-adenosyl-L-methionine-dependent methyltransferase superfamily. In plants, phosphoethanolamine methyltransferase converts phosphoethanolamine (PEA) derived from serine into monomethyl ethanolamine phosphate (PMMEA), then forms dimethyl ethanolamine phosphate (PDMEA), and finally generates the precursor PCho for synthesizing phosphatidylcholine, and then synthesizes phosphatidylcholine, also known as lecithin (PC), through the Kennedy pathway. Phosphatidylcholine is the main component of cell membranes, and phosphatidylcholine will generate some metabolites under the action of hydrolases to regulate plant abscisic acid signals and plant stress resistance. There are research reports that after knocking out the S-adenosyl-L-methionine-dependent methyltransferase gene BnPMT6 in rapeseed, the oil content of the knockout line is significantly increased compared with the wild type.

[0005] At present, there are few studies on the function of tobacco S-adenosyl-L-methionine-dependent methyltransferase genes in plant stress resistance. Based on the omics combined analysis and co-expression network analysis of drought-tolerant mutants under drought stress, a candidate gene NtPMT2 responsive to drought stress was mined. On this basis, this study carried out functional identification and analysis of its regulatory mechanism of this gene, providing gene resources and theoretical basis for tobacco drought-tolerant molecular breeding. Summary of the Invention

[0006] Drought is one of the important abiotic stresses that affect the growth, development, yield and quality of tobacco. In-depth exploration of the drought tolerance regulation mechanism of tobacco and excavation of drought tolerance genes are of great significance for breeding new drought-tolerant varieties. In this study, through the combined analysis of transcriptome and metabolome of drought-tolerant mutants screened previously under drought stress, a candidate gene NtPMT2 that was significantly induced by drought stress was identified. The CDS sequence of this gene is 1842 bp in length, encoding 613 amino acids, and encoding an S-adenosyl-L-methionine-dependent methyltransferase. Using K326 as the background, two knockout lines pmt2-21 and pmt2-22 of this gene were obtained by CRISPR / Cas9 technology. The results of natural drought showed that the recovery of the two knockout lines after 26 days of natural drought treatment and 12 days of rewatering was significantly better than that of the wild type K326, and their survival rate was significantly increased; the results of mannitol-simulated water stress showed that the wilting degree of the two knockout lines was significantly lower than that of K326 under drought stress. Physiological and biochemical results showed that the contents of malondialdehyde (MDA), hydrogen peroxide (H2O2), and superoxide anion (OFR) in the leaves of the two knockout lines pmt2-21 and pmt2-22 were significantly lower than those of the wild type under drought stress; the activities of superoxide dismutase (SOD) and peroxidase (POD) were significantly higher than those of the wild type. The results of photosynthetic indicators showed that the net photosynthetic rate, transpiration rate, intercellular carbon dioxide concentration, stomatal conductance, and electron transfer efficiency of the two knockout lines were significantly higher than those of the wild type under drought stress. The above results proved that NtPMT2 negatively regulates the drought tolerance of tobacco, and knocking out this gene can significantly improve the drought tolerance of tobacco. The discovery and identification of this gene provide important gene resources and breeding materials for cultivating and identifying new drought-tolerant tobacco varieties.

[0007] The purpose of the present invention is to provide a method for improving the drought resistance of plants. Those skilled in the art can use known biotechnologies, such as transgenic, gene editing or mutation technologies, to reduce or eliminate the expression of the NtPMT2 gene in plants, and the plants can then have improved drought resistance.

[0008] Specifically, the present invention provides a primer pair for constructing a CRSIPR knockout vector of the drought negative regulatory gene NtPMT2, and the primer pair is:

[0009] F1: cagtGGTCTCatgcaGACTCGTCATGGTGGCCAAG (SEQ ID NO.5);

[0010] R1: cagtGGTCTCaaaacTGTCATCCTCGTTACACCGA (SEQ ID NO.6), and the primer pair is used to knockout the NtPMT2 gene in plants to improve the drought tolerance of plants.

[0011] The present invention provides a vector for regulating the expression of the NtPMT2 gene. The vector is obtained by amplifying the NtPMT2 gene (SEQ ID NO.17) or its CDS sequence (SEQ ID NO.11) using the primer pair F1 / R1, and inserting the obtained gene fragment into the BsaI / Eco31I digestion sites of the pHSbdcas9i expression vector. The NtPMT2 gene is knocked out in plants using the vector to improve the drought tolerance of the plants.

[0012] The present invention provides the isolated NtPMT2 gene mutant pmt2-21, whose nucleotide sequence is as shown in SEQ ID NO.13. The gene mutant pmt2-21 confers drought resistance to plants. Compared with the wild type, pmt2-21 (SEQ ID NO.13) has a base deletion at target site 2.

[0013] The present invention provides the encoded protein of the isolated NtPMT2 gene mutant pmt2-21, whose amino acid sequence is as shown in SEQ ID NO.14. The encoded protein confers drought resistance to plants. Compared with the wild type, the translation of the pmt2-21 protein (SEQ ID NO.14) terminates prematurely.

[0014] The present invention provides the isolated NtPMT2 gene mutant pmt2-22, whose nucleotide sequence is as shown in SEQ ID NO.15. The gene mutant pmt2-22 confers drought resistance to plants. Compared with the wild type, pmt2-21 (SEQ ID NO.15) has a large fragment of base deletion between target site 1 and target site 2, and the peak maps near its target sites are all clean single peaks.

[0015] The present invention provides the encoded protein of the isolated NtPMT2 gene mutant pmt2-22, whose amino acid sequence is as shown in SEQ ID NO.16. The encoded protein confers drought resistance to plants. Compared with the wild type, the pmt2-22 protein (SEQ ID NO.16) has 18 amino acids deleted in its sequence.

[0016] The present invention provides the application of the drought-negative regulatory NtPMT2 gene (SEQ ID NO.17) or its CDS sequence (SEQ ID NO.11) in plant drought tolerance breeding. Knock out the NtPMT2 gene or its homologous genes NtPMT2 (XP016490431.1), NSPMT2 (XP 009793104.1), NtoPMT2 (XP 009626042.1), NaPMT2 (XP019235100.1), SsPMT2 isoform Xl (XP 049399879.1), SvPMT2_isoform X1 (XP049369362.1), StPMT2 (XP 006366703.1), SdPMT2 (XP 055818639.1) in plants to obtain plants with improved drought tolerance, and / or hybridize the above-obtained plants with improved drought tolerance with other plant varieties to produce plant offspring, as well as backcross or self-cross to produce plant offspring, so that the amino acid mutations shown in SEQ ID NO.14 or SEQ ID NO.16 are expressed in plants, thereby obtaining plants with improved drought tolerance. Among them, the knockout includes deletion or inhibition of the NtPMT2 gene expression. The plants include monocotyledonous plants and dicotyledonous plants, and the plants are preferably tobacco.

[0017] The present invention provides the application of the primer pair F1 / F2 in plant drought tolerance breeding. Use the primer pair to knock out the NtPMT2 gene or its homologous genes NtPMT2 (XP 016490431.1), NSPMT2 (XP 009793104.1), NtoPMT2 (XP 009626042.1), NaPMT2 (XP 019235100.1), SsPMT2 isoform Xl (XP049399879.1), SvPMT2_isoform X1 (XP 049369362.1), StPMT2 (XP 006366703.1), SdPMT2 (XP 055818639.1) in plants to obtain plants with improved drought tolerance, and / or hybridize the above-obtained plants with improved drought tolerance with other plant varieties to produce plant offspring, as well as backcross or self-cross to produce plant offspring, so that the amino acid mutations shown in SEQ ID NO.14 or SEQ ID NO.16 are expressed in plants, thereby obtaining plants with improved drought tolerance. Among them, the knockout includes deletion or inhibition of the NtPMT2 gene expression. The plants include monocotyledonous plants and dicotyledonous plants, and the plants are preferably tobacco.

[0018] The present invention provides the application of a vector for regulating the expression of the NtPMT2 gene in plant drought tolerance breeding. The vector is used to knockout the NtPMT2 gene or its homologous genes NtPMT2 (XP 016490431.1), NSPMT2 (XP009793104.1), NtoPMT2 (XP 009626042.1), NaPMT2 (XP 019235100.1), SsPMT2 isoform Xl (XP 049399879.1), SvPMT2_isoform X1 (XP 049369362.1), StPMT2 (XP 006366703.1), SdPMT2 (XP 055818639.1) in plants to obtain plants with improved drought tolerance, and / or cross the above-mentioned plants with improved drought tolerance with other plant varieties to produce plant offspring, and backcross or self-cross to produce plant offspring, so that the amino acid mutations shown in SEQ ID NO.14 and / or SEQ ID NO.16 are expressed in plants, thereby obtaining plants with improved drought tolerance. Among them, the knockout includes deletion or inhibition of the expression of the NtPMT2 gene. The plants include monocotyledonous plants and dicotyledonous plants, and the plants are preferably tobacco. The vector is obtained by amplifying the NtPMT2 gene (SEQ ID NO.17) or its CDS sequence (SEQ ID NO.11) using the primer pair F1 / F2 and inserting the obtained gene fragment into the BsaI / Eco31I cleavage site of the pHSbdcas9i expression vector.

[0019] The present invention provides the application of the NtPMT2 gene mutant pmt2-21 (SEQ ID NO.13) or the NtPMT2 gene mutant pmt2-22 (SEQ ID NO.15) in plant drought tolerance breeding. Overexpressing any one or both of the mutant genes in plants to obtain plants with improved drought tolerance, and / or cross the above-mentioned plants with improved drought tolerance with other plant varieties to produce plant offspring, and backcross or self-cross to produce plant offspring, so that the amino acid mutations shown in SEQ ID NO.14 and / or SEQ ID NO.16 are expressed in plants, thereby obtaining plants with improved drought tolerance. Among them, the knockout includes deletion or inhibition of the expression of the NtPMT2 gene. The plants include monocotyledonous plants and dicotyledonous plants, and the plants are preferably tobacco.

[0020] The present invention provides a breeding method for drought-tolerant plants. The method includes using the NtPMT2 gene (SEQ ID NO.17) or its CDS sequence (SEQ ID NO.11), the primer pairs as described above, or the vector as described above in the method to knockout the NtPMT2 gene or its homologous genes NtPMT2 (XP 016490431.1), NSPMT2 (XP009793104.1), NtoPMT2 (XP 009626042.1), NaPMT2 (XP 019235100.1), SsPMT2 isoform Xl (XP 049399879.1), SvPMT2_isoform X1 (XP 049369362.1), StPMT2 (XP 006366703.1), SdPMT2 (XP 055818639.1) in plants, or overexpressing the NtPMT2 gene mutant pmt2-21 (SEQ ID NO.13) as described above, or the NtPMT2 gene mutant pmt2-22 (SEQ ID NO.15) as described above in plants to obtain plants with improved drought tolerance, and / or hybridizing the plants with improved drought tolerance obtained above with other plant varieties to produce plant offspring, and backcrossing or self-crossing to produce plant offspring, so that the amino acid mutations shown in SEQ ID NO.14 or SEQ ID NO.16 are expressed in plants, thereby obtaining plants with improved drought tolerance. Among them, the knockout includes deleting or inhibiting the expression of the NtPMT2 gene, and the plants include monocotyledonous plants and dicotyledonous plants, and the plants are preferably tobacco.

[0021] The present invention provides a method for reducing the contents of malondialdehyde (MDA), hydrogen peroxide (H2O2), and / or superoxide anion (OFR) in plant leaves, and / or increasing the activities of superoxide dismutase (SOD) and / or peroxidase (POD); and / or increasing the net photosynthetic rate, transpiration rate, intercellular carbon dioxide concentration, stomatal conductance, and electron transfer efficiency, relative to wild-type plants. The method includes using the NtPMT2 gene (SEQ ID NO.17) or its CDS sequence (SEQ ID NO.11), the primer pair as described above, and the vector as described above for the method to knockout the NtPMT2 gene or its homologous genes NtPMT2 (XP 016490431.1), NSPMT2 (XP 009793104.1), NtoPMT2 (XP 009626042.1), NaPMT2 (XP 019235100.1), SsPMT2 isoform Xl (XP 049399879.1), SvPMT2_isoform X1 (XP049369362.1), StPMT2 (XP 006366703.1), SdPMT2 (XP 055818639.1) in plants, or overexpressing the NtPMT2 gene mutant pmt2-21 (SEQ ID NO.13) or the NtPMT2 gene mutant pmt2-22 (SEQ ID NO.15) as described above in plants to improve the drought tolerance of plants, and simultaneously performing drought induction. Among them, the knockout includes deleting or inhibiting the expression of the NtPMT2 gene. The plants include monocotyledonous plants and dicotyledonous plants, and the plants are preferably tobacco.

[0022] The present invention provides a method for identifying whether a plant is a NtPMT2 gene knockout plant. If the NtPMT2 gene (SEQ ID NO.17), its CDS sequence (SEQ ID NO.11), and / or its encoded protein (SEQ ID NO.12) are detected in the plant to be detected, it is a plant with the NtPMT2 gene not knocked out. Preferably, it can be determined that the plant is not drought-tolerant. If the NtPMT2 gene mutant pmt2-21 (SEQ ID NO.13) and / or its encoded protein (SEQ ID NO.14) are detected, or the NtPMT2 gene mutant pmt2-22 (SEQ ID NO.15) and / or its encoded protein (SEQ ID NO.16) are detected, or the NtPMT2 gene (SEQ ID NO.17), its CDS sequence (SEQ ID NO.11), and / or its encoded protein (SEQ ID NO.12) are not detected on the premise that the method is reliable, it is a NtPMT2 gene knockout plant. Preferably, it can be determined that the plant is drought-tolerant.

[0023] The present invention will be described in detail below with specific drawings and examples to make the present invention easier to understand. The plant mutants provided by the present invention are derived from tobacco, but the mutations of the two amino acids are applicable to other plants. The mutations can occur at equivalent sites on other plants, and the resulting mutant plants have or improve the drought resistance of the plants. Description of the Drawings

[0024] Figure 1 In A-B, it is the phylogenetic tree of NtPMT2 and the homologous alignment of protein sequences. NtPMT2 (XP_016490431.1), NSPMT2 (XP_009793104.1), NtoPMT2 (XP_009626042.1), NaPMT2 (XP_019235100.1), SsPMT2isoform Xl (XP_049399879.1), SvPMT2_isoform X1 (XP_049369362.1), StPMT2 (XP006366703.1), SdPMT2 (XP_055818639.1). (The boxed one is NtPMT2).

[0025] Figure 2 In A-F, it is the analysis of the gene expression pattern of NtPMT2. The figure shows the expression of NtPMT2 in the leaves of K326 seedlings at 30 days old under the treatments of 400 mM mannitol drought, 40 °C high temperature, 200 mM NaCl, and abscisic acid (ABA), salicylic acid (SA), and methyl jasmonate (JA) with a concentration of 100 μM for 48 hours. Each data is the average of 3 replicates.

[0026] Figure 3 In A-C, it is the gene sequence alignment (A), peak map analysis (B), and protein sequence alignment (C) of the knockout lines.

[0027] Figure 4 In A-B, it is the identification of the drought tolerance phenotype of the knockout lines. Figure 4 In A, 30-day-old seedlings were naturally droughted for 26 days, and after rehydration for 12 days, the phenotypes and survival rates of the knockout lines and wild-type plants were analyzed. Asterisks represent significant differences between the knockout lines and the WT (* represents P < 0.05, ** represents P < 0.01). Figure 4 In B, 30-day-old seedlings were treated with 400 mM mannitol for 24 hours, and the phenotypic results are shown. Bar value = 5 cm.

[0028] Figure 5A-F are the changes in physiological and biochemical indexes under drought treatment. The plants at 30-day seedling age were treated with 400 mM mannitol for 5 days, and the results of physiological and biochemical index determination were obtained. Asterisks indicate significant differences between the knockout lines and the WT under specific treatments (* represents P < 0.05, ** represents P < 0.01).

[0029] Figure 6 A-E are the changes in photosynthetic parameters under drought stress. The plants at 30-day seedling age were treated with 400 mM mannitol for 4 days, and the results of plant photosynthetic index determination were obtained. Asterisks indicate significant differences between the knockout lines and the WT under specific treatments (* represents P < 0.05, ** represents P < 0.01). Detailed implementation manners

[0030] The present invention will be further elaborated through specific implementation manners below, in order to better understand the present invention, but it does not constitute a limitation to the present invention.

[0031] 1. Materials and methods

[0032] 1.1 Gene sequence feature analysis

[0033] The CDS sequence of NtPMT2 from the NCBI database was retrieved on the NCBI-BLAST website (http: / / www.ncbi.nlm.nih.gov / BLAST / ) to obtain 15 sequences with relatively high similarity, and they were translated into their corresponding protein sequences. Homologous alignment was performed using MEGA7.0, and a phylogenetic tree was constructed using the neighbor-joining method. Protein sequence similarity comparison was performed using DNAMAN6.0.

[0034] 1.2 Expression pattern analysis

[0035] Analysis of expression patterns under different treatments. Tobacco plants at 30-day seedling age were treated with drought (400 mM mannitol), high temperature (40 °C), high salt (200 mM), and different hormones abscisic acid (100 μM ABA), jasmonic acid (100 μM JA), salicylic acid (100 μM SA), etc. Samples were taken and stored at 0 h, 2 h, 6 h, 12 h, 24 h, and 48 h. Leaves from 3 plants were mixed at each time point.

[0036] The primer sequence information used in this experiment is as follows:

[0037] Fluorescent quantitative primers for NtPMT2:

[0038] PMT2-q-F: 5’-TGGTGGCCAAGCGGGTAGCATT-3’ (SEQ ID NO.1)

[0039] PMT2-q-R: 5’-GAGGTGGACAATGCCTTTCCCG-3’ (SEQ ID NO.2)

[0040] Tobacco internal reference gene β-Actin fluorescence quantitative primer:

[0041] Actin-q-F: 5’-TGCTGATCGTATGAGCAAGG-3’ (SEQ ID NO.3)

[0042] Actin-q-R: 5’-ATCCTCCGATCCAGACACTG-3’ (SEQ ID NO.4)

[0043] Use real-time quantitative PCR technology to analyze the expression pattern of NtPMT2, and the reaction system is shown in Table 1.

[0044] Table 1. Real-time fluorescence quantitative RT-PCR system

[0045]

[0046] The instrument used in the experiment is the QuantStudio 3 fluorescence quantitative PCR instrument of Thermo Fisher Company, and the reaction conditions use the standard mode. Each group is set with three replicates. Mix the above components well and perform real-time quantitative PCR amplification according to the following program: 94°C, pre-denaturation for 1 min; 94°C for 20 s, 60°C for 20 s, 72°C for 30 s, 81°C for 10 s for 45 cycles; 72°C for 7 min; finally store at 12°C for 10 min. Melt Curve Stage: 55°C for 2 s, 95°C for 10 s.

[0047] 1.3 Identification of the function of tobacco NtPMT2 gene

[0048] 1.3.1 Construction of gene editing vector

[0049] Use the online analysis tool at http: / / crispor.tefor.net / to analyze and obtain 2 specific targets located on the exon of the NtPMT2 gene, Target1: GACTCGTCATGGTGGCCAAGCGG (SEQ ID NO.18); Target2: TCGGTGTAACGAGGATGACA TGG (SEQ ID NO.19).

[0050] Furthermore, design primers for constructing the CRSIPR vector, and their sequence information is as follows:

[0051] F1: cagtGGTCTCatgcaGACTCGTCATGGTGGCCAAG (SEQ ID NO.5)

[0052] R1: cagtGGTCTCaaaacTGTCATCCTCGTTACACCGA (SEQ ID NO.6).

[0053] PCR amplification

[0054] Table 2. PCR reaction system

[0055]

[0056]

[0057] Table 3. PCR program

[0058] Step Number of cycles 94°C for 5 min 1 94°C for 30 sec 30 55°C for 45 sec 30 72°C for 54 sec 30 72°C for 10 min 1 16°C for 30 min 1

[0059] After electrophoresis, select the target fragment (about 200 bp), use the Novizan kit for recovery, and measure the concentration of the recovered product. After correct detection, ligate it to the vector.

[0060] Restriction digestion and ligation

[0061] The restriction digestion ligation system and reaction conditions are as follows:

[0062] Table 4. Restriction digestion ligation system

[0063] Component Volume Nuclease-free Water 8 μL 10* Buffer 2 μL BsaI / Eco31I 1 μL T4_ligase 1 μL pHSbdcas9i 4 μL Recycled DNA 4 μL Total volume 20 μL

[0064] Place it in an incubator at 37 °C for 1 h.

[0065] Transformation and identification

[0066] Transform 5 - 10 μL of the ligation product into Escherichia coli competent cells. After transformation, spread it on a kanamycin-resistant petri dish and culture it at 37 °C for 12 hours. Pick a single colony for expanded culture for 16 h and then perform colony PCR identification. The identification system and reaction conditions refer to Table 6 and Table 7.

[0067] The primer information is as follows:

[0068] F2: gtaaaacgacggccagt (SEQ ID NO.7)

[0069] R2: ccagaaattgaacgccgaag (SEQ ID NO.8)

[0070] The target band is a fragment about 800 bp. The reaction system is as follows:

[0071] Table 6. Colony PCR reaction system

[0072]

[0073]

[0074] Table 7. PCR reaction program

[0075] Step Number of cycles 94°C for 5 min 1 94°C for 30 sec 30 50°C for 45 sec 30 72°C for 54 sec 30 72°C for 10 min 1 16°C for 30 min 1

[0076] After electrophoresis, select 2 bright and clear bacterial solutions corresponding to the positive control bands. Take 100 μL of the bacterial solution for sequencing. After the sequencing results are confirmed to be correct, inoculate the bacterial solution with the correct sequence into LB liquid medium containing kanamycin, and shake the bacteria at 37 °C / 400 rpm for 24 h to extract the plasmid.

[0077] 1.3.2 Tobacco genetic transformation

[0078] (1) Agrobacterium preparation

[0079] Add 1 μL of plasmid to 50 μL of GV3101 Agrobacterium competent cells. The amplification primers, reaction system, and reaction program are the same as above. The PCR products are detected by gel electrophoresis. When the electrophoresis bands of the positive control and the samples are clear, the sizes are correct, and there are no bands in the negative control, it indicates that the sample can enter the next step and can be used to infect tobacco.

[0080] Select single colonies and culture them in liquid LB medium containing 25 μg / mL rifampicin and 100 μg / mL Km antibiotics at 28 °C for 24 h; centrifuge the cultured bacterial solution at 4000 r / min for 10 min, discard the supernatant, and then resuspend it in infiltration buffer (containing 10 mM MgCl2, 10 mM 2-(N-morpholino)ethanesulfonic acid (MES) with pH = 5.2, and 0.1 mM acetosyringone), and incubate at room temperature for more than 3 h until the OD600 value is about 0.6 as the infection solution for standby.

[0081] (2) Tobacco genetic transformation

[0082] The K326 tobacco seeds were disinfected with 75% alcohol for 30 s, washed with sterile water for 1 min, then disinfected with 84 disinfectant for 3 - 5 min, and washed with sterile water 3 times, 1 min each time. The disinfected tobacco seeds were sown on the germination medium and cultured at 23°C with a 16 h light / 8 h dark cycle for 4 - 5 weeks. The sterile tobacco leaves were cut into small pieces with a scalpel and inoculated on the pre - culture medium. Agrobacterium was picked and resuspended in the infection solution to prepare an Agrobacterium resuspension with an OD600 of 0.2. The tobacco leaves pre - cultured for 2 - 3 d were inoculated into the Agrobacterium suspension and infected for 10 - 15 min. The infected tobacco leaves were inoculated on filter paper, air - dried and then inoculated on the co - culture medium for dark culture for 48 - 72 h. The leaves after 2 d of co - culture were transferred to the induction medium to induce callus for about 10 d until callus tissue grew. Callus tissues meeting the standards were selected and inoculated on the screening medium with corresponding resistance for 15 - 30 d of culture at a temperature of 23 ± 2°C. The vigorously growing positive callus from the second - screening was inoculated onto the differentiation medium, 4 - 5 callus per petri dish, and cultured at 23°C with a 16 h / 8 h light / dark cycle for 15 - 30 d. During the differentiation process, if seedlings formed from the callus, they were inoculated onto the seedling - strengthening medium to grow.

[0083] 1.3.3 Sequencing analysis of positive seedlings

[0084] The genomic DNA of positive seedling leaves was extracted using the Plant DNA Isolation Mini Kit (Cat. No.: DC104 - 01) from Nanjing Novoprotein Scientific Inc., and the detailed method was referred to the instruction manual. The knockout materials were subjected to PCR amplification using the high - fidelity enzyme PrimeSTAR Max DNA Polymerase from Takara Biotechnology (Dalian) Co., Ltd. The length of the amplified fragment was 520 bp. The genomic DNA of positive seedling leaves was extracted using the Plant DNA Isolation Mini Kit (Cat. No.: DC104 - 01) from Nanjing Novoprotein Scientific Inc., and the detailed method was referred to the instruction manual. The knockout materials were subjected to PCR amplification using the high - fidelity enzyme PrimeSTAR Max DNA Polymerase from Takara Biotechnology (Beijing) Co., Ltd. The length of the amplified fragment was 520 bp.

[0085] The primer sequence information is as follows:

[0086] PMT2 - crispr - F2: GGCAAATAAAAGTTCAGGGGAC (SEQ ID NO.9)

[0087] PMT2 - crispr - R2: CATTACCTTCATACTGAACCC (SEQ ID NO.10)

[0088] The PCR program and reaction system are shown in Tables 8 and 9 below.

[0089] Table 8. PCR program

[0090]

[0091] Table 9. PCR reaction system

[0092]

[0093] 1.3.4 Identification of drought tolerance of knockout lines

[0094] The seeds of wild type and knockout lines were selected, disinfected and placed at 4°C for 48 h. Then they were sown on the substrate and cultured in an artificial climate chamber (temperature 25°C, relative humidity 75%, light / dark = 16 h / 8 h) for 30 d waiting for subsequent treatment. (1) Natural drought experiment: After natural drought for 26 d, rewatering was carried out, and photos were taken and the survival rate was counted 12 d after rewatering. (2) Mannitol-simulated drought experiment: Tobacco seedlings with consistent growth were selected, and 250 ml of 400 mM mannitol solution was infiltrated into each tobacco seedling. After treatment, the phenotypic changes were observed and photos were taken.

[0095] At three time points of 0 d, 2 d, and 5 d of treatment, the third leaf from the top of the plant was taken. After removing the main vein, 0.2 g of leaf samples were accurately weighed, quickly wrapped with tin foil, frozen in liquid nitrogen, and then transferred to a -80 refrigerator for storage. Five biological replicates were set for each treatment for physiological and biochemical detection.

[0096] 1.3.5 Determination of physiological and biochemical indexes of knockout lines

[0097] The content of malondialdehyde (MDA) was determined using a plant malondialdehyde (MDA) test kit (Nanjing Jiancheng, product number: A003-3-1);

[0098] The content of hydrogen peroxide (H 2 O 2 ) was determined using a hydrogen peroxide test kit (Nanjing Jiancheng, product number: A064-1-1);

[0099] The superoxide anion radical ability (OFR) was determined using a superoxide anion (Oxygen free radical, OFR) kit (Jiangsu Edison Biotechnology Co., Ltd., product number: ADS-W-YH008);

[0100] The content of proline (PRO) was determined using a proline (PRO) content test kit (Suzhou Gries, product number: G0111W);

[0101] The soluble protein (SP) was determined using a protein quantification (TP) assay kit (Nanjing Jiancheng, product number: A045-2);

[0102] The determination of the content of glutathione (GSH) was carried out using a micro reduced glutathione (GSH) assay kit (Nanjing Jiancheng, product number: A006-2-1).

[0103] 1.3.6 Determination of photosynthetic indexes of knockout lines

[0104] Select tobacco plants with a growth age of 30 days and consistent growth vigor, and use a 400 mM mannitol solution for drought simulation treatment. The photosynthetic measurement instrument used is a LI-6800 photosynthesis meter (set parameters: light intensity = 450 μmol m-2 s-1, CO 2 = 400 μmol mol-1, H 2 O = 25 mmol mol-1, flow rate = 500 μmol s-1, air pressure = 100 kPa, fan speed = 10,000 rpm, temperature = 25 °C). Measure photosynthetic indicators such as net photosynthetic rate A, transpiration rate E, stomatal conductance gsw, intercellular carbon dioxide concentration Ci, and electron transfer efficiency ETR at three time points: 0 d, 2 d, and 4 d.

[0105] 2. Result analysis

[0106] 2.1 Analysis of NtPMT2 sequence characteristics

[0107] (1) The NtPMT2 CDS sequence is shown in SEQ ID NO.11.

[0108] (2) The NtPMT2 protein sequence is shown in SEQ ID NO.12.

[0109] (3) The PMT2 genomic sequence is shown in SEQ ID NO.17.

[0110] Phylogenetic tree analysis ( Figure 1 in A) found that NtPMT2 has the closest genetic relationship with Nicotiana sylvestris NsPMT2 (XP-009793104.1) ( Figure 1 in A). Homologous protein sequence alignment ( Figure 1 in B) found that this protein has a conserved domain of Methyltransf_29 (94 bp - 599 bp), and has a high homology with Nicotiana sylvestris NsPMT2 and Nicotiana tomentosiformis NtoPMT2 ( Figure 1 in B).

[0111] The NtPMT2 gene was rapidly up-regulated under drought, high temperature, and high salt induction, and reached its peak at 12 h. At the same time, it was found that the expression level of NtPMT2 was rapidly up-regulated under the treatment of abscisic acid, salicylic acid, and jasmonic acid ( Figure 2 ). This result indicates that NtPMT2 can respond to abiotic stresses and stress-related plant hormones.

[0112] 2.2 Screening of NtPMT2 gene knockout homozygous lines

[0113] Thirty gene-edited positive seedlings obtained were subjected to sequencing analysis, and two successfully edited gene knockout lines were screened out. pmt2-21 (SEQ ID NO.13) has a single-base deletion at target site 2, and pmt2-22 (SEQ ID NO.15) has a large fragment of base deletion between target site 1 and target site 2( Figure 3 as shown in A), and the peak maps near their target sites all show clean single peaks( Figure 3 as shown in B). Through protein sequence analysis, it was found that the translation of pmt2-21 protein (SEQ ID NO.14) terminated prematurely, and the pmt2-22 protein (SEQ ID NO.16) (the sequence lacks 18 amino acids as Figure 3 shown in C).

[0114] Among them, the pmt2-21 sequence is as shown in SEQ ID NO.13. The pmt2-21 protein sequence is as shown in SEQ ID NO.14. The pmt2-22 sequence is as shown in SEQ ID NO.15. The pmt2-22 protein sequence is as shown in SEQ ID NO.16.

[0115] 2.3 Identification of drought tolerance of NtPMT2 knockout lines

[0116] After natural drought stress and rewatering treatment, the recovery of pmt2-21 and pmt2-22 was significantly stronger than that of WT, and correspondingly their survival rates also increased significantly( Figure 4 as shown in A). In addition, after treatment with 400 mM mannitol for 24 h, the wild type showed severe wilting of the whole plant; while only slight wilting appeared in the leaves of the two knockout lines, with no obvious difference from before treatment( Figure 4 as shown in B).

[0117] As Figure 5 shown in A - B, the MDA and H2O2 contents of pmt2-21 and pmt2-22 were significantly lower than those of WT under drought stress. At 2 days of drought stress, the OFR content of the two knockout lines was extremely significantly lower than that of WT( Figure 5 as shown in C). At 5 days of drought stress, the PRO content of pmt2-22 was significantly higher than that of WT( Figure 5 as shown in D). In addition, under drought stress, compared with WT, the SOD and POD activities of the two knockout lines were significantly increased( Figure 5 as shown in E - F). The results indicate that knocking out the NtPMT2 gene can lead to a decrease in the ROS content of tobacco, a weakening of the degree of membrane lipid peroxidation, an increase in the content of osmoregulatory substances and antioxidant substances, and an enhancement of plant drought tolerance.

[0118] Under drought stress, the net photosynthetic rate, transpiration rate, intercellular carbon dioxide concentration, stomatal conductance and electron transfer efficiency of pmt2-21 and pmt2-22 were all significantly higher than those of the wild typeFigure 6 )。This result indicates that the photosynthetic systems of the two knockout lines were significantly less damaged under drought stress.

[0119] It can be seen that the present invention successfully obtained two homozygous knockout lines of the NtPMT2 gene, pmt2-21 and pmt2-22, and their drought tolerance functions were identified. Under drought stress, the survival rates, plant phenotypes, physiological and biochemical indexes, and photosynthetic indexes of the two homozygous knockout lines were significantly better than those of the wild type (WT), indicating that the NtPMT2 gene negatively regulates the drought tolerance of tobacco, and knocking out the NtPMT2 gene leads to enhanced drought tolerance of tobacco.

Claims

1. Application of drought negative regulatory gene NtPMT2 in breeding plants with improved drought tolerance, characterized in that, knocking out the NtPMT2 gene in plants to obtain plants with improved drought tolerance; wherein, the knocking out refers to deletion or inhibition of the expression of the NtPMT2 gene; the plant is tobacco; the amino acid sequence encoded by the drought negative regulatory gene NtPMT2 is as shown in SEQ ID NO.

16.

2. The application according to claim 1, characterized in that, the nucleotide sequence of the drought negative regulatory gene NtPMT2 is as shown in SEQ ID NO.

17.

3. A breeding method for drought-tolerant plants, characterized in that, the method comprises knocking out the NtPMT2 gene in plants to obtain plants with improved drought tolerance; wherein, the knocking out refers to deletion or inhibition of the expression of the NtPMT2 gene; the plant is tobacco; the amino acid sequence encoded by the drought negative regulatory gene NtPMT2 is as shown in SEQ ID NO.

16.

4. The method according to claim 2, characterized in that, the nucleotide sequence of the drought negative regulatory gene NtPMT2 is as shown in SEQ ID NO.

17.

5. A method for reducing the content of malondialdehyde, hydrogen peroxide, and / or superoxide anion in plant leaves, and / or increasing the activity of superoxide dismutase and / or peroxidase; and / or increasing the net photosynthetic rate, transpiration rate, intercellular carbon dioxide concentration, stomatal conductance, and electron transfer efficiency relative to wild-type plants, characterized in that, the method comprises knocking out the NtPMT2 gene in plants to improve plant drought tolerance and simultaneously performing drought induction; wherein, the knocking out refers to deletion or inhibition of the expression of the NtPMT2 gene; the plant is tobacco; the amino acid sequence encoded by the drought negative regulatory gene NtPMT2 is as shown in SEQ ID NO.

16.

6. The application according to claim 5, characterized in that, the nucleotide sequence of the drought negative regulatory gene NtPMT2 is as shown in SEQ ID NO.17.

Images