A method for accurately and sensitively detecting tumor-derived exosomes based on a two-parameter para-site connection reaction

By employing a two-parameter adjacent linkage reaction and utilizing the combination of curvature-sensitive peptide probes and aptamer probes, precise and sensitive detection of tumor-derived exosomes was achieved. This solved the problem of distinguishing exosomes from microvesicles in existing technologies, and improved the accuracy and sensitivity of the detection.

CN117630369BActive Publication Date: 2026-05-22XIAMEN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
XIAMEN UNIV
Filing Date
2023-12-08
Publication Date
2026-05-22

Smart Images

  • Figure CN117630369B_ABST
    Figure CN117630369B_ABST
Patent Text Reader

Abstract

A method for accurately and sensitively detecting tumor-derived exosomes based on a two-parameter proximity ligation reaction, 1) a curvature-sensitive peptide and a maleimide group-modified oligonucleotide chain are connected through a Michael addition reaction to synthesize a curvature-sensitive peptide probe; 2) in a sample with exosomes and large vesicles, add the aptamer probe and incubate, add the curvature-sensitive peptide probe and incubate, and then dilute; 3) the diluted sample of step 2) is subjected to a ligation reaction with a connector, T4 ligase, T4 ligase buffer and other reagents to obtain a ligation reaction product; 4) the ligation reaction product of step 3) is subjected to a qPCR reaction with a probe qPCR premix, a forward primer, a reverse primer, a TaqMan probe and other reagents to realize high selectivity and high sensitivity detection of the sample. The method can be used for high specificity identification and accurate quantification of tumor-derived exosomes, and has potential research value in the accurate and non-invasive diagnosis of cancer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of tumor-derived exosome detection, and more particularly to a method for accurate and sensitive detection of tumor-derived exosomes based on a two-parameter adjacent linkage reaction. Background Technology

[0002] Extracellular vesicles (EVs) are small, membrane-bound vesicles released from cells into the extracellular matrix, playing a crucial role in intercellular communication. Based on different biosynthetic release pathways, EVs can be mainly classified into exosomes (30–150 nm), microvesicles (100–1000 nm), and apoptotic bodies (100–5000 nm), and their biogenetic patterns may be directly related to physiological functions or the physiological and pathological states of the cells of origin. Among them, exosomes, especially tumor-derived exosomes, serve as key mediators, facilitating intercellular communication between tumor cells and stromal cells in both local and distant microenvironments. Tumor-derived exosomes carry unique information from tumor cells, including nucleic acids, proteins, metabolites, and lipids, and are present in circulation and other body fluids. Proteins, in particular, play a vital role due to their abundance, uniqueness, and stability. Therefore, tumor-derived exosomal proteins have great potential as biomarkers for monitoring disease progression and treatment response.

[0003] Sensitivity and specificity are the most important indicators in the analysis of tumor-derived exosomes. Neighbor-ligation reaction (NLR) is a homogeneous immunohistochemical tool that combines the specificity of enzyme-linked immunosorbent assay (ELISA) with the sensitivity of polymerase chain reaction (PCR). It boasts high specificity and sensitivity, making it a commonly used method for analyzing tumor-derived exosomes. Currently, several research teams have developed novel NLR methods of different types, such as dual-antibody NLR, dual-aptamer NLR, lectin-aptamer NLR, and cholesterol-aptamer NLR. However, existing analytical methods still have limitations, such as the inability to accurately analyze EV subsets. The partial overlap in size between exosomes and microvesicles can lead to difficulties in distinguishing them in studies. Furthermore, the time-consuming sample preparation and cumbersome washing steps hinder the practical application of existing analytical methods in clinical samples. Summary of the Invention

[0004] The purpose of this invention is to solve the above-mentioned problems in the prior art and provide a method for accurate and sensitive detection of tumor exosomes based on a two-parameter ortho-linking reaction. By using ortho-linking technology based on the size selectivity of binding curvature sensitive peptide probes and the antigen specificity of aptamer probes, tumor-derived exosomes can be targeted and identified. The signal is amplified by real-time quantitative PCR (qPCR), which can effectively achieve accurate and non-invasive diagnosis of cancer.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A precise and sensitive method for detecting tumor-derived exosomes based on a two-parameter adjacent connectivity reaction includes the following steps:

[0007] 1) Curvature-sensitive peptide and maleimide-modified oligonucleotide chains were linked by Michael addition reaction to synthesize crude curvature-sensitive peptide probe, and the crude product was purified by high performance liquid chromatography to obtain curvature-sensitive peptide probe.

[0008] 2) Add aptamer probes to samples containing exosomes and large vesicles and incubate, then add curvature-sensitive peptide probes and incubate, and then perform dilution.

[0009] 3) The diluted sample from step 2) is ligated with connector, T4 ligase, T4 ligase buffer, and nuclease-free water to obtain the ligation product;

[0010] 4) Perform qPCR reaction on the ligation reaction product of step 3) with probe-based qPCR premix, forward primer, reverse primer, TaqMan probe, and nuclease-free water to achieve highly selective and sensitive detection of the sample.

[0011] The sample containing exosomes and large vesicles includes at least one of serum, tissue, and cell culture medium.

[0012] The two parameters include size parameters and biomarker parameters. Size parameters are achieved using the size selectivity of curvature-sensitive peptide probes, while biomarker parameters are achieved using the antigen specificity of aptamer probes.

[0013] The curvature-sensitive peptide probe is chemically synthesized by attaching a maleimide-modified oligonucleotide chain to the end of the curvature-sensitive peptide via a Michael addition reaction.

[0014] Compared with the prior art, the beneficial effects achieved by the technical solution of this invention are:

[0015] This invention utilizes the size selectivity of curvature-sensitive peptide probes and the biomarker recognition capability of aptamer probes to ensure significant selectivity and accuracy in the detection of tumor-derived exosomes, while avoiding interference from large vesicles and free proteins, thereby enabling more accurate and sensitive analysis of tumor-derived exosomes. Attached Figure Description

[0016] Figure 1 This is a schematic diagram illustrating the principle of the present invention;

[0017] Figure 2 Dynamic light scattering analysis (DLS) of exosomes and large vesicles from human malignant melanoma cells (A375 cells), with the inset showing transmission electron microscopy (TEM) results of A375 cell exosomes and large vesicles.

[0018] Figure 3 These are laser scanning confocal microscopy (CLSM) imaging results of curvature-sensitive peptide-magnetic bead-conjugated A375 cell exosomes or large vesicles co-incubated with a TAMRA-modified curvature-sensitive peptide. a: TAMRA channel results from CLSM imaging of curvature-sensitive peptide-magnetic bead-conjugated A375 cell exosomes co-incubated with a TAMRA-modified curvature-sensitive peptide. b: TAMRA channel results from CLSM imaging of curvature-sensitive peptide-magnetic bead-conjugated A375 cell large vesicles co-incubated with a TAMRA-modified curvature-sensitive peptide. c: Superimposed TAMRA and bright-field dual-channel results from CLSM imaging of curvature-sensitive peptide-magnetic bead-conjugated A375 cell exosomes co-incubated with a TAMRA-modified curvature-sensitive peptide. d: Superimposed TAMRA and bright-field dual-channel results from CLSM imaging of curvature-sensitive peptide-magnetic bead-conjugated A375 cell large vesicles co-incubated with a TAMRA-modified curvature-sensitive peptide.

[0019] Figure 4 Real-time fluorescence intensity to capture the qPCR signal of the product.

[0020] Figure 5 The present invention is used to detect the circulation threshold (Ct value) in serum samples from cancer patients and healthy individuals. Detailed Implementation

[0021] To make the technical problems, technical solutions and beneficial effects of the present invention clearer and more understandable, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments.

[0022] Figure 1 This is a schematic diagram of the steps of the present invention for the sensitive and accurate detection of tumor-derived exosomes using a two-parameter adjacent linkage reaction based on size and biomarkers.

[0023] Exosomes possess a highly tortuous membrane structure and a phospholipid bilayer structure, exhibiting characteristic lipid accumulation defects and negatively charged properties. Curvature-sensitive peptide probes can specifically recognize these lipid accumulation defects in exosomes of a specific size (<150 nm). Exosomes carry important proteins from tumor cells, and aptamer probes specifically bind to target proteins. Curvature-sensitive peptide probes and aptamer probes synergistically recognize tumor-derived exosomes. Using T4 ligase, a linker hybridizes with two neighboring probes at the ligation region, forming a double-stranded fragment through a ligation reaction. The formed double-stranded fragment is then detected using standard qPCR. A low Ct value indicates the presence and quantitative representation of tumor-derived exosomes when the dual recognition probes trigger a ligation-dependent qPCR amplification reaction; conversely, a high Ct value indicates a low concentration or absence of tumor-derived exosomes.

[0024] The tumor targets studied in this invention include exosomes and large vesicles produced by in vitro cell secretion, and the in vitro cells are cultured tumor cells.

[0025] Example 1

[0026] aptamer probe:

[0027] 5'-CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTGTGTGGTCTAT GTCGTCGTTCGCTAGTAGTTCCTGGGCTGCAC-3'

[0028] Curvature-sensitive peptide: N-terminus -RPPGFSPFRKGKC-C-terminus

[0029] Oligonucleotide chain linked to curvature-sensitive peptide: 5'-TCGAGGCGTAGAATTCCCCCGATGCGCGCTGTTCT-3' (5' end modified with a phosphate group, 3' end modified with a maleimide group)

[0030] Connector: 5'-AAATACGCCTCGAGTGCAGCCCATTT-3'

[0031] Forward primer: 5'-TGTGGTCTATGTCGTCGTTCG-3'

[0032] Reverse primer: 5'-GTAGTGAGAACAGCGCGCATC-3'

[0033] TaqMan probe: 5'-CTGCACTCGAGGCGTAGAATTCCCC-3' (5' end modified with a 6-carboxyfluorescein group, 3' end modified with a minor groove quencher group)

[0034] Epithelial cell adhesion molecule (EpCAM) is a 40 kDa transmembrane glycoprotein encoded by the GA-733-2 gene. It plays a role in epithelial carcinogenesis and is a target for cancer diagnosis and treatment due to its overexpression in various cancer cells. The aptamer probe of this invention can specifically recognize EpCAM-expressing cells from breast cancer, colorectal cancer, and gastric cancer, but does not bind to EpCAM-negative cells.

[0035] The recognition principle of curvature-sensitive peptide probes can be summarized as follows:

[0036] 1) Electrostatic interactions occur between positively charged amino acid residues and negatively charged phosphatidylserine head groups;

[0037] 2) A large number of hydrophobic amino acid residues are inserted into the lipid accumulation defects inherent in the highly curved lipid membrane of exosomes, thereby enabling recognition.

[0038] The detection method in this embodiment is as follows:

[0039] 1. Extraction of cell-derived exosomes and large vesicles

[0040] 1) Cell culture.

[0041] A375 cells were purchased from ATCC. A375 cells were cultured in DMEM medium supplemented with 10% (v / v) fetal bovine serum and 1% (v / v) penicillin-streptomycin. Cells were cultured in a 37°C incubator with 5% CO2.

[0042] 2) Extraction of cell line exosomes and large vesicles.

[0043] Cells were cultured in fetal bovine serum (FBS) culture medium after exosome removal. After 60 hours of cell proliferation, the cell culture supernatant was collected for exosome and large vesicle extraction. First, cell debris and dead cells were removed by centrifugation at 3000g for 20 min. Then, after centrifugation at 16500g for 45 min, the crude product from the large vesicles at the bottom was collected. The precipitated crude product was resuspended in phosphate-buffered saline (PBS) and concentrated by ultracentrifugation at 16500g for 45 min. The supernatant from which the crude product was removed was centrifuged at 100000g for 2 h to collect the crude exosome product at the bottom. The precipitated exosomes were resuspended in PBS and concentrated by ultracentrifugation at 100000g for 2 h. All centrifugation steps were performed at 4°C.

[0044] 2. Preparation of curvature-sensitive peptide probes

[0045] The curvature-sensitive peptide was incubated overnight at 4°C with maleimide-modified oligonucleotide chains by Michael addition reaction to obtain the crude product of curvature-sensitive peptide probe, which was then purified by HPLC.

[0046] 3. Sample characterization

[0047] 1) The total protein level of exosomes or large vesicles was determined using the BCA protein assay kit.

[0048] 2) The size distribution of extracted A375 cell exosomes and large vesicles was characterized using DLS.

[0049] 3) The morphology and size of the extracted A375 cell exosomes and large vesicles were characterized using TEM.

[0050] 4) Preparation of curvature-sensitive peptide-magnetic beads: 16 μL of 8 mg / mL T1 streptavidin magnetic beads were washed with PBS solution and resuspended in 180 μL of PBS solution. Then, 20 μL of 100 μM biotin-modified curvature-sensitive peptide was added, and the mixture was incubated at 37°C for 20 min. After washing with PBS solution, a blocking solution containing 10 mM pH 7.4 Tris-HCl, 1 mM EDTA, 2 M NaCl, 0.01% Tween-20, and 0.05% bovine serum albumin was added, and the mixture was incubated at 37°C for 1 h. After washing with PBS solution, the mixture was resuspended in 100 μL of PBS solution to obtain curvature-sensitive peptide-magnetic beads. The prepared curvature-sensitive peptide-magnetic beads were incubated with extracted A375 cell exosomes or large vesicles at 37°C for 1 h, magnetically separated, and washed with PBS solution. Next, 20 μL of 100 μM TAMRA-modified curvature-sensitive peptide was added, and the sample was incubated at 37°C for 20 min, followed by washing with PBS. The sample was then imaged using a CLSM scanner.

[0051] 5) Add 20 μL of 400 pM aptamer probe to 20 μL of exosomes and large vesicles or samples containing exosomes and large vesicles, and incubate at room temperature for 30 min. Then, incubate with 1.6 μL of 250 ng / mL curvature-sensitive peptide probe on ice for 10 min. Dilute with 360 μL of PBS solution containing 0.55 mM MgCl2 to obtain a diluted sample. Mix the diluted sample, connector, T4 ligase, T4 ligase buffer, and other reagents according to Table 1, and perform ligation in a heated instrument. The ligation reaction program is set to 25℃ for 10 min and 65℃ for 10 min.

[0052] Table 1 Formulation for the connection reaction

[0053] reagents Input Diluted sample 8μL Connector (2μM) 2μL T4 ligase buffer (10×) 2μL T4 ligase (400,000 U / mL) 1μL Nuclease-free water 7μL

[0054] 6) After the ligation reaction is complete, mix the ligation reaction product, probe-based qPCR premix, forward primer, reverse primer, TaqMan probe and other reagents according to Table 2, and perform qPCR testing in a qPCR instrument. Set the qPCR program according to Table 3.

[0055] Table 2. qPCR reaction system formulation

[0056] reagents Input Connecting reaction products 2μL Probe-based qPCR premix (2×) 10μL Forward primer (10 μM) 0.4μL Reverse primer (10 μM) 0.4μL TaqMan probe (5μM) 1μL Nuclease-free water 6.2μL

[0057] Table 3 qPCR reaction procedure

[0058]

[0059] Figure 2DLS analysis of A375 cell exosomes and large vesicles, with the inset showing TEM results of A375 cell exosomes and large vesicles. Figure 2 The results showed that the size of A375 cell exosomes was less than 150 nm, while the size of A375 cell large vesicles was greater than 250 nm.

[0060] Figure 3 CLSM imaging results of curvature-sensitive peptide-magnetic bead-coupled A375 cell exosomes or large vesicles co-incubated with TAMRA-modified curvature-sensitive peptides. a: TAMRA channel results of CLSM imaging of curvature-sensitive peptide-magnetic bead-coupled A375 cell exosomes co-incubated with TAMRA-modified curvature-sensitive peptides. b: TAMRA channel results of CLSM imaging of curvature-sensitive peptide-magnetic bead-coupled A375 cell large vesicles co-incubated with TAMRA-modified curvature-sensitive peptides. c: Superimposed TAMRA and bright-field dual-channel results of CLSM imaging of curvature-sensitive peptide-magnetic bead-coupled A375 cell exosomes co-incubated with TAMRA-modified curvature-sensitive peptides. d: Superimposed TAMRA and bright-field dual-channel results of CLSM imaging of curvature-sensitive peptide-magnetic bead-coupled A375 cell large vesicles co-incubated with TAMRA-modified curvature-sensitive peptides. Figure 3 The results showed that A375 cell exosomes significantly bound to curvature-sensitive peptides. Figure 3 The results showed that large vesicles in A375 cells did not bind to curvature-sensitive peptides. Figure 3 The results showed that the TAMRA channel and the bright field channel co-localized significantly, indicating that the curvature-sensitive peptide-magnetic bead coupled A375 cell exosomes bind to the curvature-sensitive peptide modified with the TAMRA group. Figure 3 The results showed that large vesicles in A375 cells did not bind to curvature-sensitive peptides.

[0061] Figure 4 Real-time fluorescence intensity to capture the qPCR signal of the product. Figure 4 The results showed that in the absence of A375 cell exosomes, the Ct value was high, indicating that the two-parameter probes were not close enough to promote the reaction. In contrast, the introduction of A375 cell exosomes led to a significant decrease in the Ct value, suggesting that the two-parameter probes simultaneously bound to A375 cell exosomes and triggered the adjacent linkage reaction. Furthermore, when one of the aptamer probes, curvature-sensitive peptide probes, or connectors was absent, the Ct value was slightly higher than that of the blank sample, indicating that the linkage efficiency was negligible.

[0062] Figure 5 This invention is used to detect the Ct values ​​of actual serum samples from cancer patients and healthy individuals. Figure 5 The results showed that the Ct values ​​of cancer patients detected using this invention were significantly lower than those detected in healthy individuals.

[0063] In summary, the size- and biomarker-based two-parameter adjacent linkage technique, by combining the size selectivity of curvature-sensitive peptide probes with the antigen specificity of aptamer probes, can target and identify tumor-derived exosomes with high specificity, enabling their identification and quantification. This invention ensures significant selectivity and accuracy in the detection of tumor-derived exosomes while avoiding interference from large vesicles and free proteins. This invention provides important evidence for the detection of exosomes in cancer patients and has potential research value in the precise and non-invasive diagnosis of cancer.

[0064] The above description is merely a preferred embodiment of the present invention, and therefore should not be construed as limiting the scope of the present invention. All equivalent changes and modifications made in accordance with the scope of the patent and the contents of the specification should still fall within the scope of the present invention.

Claims

1. A method for precise and sensitive detection of tumor-derived exosomes based on a two-parameter adjacent connectivity reaction, characterized in that, Includes the following steps: 1) Curvature-sensitive peptide and maleimide-modified oligonucleotide chains were linked by Michael addition reaction to synthesize crude curvature-sensitive peptide probe, and the crude product was purified by high performance liquid chromatography to obtain curvature-sensitive peptide probe. 2) Add aptamer probes to cell culture media samples containing exosomes and large vesicles and incubate, then add curvature-sensitive peptide probes and incubate, and then perform dilution. 3) The diluted sample from step 2) is ligated with connector, T4 ligase, T4 ligase buffer, and nuclease-free water to obtain the ligation product; 4) Perform qPCR reaction on the ligation reaction product of step 3) with probe-based qPCR premix, forward primer, reverse primer, TaqMan probe, and nuclease-free water to achieve sample detection.

2. The method for accurate and sensitive detection of tumor-derived exosomes based on a two-parameter adjacent connectivity reaction as described in claim 1, characterized in that: The two parameters include size parameters and biomarker parameters. Size parameters are achieved using the size selectivity of curvature-sensitive peptide probes, while biomarker parameters are achieved using the antigen specificity of aptamer probes.