Fish collagen peptide, composite nanoparticles, emulsion and use thereof in anti-hypertensive and / or anti-thrombotic treatment

Abstract

The present invention relates to fish collagen peptides, composite nanoparticles, emulsions and their use in preparing anti-hypertensive and / or anti-thrombotic drugs. The fish collagen peptide is Gly-Por-Met, and its composite nanoparticles are prepared by compounding with water-soluble starch and stearic acid. The fish collagen peptide nanoparticles are prepared to form a physical barrier at the oil-water interface and hinder the aggregation and merging of oil droplets, so that the emulsion prepared by the emulsion can maintain long-term stability, which is conducive to preparing it into an emulsion for long-term storage. The composite nanoparticles and emulsion have the potential for application as raw materials for anti-thrombotic and anti-hypertensive foods, health products or drugs.

Description

Technical Field

[0001] The present invention relates to the technical field of fish collagen peptides, and in particular to fish collagen peptides, composite nanoparticles, emulsions and applications in preparing antihypertensive and / or antithrombotic drugs. Background Art

[0002] Fish collagen mainly contains type I and type V collagen, which is distributed in the skin, bones, scales, etc. of fish. It is a spiral fibrous protein twisted by three peptide chains. Its main amino acid composition is glycine, proline, hydroxyproline, alanine, hydroxylysine, etc. The amino acid composition is significantly different from other proteins. The content of glycine is very high, accounting for almost one-third of the total amino acid residues, that is, there is one glycine for every two other amino acid residues (X, Y), so its peptide chain can be represented by (Gly-XY)n; the hydroxyproline and hydroxylysine residues it contains are relatively rare in other proteins.

[0003] Existing research data at home and abroad show that fish collagen peptides have multiple physiological activities such as anti-oxidation, lowering blood pressure, and increasing body bone density. Lin Lin et al. found that fish skin collagen peptides with a molecular weight range of 3 to 10 kD have a certain protective and repairing effect on vascular endothelial cell damage, and within a certain concentration range, its effect increases with the increase of peptide concentration. Byun et al. (Byun HG, Kim SK. Purification and characterization of angiotensin I converting enzyme (ACE) inhibitory peptides from Alaska pollack (Theragra chalcogramma) skin [J]. Process Biochem, 2001, 36: 1155.) used a three-step ultrafiltration membrane reactor to continuously hydrolyze Alaska pollack skin gelatin with Alcalase, Pronase E and collagenase. The peptides with a relative molecular mass distribution in the range of 0.9 to 1.9 Kda have inhibitory activity against ACE. After chromatographic separation and purification, two peptides with ACE inhibitory activity, Gly-Por-Leu and Gly-Por-Met, were obtained, with ICs of 2.60 and 17.13 μmol / L, respectively.

[0004] Fish collagen peptides have many physiological functions. With the continuous improvement of living standards, people pay more and more attention to health issues. At present, collagen peptide-related products on the market are deeply loved by consumers, such as "Peptide Beauty" brand collagen, collagen peptide drinks, etc. It is believed that with the continuous progress of research, fish collagen peptides will be widely used in the fields of food and health products. Summary of the invention

[0005] Based on the above objectives, the present invention provides fish collagen peptides, composite nanoparticles, emulsions and their use in anti-hypertensive and / or anti-thrombotic applications.

[0006] The first aspect of the present invention provides a method for preparing fish collagen peptide composite nanoparticles, comprising: compounding fish collagen peptide Gly-Por-Met with water-soluble starch to obtain a fish collagen peptide-starch complex; dripping a stearic acid solution into a solution of the fish collagen peptide-starch complex to obtain the fish collagen peptide composite nanoparticles.

[0007] In the preparation method, the compounding comprises: preparing a fish collagen peptide solution and a water-soluble starch solution respectively with a phosphate buffer solution; mixing the fish collagen peptide solution and the water-soluble starch solution in equal volumes, adjusting the pH value to 7.5, and freeze-drying; reacting the dried powder at a relative humidity of 79% and 60° C. for 4 days; and then using a deionized water solution, centrifuging, and taking the supernatant to obtain the fish collagen peptide-starch complex.

[0008] In the preparation method, the concentration of the phosphate buffer is 20 mM, pH 7.5.

[0009] In the preparation method, the concentrations of the fish collagen peptide solution and the water-soluble starch are equal, and the concentrations of the fish collagen peptide solution and the water-soluble starch are 0.0.5-0.15 g / mL respectively.

[0010] In the preparation method, the stearic acid solution is an ethanol solution, and the final concentration of the stearic acid after addition is 5 to 15% by mass.

[0011] In the preparation method, the final concentration of the stearic acid after addition is 15% by mass.

[0012] The second aspect of the present invention provides a method for preparing an emulsion of the fish collagen peptide, comprising: preparing fish collagen peptide composite nanoparticles according to the preparation method described in the first aspect; dispersing the fish collagen peptide composite nanoparticles in deionized water to prepare composite particle solutions of 0.1 to 2 g / 100 mL; adding soybean oil of 1 / 9 volume of the composite particle solution as an oil phase, and preparing an emulsion by ultrasonic action (power of 650 W, duty cycle of on 2s, off 1s) for 20s in an ice water bath.

[0013] In the emulsion preparation method, the ultrasonic conditions are as follows: the power is 650 W, and the duty cycle is on for 2 seconds and off for 1 second.

[0014] The third aspect of the present invention provides the use of the fish collagen peptide composite nanoparticles prepared by the preparation method described in the first aspect in the preparation of antihypertensive and / or antithrombotic drugs.

[0015] The fourth aspect of the present invention provides the use of the emulsion prepared by the preparation method described in the second aspect in the preparation of antihypertensive and / or antithrombotic drugs.

[0016] Compared with the prior art, the present invention has at least one of the following beneficial effects:

[0017] The present invention obtains a fish collagen peptide nanoparticle by compounding water-soluble starch and stearic acid with fish collagen peptide. The present invention also utilizes the fish collagen peptide nanoparticle to form a physical barrier at the oil-water interface and hinder the aggregation and merging of oil droplets, so that the prepared emulsion can maintain long-term stability, which is conducive to preparing it into an emulsion for long-term storage. The emulsion containing fish collagen peptide nanoparticles provided by the present invention has the best emulsion stability when pH is 8.0, 4°C and the amount of stearic acid added is 15%. The fish collagen peptide composite nanoparticles and their emulsions have anti-thrombotic effects by downregulating the fibrinogen encoded by the FGA, FGB and FGG genes, and have a wide application prospect as anti-thrombotic and anti-hypertensive foods, health products or drugs. The raw materials have the potential for application. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The microscopic images are of fish collagen peptide composite nanoparticles (Pep1-Sta-ACID (15%), A) and fish collagen peptide composite nanoparticles (Pep2-Sta-ACID (15%), B). In the figure, "*" indicates p<0.05.

[0019] Figure 2 The CI values ​​of fish collagen peptide composite nanoparticles Pep1-Sta-ACID (5%), Pep1-Sta-ACID (10%), Pep1-Sta-ACID (15%), Pep2-Sta-ACID (5%), Pep2-Sta-ACID (10%), and Pep2-Sta-ACID (15%) at different pH values. In the figure, "*" indicates p < 0.05.

[0020] Figure 3The CI values ​​of fish collagen peptide composite nanoparticles Pep1-Sta-ACID (5%), Pep1-Sta-ACID (10%), Pep1-Sta-ACID (15%), Pep2-Sta-ACID (5%), Pep2-Sta-ACID (10%), and Pep2-Sta-ACID (15%) at different storage temperatures. In the figure, "*" indicates p<0.05, "**" indicates p<0.01, "***" indicates p<0.005, and "ns" indicates no statistically significant difference.

[0021] Figure 4 The antithrombotic ability of Pep1, Pep2, fish collagen peptide composite nanoparticles Pep1-Sta-ACID (15%) and Pep2-Sta-ACID (15%), latex1 (Pep1-Sta-ACID (15%)) and latex2 (containing Pep2-Sta-ACID (15%)). In the figure, "*" indicates p < 0.05, "**" indicates p < 0.01, "***" indicates p < 0.005, and "ns" indicates no statistically significant difference.

[0022] Figure 5 The relative expression of FGA mRNA in Pep1, Pep2, fish collagen peptide composite nanoparticles Pep1-Sta-ACID (15%) and Pep2-Sta-ACID (15%), latex1 (Pep1-Sta-ACID (15%)) and latex2 (including Pep2-Sta-ACID (15%)). In the figure, "*" indicates p < 0.05, "**" indicates p < 0.01, "***" indicates p < 0.005, and "ns" indicates no statistically significant difference.

[0023] Figure 6 The relative expression levels of FGB mRNA in Pep1, Pep2, fish collagen peptide composite nanoparticles Pep1-Sta-ACID (15%) and Pep2-Sta-ACID (15%), latex1 (Pep1-Sta-ACID (15%)) and latex2 (including Pep2-Sta-ACID (15%)). In the figure, "*" indicates p < 0.05, "**" indicates p < 0.01, and "ns" indicates no statistically significant difference.

[0024] Figure 7The relative expression levels of FGG mRNA in Pep1, Pep2, fish collagen peptide composite nanoparticles Pep1-Sta-ACID (15%) and Pep2-Sta-ACID (15%), latex1 (Pep1-Sta-ACID (15%)) and latex2 (including Pep2-Sta-ACID (15%)). In the figure, "*" indicates p < 0.05, and "ns" indicates no statistically significant difference. DETAILED DESCRIPTION

[0025] In order to make the purpose, technical scheme and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. The reagents not described separately in detail in the present invention are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0026] Example 1. Preparation of fish collagen peptide composite nanoparticles

[0027] Chemically synthesize fish collagen peptides (Gly-Por-Leu, named PEP1; Gly-Por-Met, named PEP2). Dissolve fish collagen peptides and water-soluble starch (Wuhan Meian Biopharmaceutical Technology Co., Ltd.) in phosphate buffer (20mM, pH 7.5) at a concentration of 0.1g / mL and stir for 2h. Mix the two solutions in equal volumes, adjust the pH value to 7.5 with 0.1mol / LNaOH, stir for 2h, and freeze-dry. Place the dried powder in a closed desiccator and react for 4 days at a relative humidity of 79% and 60°C. Dissolve the sample after dry heat reaction in deionized water, stir for 2h, centrifuge (10000r·min-1, 15min), take the supernatant, and freeze-dry to obtain fish collagen peptide-starch complex.

[0028] Prepare 250mg / mL of fish collagen peptide-starch complex aqueous solution and 2.5mg / mL of stearic acid ethanol solution with deionized water, add stearic acid ethanol solution dropwise to the fish collagen peptide-starch complex aqueous solution, and add 5%, 10% and 15% of the mass of fish collagen peptide-starch complex dropwise to the above solution, stir at 95°C for 30min, then cool to 75°C, and add anhydrous ethanol dropwise (the amount added is 3 times the volume of the solution). Centrifuge at 8000r / min, wash twice with 75% ethanol solution, and vacuum dry at 40°C for 24h to obtain fish collagen peptide nanoparticles.

[0029] Example 2: Characterization of fish collagen peptide composite nanoparticles

[0030] 1. Scanning electron microscopy characterization of particle morphology

[0031] The sample was fixed to the sample stage with conductive double-sided tape, a platinum film was sprayed under vacuum, and the sample was scanned with an SEM at an accelerating voltage of 15 kV to take electron micrographs. Figure 1 As shown, fish collagen peptide nanoparticles are mainly spherical in shape, with uneven sizes and adhesion between particles.

[0032] 2. Dynamic light scattering (DLS) analysis

[0033] The particle size distribution of the sample was analyzed by DLS. The sample was placed in ultrapure water and ultrasonically treated to obtain a 0.01 g / 100 mL dispersion. The sample was loaded into a plastic sample cell and placed in a nano-laser particle size analyzer for automatic balancing for 120 seconds before measuring the particle size distribution. The Zeta potential was measured using the dispersion in the same device.

[0034] 3. Crystal morphology analysis

[0035] The sample was scanned in the range of 3° to 60° using an XRD instrument equipped with a copper target, a Ni filter, a voltage of 40 kV and a current of 15 mA using a Cu-Kα radiation, at a scanning rate of 8° / min and a scanning step of 0.02°. The relative crystallinity % was calculated using the ratio of the crystallization area to the total diffraction area using Jade 6.0 software: =Ac / (Ac+Aa)×100% (2); where: Ac is the area of ​​the XRD crystallization peak; Aa is the area of ​​the amorphous peak.

[0036] 4. Contact angle analysis

[0037] The composite particle dispersion (75% ethanol solution) was spread on a thin glass slide to form a film, and then placed in a vacuum drying oven at 35°C and -0.095 MPa for 24 hours. The glass slide was immersed in soybean oil, and the contact angle of the water drop on the film was observed with a contact angle meter to measure the contact angle value.

[0038] 5. Results

[0039] Table 1 (mean ± standard deviation, n = 5)

[0040]

[0041] Note: Pep1-Sta-ACID (5%) means Pep1\water-soluble starch\stearic acid composite granules, with a stearic acid dosage of 5%; Pep1-Sta-ACID (10%) means Pep1\water-soluble starch\stearic acid composite granules, with a stearic acid dosage of 10%; Pep1-Sta-ACID (15%) means Pep1\water-soluble starch\stearic acid composite granules, with a stearic acid dosage of 15%; Pep2-Sta-ACID (5%) means Pep2\water-soluble starch\stearic acid composite granules, with a stearic acid dosage of 15%. Pep2-Sta-ACID(10%) means Pep2\water-soluble starch\stearic acid composite particles, the stearic acid dosage is 10%; Pep2-Sta-ACID(15%) means Pep2\water-soluble starch\stearic acid composite particles, the stearic acid dosage is 15%; PDI is the polydispersity index; the contact angle result is the measured value 10s after the water droplet falls on the sample film; different letters in the same column indicate significant differences (P<0.05).

[0042] As shown in Table 1, with the increase of the amount of stearic acid, the nanometer diameter of the composite nanoparticles increases continuously, and the molecular weight distribution becomes uneven; however, the lower the Zeta potential, the more stable the particles; and the relative crystallinity and contact angle increase continuously, indicating that with the increase of the amount of stearic acid, the bidirectional wettability of the interface of the composite nanoparticles increases continuously, the interfacial wettability is enhanced, and good emulsification can be exhibited. It can form a physical barrier at the oil-water interface and hinder the aggregation and merging of oil droplets, so that the prepared emulsion can maintain long-term stability, which is conducive to its preparation into an emulsion for long-term storage.

[0043] Example 3. Emulsion preparation and analysis

[0044] 1. Emulsion preparation

[0045] In an ice-water bath, the nanoparticles were fully dispersed in deionized water by ultrasonic wave (power of 650W, duty cycle of 2s on, 1s off) for 20s, and 0.1-2g / 100mL of composite particle solution was prepared. Soybean oil with a volume of 1 / 9 of the volume of the composite particle solution was added as the oil phase, and an emulsion was prepared by ultrasonic wave (power of 650W, duty cycle of 2s on, 1s off) for 20s in an ice-water bath.

[0046] 2. Emulsion storage stability analysis

[0047] The effects of environmental factors such as pH value and temperature on the stability of emulsion were investigated.

[0048] 70 mg / mL of the composite particles were added to the aqueous phase relative to the total volume of the emulsion, and the pH values ​​were adjusted to 2.0, 4.0, 6.0 and 8.0 with 0.001 mol / L NaOH and 0.1 mol / L HCl solutions, respectively, to prepare an emulsion with an oil-water ratio of 1:9 (V / V). The obtained emulsions were stored at 25°C for 1 week, and the changes in the appearance of the emulsions were observed. The changes in droplet distribution and the changes in the droplet size of the emulsion during storage were observed and measured using a microscope and a laser particle size analyzer. The corresponding emulsion volume was measured, and the creaming index (CI) was calculated to evaluate the physical stability of the emulsion. CI / % = Htotal / Hcream×100; where Htotal and Hcream are the total height of the emulsion layer and the height of the creaming layer, respectively.

[0049] In the same way, an emulsion (pH 8.0) was prepared and stored at 4°C, 25°C and 40°C for 3 months. The emulsion volume at the corresponding time was measured, and the creaming index (CI) was calculated to evaluate the physical stability of the emulsion. The changes in droplet distribution and droplet size during storage were observed and measured using a microscope and a laser particle size analyzer.

[0050] 3. Results

[0051] like Figure 2 As shown in the figure, as the pH value continues to increase, the CI value of the emulsion continues to increase, indicating that its stability continues to increase. It can be seen that low pH value is not conducive to the stability of the emulsion. Figure 3 As shown, as the storage temperature increases, the CI value of the emulsion increases, and as the proportion of stearic acid added increases, the CI value of the emulsion increases. This shows that the emulsion stability is best when pH 8.0, 4°C and 15% stearic acid is added.

[0052] Example 4. Biological activity of fish collagen peptide composite nanoparticles and their emulsions

[0053] 1. Cod breeding and embryo collection

[0054] Male and female cod were kept separately in different breeding tanks at (27±1℃) and natural light conditions, and fed 4 times a day. Female and male cod were placed in the spawning tank at a ratio of 1:1 the night before embryo collection, and embryos were collected at noon the next day. The embryos were stored in E3 medium, and dead eggs were removed and the medium was replaced every 24 hours.

[0055] 2. Establishment of cod thrombosis model and grouping experiment

[0056] Cod fish that developed normally 60 hours after fertilization were selected and placed in a 12-well plate, with 20 fish in each well. They were divided into normal group, model group, Pep1 group, Pep2 group, Pep1-Sta-ACID (15%) group, Pep2-Sta-ACID (15%) group, emulsion 1 group, and emulsion 2 group.

[0057] The normal group was cod fry cultured normally. The model group was cod fry treated with 2μM phenylhydrazine for 12 hours, and then replaced with normal culture medium for 24 hours. The positive drug group was cod fry treated with 2μM phenylhydrazine for 12 hours, and then aspirin with a final concentration of 40μM was added to replace normal culture medium for 48 hours.

[0058] In the Pep1 group, phenylhydrazine was added to each well at a final concentration of 2 μM to treat the cod fry for 12 h, and then 40 μM Pep1 was added to each well to replace the normal culture medium and culture was continued for 48 h.

[0059] In the Pep2 group, phenylhydrazine was added to each well at a final concentration of 2 μM to treat the cod fry for 12 h, and then 40 μM Pep2 was added to each well to replace the normal culture medium and culture was continued for 48 h.

[0060] In the Pep1-Sta-ACID (15%) group, phenylhydrazine was added to each well at a final concentration of 2 μM to treat cod fry for 12 h, and then Pep1-Sta-ACID (15%) was added at a final concentration of 70 mg / mL to replace the normal culture medium and culture was continued for 48 h.

[0061] In the Pep2-Sta-ACID (15%) group, phenylhydrazine was added to each well at a final concentration of 2 μM to treat the cod fry for 12 h, and then Pep2-Sta-ACID (15%) was added at a final concentration of 70 mg / mL to replace the normal culture medium and continue to culture for 48 h.

[0062] In the emulsion 1 group, phenylhydrazine was added to each well at a final concentration of 2 μM to treat the cod fry for 12 hours, and then 20% of emulsion 1 was added to replace the normal medium and cultured for another 48 hours. Emulsion 1 was an emulsion containing 70 mg / mL Pep2-Sta-ACID (15%), and the preparation method was the same as above.

[0063] In the emulsion 2 group, phenylhydrazine was added to each well at a final concentration of 2 μM to treat the cod fry for 12 hours, and then 20% of emulsion 2 was added to replace the normal medium and cultured for another 48 hours. Emulsion 2 was an emulsion containing 70 mg / mL Pep2-Sta-ACID (15%).

[0064] 3. Determination of antithrombotic ability

[0065] The antithrombotic ability was evaluated by microscopic observation and RT-PCR:

[0066] Microscope observation method: The heart and tail vein red blood cells of cod fry treated in each group were stained with o-dianisidine, and photographed and observed using a fluorescent inverted microscope, and statistical analysis was performed using ImageJ and ImageProPlus software. The anti-thrombotic ability was calculated by measuring the thrombus area of ​​the heart and tail vein of cod, and the anti-thrombotic ability = (S each group - S model group) / (S normal group - S model group) × 100%, where S represents the heart red blood cell staining area.

[0067] RT-PCR method:

[0068] The zebra larvae treated with drugs in each group were collected, quickly washed with distilled water, crushed and homogenized, and RNA was extracted using Trizol reagent. Since the extracted RNA solution may contain genomic DNA, a genomic DNA removal reaction is required before RNA reverse transcription. The reaction system is: 2μL gDNA Eraser, 4μL 5×gDNA Eraser Buffer, and the volume of RNA to be added is calculated according to the concentration of the extracted RNA solution to contain 2μɡ RNA. Finally, RNAseFreed H2O is added to make the entire reaction system 20μL, and the reaction is carried out at 42℃ for 2min.

[0069] The RNA reverse transcription reaction system is: 20 μL of the reaction system for removing genomic DNA in the previous step, 2 μL RT-PrimeRMix, 2 μL PrimeScRipTRTEnzymeMixI, 8 μL 5× PrimeScRipTBuffer2, 8 μL RNAseFreed H2O. Reaction at 37℃ for 15 min, 85℃ for 5 s, and the cDNA obtained by the reaction is frozen at -20℃ for later use.

[0070] The Real-Time PCR reaction system is: 7μL RNAseFreed H2O, 0.4μL upstream primer, 0.4μL PCR downstream primer, 10μL GoTaqqPCRMasTeRMix (2×), 0.2μL C×R (10×), 2μL cDNA. After the above system is mixed and centrifuged, quantitative analysis is performed on a 7500 Real-Time PCRsyeTem fluorescence timing quantitative PCR instrument. The reaction program is 95°C, 30s, and 40 cycles (95°C, 15s, 60°C, 15s, 72°C, 30s). β-actin is used as the internal reference gene. Use The relative expression level of the measured gene mRNA was calculated by the formula.

[0071] FGA primer: as shown in SEQ ID NO.1: CATTCACTGCTCTGCCTGTTC as shown in SEQ ID NO.2: CGCCTCTAGGGTTCACCAC.

[0072] FGB primer: as shown in SEQ ID NO.3: CGTTGGGACGACTACCGAAG; as shown in SEQ ID NO.4: AATACGGTCATTGCCCAGCC.

[0073] FGG primer: as shown in SEQ ID NO.5: AGATGGTCGATTGGGAAGGC; as shown in SEQ ID NO.6: AACCATCAAAGGCATCGCCA.

[0074] β-actin primer: as shown in SEQ ID NO.7: TCGTCCACCGCAAATGCTTCTA; as shown in SEQ ID NO.8: CCGTCACCTTCACCGTTCCAGT.

[0075] 4. Results

[0076] like Figure 4 As shown, the antithrombotic ability of each group observed under a microscope showed that the antithrombotic ability of Pep1, Pep2, Pep1-Sta-ACID (15%) and emulsion 1 were all low, and there was no significant difference between the antithrombotic ability of the fish collagen peptide composite particles and emulsion prepared with Pep1 as the raw material and Pep1, indicating that nanocomposite and emulsion preparation of Pep1 could not improve its antithrombotic ability. However, the antithrombotic ability of the fish collagen peptide composite particles and emulsion prepared with Pep2 as the raw material was significantly different from that of Pep2, and the antithrombotic ability of the emulsion was the highest, and significantly higher than the positive drug aspirin. This shows that the fish collagen peptide composite particles and emulsion prepared with Pep2 as the fish collagen peptide have anti-thrombotic application potential.

[0077] To further study its anti-thrombotic mechanism, this experiment also detected the relative expression levels of FGA, FGB and FGG in cod fry. Figures 5 to 7 The RT-PCR results showed that compared with the blank control group, the relative expression levels of genes FGA, FGB and FGG were significantly increased after phenylhydrazine treatment. However, the fish collagen peptide composite particles and emulsion prepared with Pep1 as the raw material had no significant effect on reducing the relative expression levels of FGA, FGB and FGG in cod fry treated with phenylhydrazine, while the fish collagen peptide composite particles and emulsion prepared with Pep2 as the raw material had significantly lower relative expression levels of FGA, FGB and FGG in cod fry treated with phenylhydrazine than the model group. This shows that the fish collagen peptide composite particles and emulsion prepared with Pep2 as the fish collagen peptide can reduce the relative expression levels of FGA, FGB and FGG in cod fry treated with phenylhydrazine.

[0078] The coagulation cascade is a series of limited protein hydrolysis leading to the generation of thrombin. Fibrinogen encoded by FGA, FGB and FGG genes is a key protein in the coagulation cascade. The expression level of FGA, FGB and FGG genes can reflect the thrombotic function in vivo. The above RT-PCR results once again show that the fish collagen peptide composite particles and emulsions prepared by using Pep2 as a fish collagen peptide have anti-thrombotic application potential.

[0079] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed by the present invention should be covered within the protection scope of the present invention.

Claims

1. A method for preparing fish collagen peptide composite nanoparticles, characterized in that: include: Compounding fish collagen peptide Gly-Pro-Met with water-soluble starch to obtain fish collagen peptide-starch complex; Dropping a stearic acid solution into the fish collagen peptide-starch complex solution to obtain the fish collagen peptide composite nanoparticles, wherein the stearic acid solution is a solution using ethanol as a solvent, and the final concentration of the stearic acid after addition is 5 to 15% by mass, and the final concentration of the stearic acid after addition is 15% by mass; The compound comprises: A fish collagen peptide solution and a water-soluble starch solution are prepared respectively with pH 7.5 and 20 mM phosphate buffer, wherein the concentrations of the fish collagen peptide solution and the water-soluble starch are equal, and the concentrations of the fish collagen peptide solution and the water-soluble starch are 0.05-0.15 g / mL respectively; The fish collagen peptide solution and the water-soluble starch solution were mixed in equal volumes, the pH value was adjusted to 7.5, and freeze-dried; the dried powder was reacted at a relative humidity of 79% and 60° C. for 4 days; Then use deionized water solution, centrifuge, take the supernatant, and obtain the fish collagen peptide-starch complex.

2. Use of the fish collagen peptide composite nanoparticles prepared by the preparation method according to claim 1 in the preparation of antihypertensive and / or antithrombotic drugs.

3. A method for preparing a fish collagen peptide emulsion, characterized in that: include: Obtaining fish collagen peptide composite nanoparticles prepared by the preparation method of claim 1; Dispersing fish collagen peptide composite nanoparticles in deionized water to prepare composite particle solutions of 0.1 to 2 g / 100 mL; 1 / 9 volume of soybean oil of the volume of the complex object particle solution was added as the oil phase, and an emulsion was prepared by ultrasonication for 20 seconds in an ice water bath; the ultrasonication conditions were power of 650 W and duty cycle of on for 2 seconds and off for 1 second.

4. Use of the emulsion prepared by the preparation method according to claim 3 in the preparation of antihypertensive and / or antithrombotic drugs.

Images