KASP primer set associated with wheat kernel weight and use thereof

By developing a KASP primer set related to the grain weight control site on wheat chromosome 5B, the problem of low gene screening efficiency in wheat breeding was solved, enabling rapid screening of wheat grain weight and significantly improving breeding efficiency, especially significantly increasing the thousand-grain weight in wheat varieties in the middle and lower reaches of the Yangtze River.

CN117646084BActive Publication Date: 2026-05-29JIANGSU ACAD OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410075195.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-18
Publication Date
2026-05-29
Estimated Expiration
2044-01-18

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively utilize molecular markers to rapidly screen gene loci related to wheat grain weight in wheat breeding, resulting in a slow breeding process.

Method used

A set of KASP primers associated with the grain weight control site Ktkw-5B on wheat chromosome 5B was developed. Efficient genotyping was achieved by fluorescence PCR detection. The KASP primer set was used to rapidly screen grain weight-related genes in wheat materials from the middle and lower reaches of the Yangtze River.

Benefits of technology

It enables rapid and efficient screening of wheat grain weight, significantly improving the efficiency of breeding selection, especially significantly increasing the thousand-grain weight of wheat varieties in the middle and lower reaches of the Yangtze River.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117646084B_ABST
    Figure CN117646084B_ABST
Patent Text Reader

Abstract

The application discloses a KASP primer group related to wheat grain weight and application thereof, and the primer group comprises a primer with a nucleotide sequence as shown in SEQ ID NO. 7, SEQ ID NO. 8 or SEQ ID NO. 3; and the KASP primer group can be used for detecting a site related to thousand-grain weight on a 5B chromosome of wheat Ktkw-5B, The allele C / T is typed, and the wheat thousand-grain weight carrying the allelic variation C is significantly higher than the wheat carrying the allelic variation T, so that the wheat grain weight screening is realized in an early stage, and the KASP primer group can be widely applied to the field of wheat breeding and accelerate the breeding process.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of wheat breeding, and in particular to a set of KASP marker primers related to wheat grain weight and their breeding applications. Background Technology

[0002] High yield is an important goal in wheat breeding. Grain weight is one of the components of yield, mainly controlled by additive effects, and has the highest heritability among yield factors, reaching 59-80% (Xiao Shihe, He Zhonghu. Improvement of wheat yield potential and quality. In: Zhuang Qiaosheng. Improvement of Chinese wheat varieties and pedigree analysis. Beijing: China Agriculture Press, 2003. pp 497-542). Wheat grain weight is a quantitative trait, exhibiting continuous variation and regulated by multiple genes with minor effects (Zhang LY, Liu DC, Guo XL, Yang W L, Sun JZ, Wang DW, Zhang A. Genomic Distribution of Quantitative Trait Loci for Yield and Yield-Related Traits in Common Wheat. Journal of Integrative Plant Biology, 2010, 52: 996-1007). Numerous studies have been reported on the genetic mapping of wheat grain weight. Mason et al. investigated wheat yield traits under different sowing dates and detected two thousand-grain weight QTLs on chromosomes 2D and 5A (Mason R E, Hays DB, Mondal S, Ibrahim AMH, Basnet B R. QTL for Yield, Yield Components and Canopy Temperature Depression in Wheat under Late Sown Field Conditions. Euphaitica, 2013, 194:243-259). Liu Lihua et al. conducted multi-environment yield trait identification on 248 winter wheat varieties bred in northern China, and identified 24 loci significantly associated with thousand-grain weight through association analysis (Liu Lihua, Liu Yangna, Zhou Yue, Li Hongbo, Zhang Mingming, Qu Pingping, Zhao Changping, Pang Binshuang. Genome-wide association analysis of wheat yield-related traits based on efficient SNP chip. Journal of Triticeae Crops, 2023, https: / / link.cnki.net / urlid / 61.1359.S.20230914.0914.004). Due to differences in mapping populations and molecular markers, the localization results varied considerably.

[0003] With the development of molecular biology, molecular markers have evolved from RFLP, RAPD and SSR to SNP markers in recent years. SNPs are characterized by genetic stability, large numbers, and wide distribution, and are suitable for high-throughput detection. Genotype chips developed based on them, such as 9k, 50k, 90k, and 660k chips, aggregate tens of thousands of SNP markers, greatly improving the accuracy of genetic mapping (Cavanagh CR, Shiaoman C, Shichen W, Bevan Emma H, Stuart S, Seifollah K, Kerrie F, Cyrille S, Brown-Guedira GL, Alina A. Genome-Wide Comparative Diversity Uncovers Multiple Targets of Selection for Improvement in Hexaploid Wheat Landraces and Cultivars. Proceedings of the National Academy of Sciences of the United States, 2013, 110: 8057-8062; Wang S, Wong D, Forrest K, Allen A, Chao S, Huang BE, Maccaferri M, Salvi S, Milner SG, Cattivelli L. Characterization). ofPolyploid Wheat Genomic Diversity Using a High-Density 90,000SingleNucleotide Polymorphism Array.Plant Biotechnology Journal,2014,12:787-796;CuiF,Zhang N,Fan X,Zhang W,Zhao C,Yang L,Pan R,Chen M,Han J,Zhao X.Utilization of a Wheat660k Snp Array-Derived High-Density Genetic Map for High-ResolutionMapping of a Major QTL for Kernel Number. Scientific Reports, 2017,7:3788).Based on the differences in SNP sites, KASP (Kompetitive Allele Specific PCR) markers with specific matching primer terminal bases can be developed. This allows for accurate biallelic identification of SNP sites and features high throughput, making it suitable for molecular marker detection of large numbers of samples. This aligns with breeding selection and has broad application prospects in breeding (Semagn K, Babu R, Hearne S, Olsen M. Single Nucleotide Polymorphism Genotyping Using KompetitiveAllele Specific Pcr (Kasp): Overview of the Technology and Its Application in Crop Improvement. Molecular Breeding, 2014, 33: 1-14).

[0004] Research in recent decades, both domestically and internationally, has shown that the increase in thousand-grain weight plays an important role in improving wheat yield (Morgounov A, Zykin V, Belan I, Roseeva L, Zelenskiy Y, Gomez Becerra HF, Budak H, Bekes F (2010) Genetic gains for grain yield in high latitude spring wheatgrown in Western Siberia in 1900–2008. Field Crops Research 117:101-112; Song JM, Dai S, Li HS, Cheng DG, Liu AF, Cao XY, Liu JJ, Zhao ZD (2013) Evolution of Agronomic and Quality Traits of Wheat Cultivars Released in Shandong Province Recently. Scientific Agricultura Sinica 46:1114-1126; Underdahl JL, Mercoum M, Ransom JK, Schatz BG (2008) Agronomic Traits Improvement and Associations in Hard Red Spring Wheat Cultivars Released in North Dakota from 1968 to 2006. Crop Science 48:158-166). The winter wheat region in the middle and lower reaches of the Yangtze River is the second largest wheat-producing area in my country. Its wheat production is of great significance to ensuring national food security. Discovering the genetic control loci of thousand-grain weight in local wheat varieties has important guiding significance for further targeted selection of wheat yield. Summary of the Invention

[0005] To address the aforementioned issues, this application provides a set of KASP primers associated with the grain weight control site Ktkw-5B on wheat chromosome 5B. This set of primers can rapidly perform grain weight-related genotyping on wheat materials from the middle and lower reaches of the Yangtze River (the definition of which can be found in the literature "Cheng Shunhe, Guo Wenshan, Wang Longjun. Wheat in Southern China. Nanjing: Jiangsu Science and Technology Press, 2012.pp23-26"), thereby accelerating the breeding process.

[0006] Specifically, this application first provides a set of KASP primers related to wheat grain weight, including primer AX-108792406-F1 with nucleotide sequence as shown in SEQ ID NO.7, primer AX-108792406-F1 with nucleotide sequence as shown in SEQ ID NO.8, and universal primer AX-108792406-R with nucleotide sequence as shown in SEQ ID NO.3.

[0007] Secondly, this application also provides the application of the above-mentioned KASP primer set in the detection of wheat grain weight. The specific steps are as follows: using wheat sample DNA as a template, a PCR detection system is prepared using the above-mentioned KASP primer set, and the sample wheat is subjected to fluorescent PCR detection. If red fluorescence is produced, it corresponds to the dominant allelic variant C; if blue fluorescence is produced, it corresponds to the non-dominant allelic variant T. The thousand-grain weight of wheat carrying the dominant allelic variant gene C is significantly higher than that of wheat carrying the non-dominant allelic variant gene T. The above-mentioned wheat is preferably from the wheat-growing region of the middle and lower reaches of the Yangtze River.

[0008] Furthermore, the above PCR detection system includes: 2.5 μL of 2×KASP Master Mix, 0.07 μL of KASP Assay Mix, and 2.43 μL of template DNA at a concentration of 20 ng / μL;

[0009] The preparation method for each 100 μL KASP Assay Mix is ​​as follows: 12 μL (100 μM) of primer AX-108792406-F1 with nucleotide sequence as shown in SEQ ID NO.7, 12 μL (100 μM) of primer AX-108792406-F2 with nucleotide sequence as shown in SEQ ID NO.8, 30 μL (100 μM) of primer AX-108792406-R with nucleotide sequence as shown in SEQ ID NO.3, and 46 μL of ultrapure water.

[0010] The PCR reaction program was as follows: Step 1: 94℃, 15 min; Step 2: 94℃, 20 s, 61~55℃, 1 min, decreasing by 0.6℃ for each cycle, for a total of 10 cycles; Step 3: 94℃, 20 s, 55℃, 1 min, for a total of 26 cycles.

[0011] Third, the present invention also provides a kit for detecting wheat grain weight, comprising: 2×KASPMaster Mix 2.5μL, KASP Assay Mix 0.07μL; wherein, the preparation method of each 100μL KASP Assay Mix is ​​as follows: primer AX-108792406-F112μL (100μM) with nucleotide sequence as shown in SEQ ID NO.7, primer AX-108792406-F212μL (100μM) with nucleotide sequence as shown in SEQ ID NO.8, primer AX-108792406-R 30μL (100μM) with nucleotide sequence as shown in SEQ ID NO.3, and 46μL of ultrapure water.

[0012] This application involves measuring and analyzing the thousand-grain weight of 103 wheat varieties approved in the middle and lower reaches of the Yangtze River wheat region from 1972 to 2016. A thousand-grain weight control locus was detected on chromosome 5B, and further converted into a KASP marker, which was verified to have a significant effect on the thousand-grain weight of wheat and can be applied to breeding selection. Attached Figure Description

[0013] Figure 1 The Ktkw-5B site map;

[0014] Figure 2 The results of KASP sequence fluorescence detection are shown in Table 1 of the examples. Detailed Implementation

[0015] The wheat varieties involved in the examples were all preserved in the laboratory of Jiangsu Academy of Agricultural Sciences.

[0016] Example 1: Screening for SNP loci Ktkw-5B

[0017] 1. Materials and Methods

[0018] This embodiment uses 103 wheat varieties approved in the middle and lower reaches of the Yangtze River wheat region from 1972 to 2016 as materials (wheat varieties are disclosed in the literature "Jiang, P., P. Zhang, L. Wu, Y. He, C. Li, H. Ma, et al. 2021. Linkage and association mapping and Kompetitive allele-specific PCR marker development for improving grain protein content in wheat. Theoretical and Applied Genetics 134:3563-3575"). For two consecutive growing seasons, 2017-2018 and 2018-2019, the materials were planted in single-row plots at the Jiangsu Academy of Agricultural Sciences' experimental base and Liuhe base, with 60 seeds per row, a row length of 1.6m, and a row spacing of 0.25m. The plants were replicated twice and managed using conventional methods.

[0019] After the grains matured, they were harvested, and the thousand-grain weight was determined using a Wanshen grain testing machine (SC-A1, Hangzhou, Zhejiang). Simultaneously, the thousand-grain weight of 279 high-generation wheat varieties harvested at the Liuhe base during the 2019–2020 growing season was also measured for subsequent verification. (Table 4) These materials were all bred from wheat parental hybrids in the middle and lower reaches of the Yangtze River, including the Ningmai series (such as Ningmai 13 and Ningmai 14), the Yangmai series (Yangmai 9, Yangmai 23, and Yangmai 20), and the Zhenmai series (such as Zhenmai 13). For example, the Line 3-4 combination is “Ningmai 13 × Yangmai 9”, the Line 30-34 combination is “Ningmai 14 × Yangmai 23”, and the Line 86-88 combination is “Yangmai 20 × Zhenmai 13”.

[0020] Genomic DNA was extracted using the CTAB method (extraction method described in the literature "Porebski S, Bailey L, Baum B (1997) Modification of CTAB DNA extraction protocol for plants containing highpolysaccharide and polyphenol components. Plant Molecular Biology Reporter 15:8-15"). Genotypes were obtained using an Affymetrix 50K gene chip (Beijing Bio-Tech Co., Ltd., Beijing). Quality control of the genotype data was performed using TASSEL V5.2.13 software, deleting marker sites with a minimum gene frequency ≤5% and a deletion rate exceeding 10% (Jiang, P., P. Zhang, L. Wu, Y. He, C. Li, H. Ma, et al. 2021. Linkage and association mapping and Kompetitive allele-specific PCRmarker development for improving grain protein content in wheat. Theoretical and Applied Genetics 134:3563-3575).

[0021] Association analysis was conducted using the GAPIT software package in R (Lipka A, Tian F, Wang Q, Peiffer J, Li M, Bradbury P, Gore M, Buckler E, Zhang Z (2012) GAPIT: Genome Association and Prediction Integrated Tool. Bioinformatics 28:2397-2399). The BLINK (Bayesian-information and linkage-disequilibrium iteratively nested keyway) method was selected (Huang M, Liu X, Yao Z, Summers R, Zhang Z (2018) BLINK: A package for the next level of genome-wide association studies with both individuals and markers in the millions. GigaScience 8). Principal components were used as covariates to reduce the false positive rate, and the screening threshold was set to 1×10⁻⁶. -3 (Valluru, R., MP Reynolds, WJ Davies and S. Sukumaran. 2017. Phenotypic and genome-wide association analysis of spike ethylene in diverse wheat genotypes under heat stress. New Phytologist 214:271-283).

[0022] KASP molecular markers were developed by designing PCR amplification primers based on SNP sites and flanking sequences. For each marker, two SNP-specific primers (F1 / F2) and one universal primer (R) were designed. The F1 primer was tailed with a specific sequence GAAGGTGACCAAGTTCATGCT that binds to the FAM fluorescent group, and the F2 primer was tailed with a specific sequence GAAGGTCGGAGTCAACGGATT that binds to the HEX fluorescent group. KASP primers were designed using Polymarker (http: / / www.polymarker.info / ) and synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0023] The total KASP reaction volume was 5 μL, containing 2.5 μL of 2×KASP Master Mix, 0.07 μL of KASP Assay Mix (primer working solution), and a concentration of 20 ng / μL. -1 2.43 μL of template DNA.

[0024] Each 100 μL Assay Mix contains: 12 μL (100 μM) each of SNP-specific primers (F1 / F2), 30 μL (100 μM) of universal primer (R), and 46 μL of ultrapure water.

[0025] KASP reaction procedure: Step 1: 94℃, 15min; Step 2: 94℃, 20s, 61~55℃, 1min, decreasing by 0.6℃ per cycle, for a total of 10 cycles; Step 3: 94℃, 20s, 55℃, 1min, for a total of 26 cycles.

[0026] PCR reactions were performed in a water bath PCR instrument (LGC Hydrocycler model). 16 The PCR results were analyzed using a KASP fluorescence analyzer (LGC model PHERAstar plus).

[0027] 2. Results and Analysis

[0028] 2.1 In this embodiment, through association analysis, an allelic variant increasing thousand-grain weight was detected on chromosome 5B of superior varieties such as Yangmai 158, Yangfumai 4, and Zhenmai 9. This thousand-grain weight control locus is located within the physical interval of 598-604 Mb, and its chromosomal location is as follows: Figure 1 As shown, the applicant named the site Ktkw-5B.

[0029] 2.2 In order to better utilize the Ktkw-5B site for breeding, this embodiment developed a KASP marker suitable for high-throughput genotyping based on its region marker sequence.

[0030] First, two SNP markers with low homology were selected from its marker region for primer design (Table 1). After amplification verification, AX-111744909 could not be successfully genotyped, while AX-108792406 showed good amplification results. Figure 2 ), Figure 2 In the table, A and B represent the fluorescence detection results of primers AX-108792406 and AX-111744909, respectively. Red corresponds to the dominant allelic variant C, blue corresponds to the non-dominant allelic variant T, and black is the blank control.

[0031] Further comparison of the genotyping results of primer AX-108792406 with the genotype chip results showed that the two were completely consistent (Table 2), indicating that primer AX-108792406 can be applied to the breeding selection of wheat thousand-grain weight in the wheat-growing areas of the middle and lower reaches of the Yangtze River.

[0032] Table 1

[0033]

[0034] Table 2

[0035]

[0036]

[0037] Example 2: KASP Primer Set Validation

[0038] In this embodiment, the KASP marker developed in Example 1 was used to genotype 279 high-generation wheat lines and statistical analysis was performed in combination with phenotypic data (Table 3). It was found that the marker had a significant effect on the selection of thousand-grain weight. The thousand-grain weight of the material carrying the C dominant allele was significantly higher than that of the material carrying the T non-dominant allele. The specific genotype and phenotypic values ​​are shown in Table 4.

[0039] The KASP primer set used was AX-108792406, consisting of AX-108792406-F1 (SEQ ID NO.7), AX-108792406-F2 (SEQ ID NO.8) and the universal primer AX-108792406-R (SEQ ID NO.3).

[0040] The total KASP reaction volume was 5 μL, containing 2.5 μL of 2×KASP Master Mix, 0.07 μL of KASP Assay Mix, and a concentration of 20 ng / μL. -1 2.43 μL of template DNA.

[0041] The preparation method for each 100 μL Assay Mix is ​​as follows: primer AX-108792406-F1 12 μL (100 μM), primer AX-108792406-F2 12 μL (100 μM), primer AX-108792406-R 30 μL (100 μM), and 46 μL of ultrapure water.

[0042] KASP reaction procedure: Step 1: 94℃, 15min; Step 2: 94℃, 20s, 61~55℃, 1min, decreasing by 0.6℃ per cycle, for a total of 10 cycles; Step 3: 94℃, 20s, 55℃, 1min, for a total of 26 cycles.

[0043] PCR reactions were performed in a water bath PCR instrument (LGC Hydrocycler model). 16 The PCR results were analyzed using a KASP fluorescence analyzer (LGC model PHERAstar plus).

[0044] Table 3

[0045]

[0046] Note: The numbers in parentheses represent the quantity of material carrying the corresponding allelic variation.

[0047] Table 4

[0048]

[0049]

[0050]

[0051]

[0052]

[0053]

[0054] As shown in Table 4, the Ktkw-5B locus can be effectively genotyped using the AX-108792406 primer set. Both alleles T and C play a significant role in the selection of thousand-grain weight. Wheat carrying the dominant allele C has a significantly higher thousand-grain weight than wheat carrying the non-dominant allele T. This allows for the screening of wheat genotypes at the seed stage, accelerating the breeding process.

Claims

1. The application of a KASP primer set related to wheat grain weight in the detection of wheat grain weight, characterized in that, Using wheat DNA as a template, a PCR detection system was prepared using KASP primers and the wheat samples were subjected to fluorescent PCR detection. If red fluorescence was produced, it contained C allelic variants; if blue fluorescence was produced, it contained T allelic variants. The thousand-grain weight of wheat carrying C allelic variants was significantly higher than that of wheat carrying T allelic variants. The KASP primer set consists of primer AX-108792406-F1 with nucleotide sequence as shown in SEQ ID NO.7, primer AX-108792406-F2 with nucleotide sequence as shown in SEQ ID NO.8, and primer AX-108792406-R with nucleotide sequence as shown in SEQ ID NO.

3.

2. The application according to claim 1, characterized in that, The PCR detection system includes: 2.5 μL of 2×KASP MasterMix, 0.07 μL of KASP Assay Mix, and 2.43 μL of template DNA at a concentration of 20 ng / μL; The KASP Assay Mix is ​​prepared as follows: 12 μL of primer AX-108792406-F1 at a concentration of 100 μM, 12 μL of primer AX-108792406-F2 at a concentration of 100 μM, 30 μL of primer AX-108792406-R at a concentration of 100 μM, and 46 μL of ultrapure water; The PCR reaction program was as follows: Step 1: 94℃, 15 min; Step 2: 94℃, 20 s, 61~55℃, 1 min, decreasing by 0.6℃ for each cycle, for a total of 10 cycles; Step 3: 94℃, 20 s, 55℃, 1 min, for a total of 26 cycles.

Citation Information

Patent Citations

  • Wheat grain weight related KASP primer group and application thereof

    CN111778352A