Herbicide-tolerant maize transformation event px424 and specific detection primers and methods thereof

Abstract

The application discloses a herbicide-resistant maize transformation event PX424 and specific detection primers and methods thereof, wherein the maize transformation event PX424 takes the nucleotide sequence shown in SEQ ID NO. 1 as a left flanking sequence of exogenous T-DNA, and takes the nucleotide sequence shown in SEQ ID NO. 2 as a right flanking sequence of exogenous T-DNA. The maize transformation event PX424 provided by the application can realize specific introduction of an exogenous gene into a maize strain, and endows the receptor maize with the ability to resist herbicides such as bensulfuron-methyl, glyphosate, nicosulfuron, glyphosate and phosphinothricin. The DNA detection method provided by the application can be used for molecular marker detection of the maize transformation event PX424, and has important significance for traceability and whole-process supervision of research, production processing and application of the PX424.

Description

(I) Technical Field

[0001] This invention belongs to the field of plant biotechnology, and relates to a maize transformation event PX424 resistant to multiple herbicides, its specific detection method, and its application. Specifically, it relates to a maize transformation event PX424 resistant to multiple herbicides, a nucleic acid sequence for detecting whether a biological sample contains the specific maize transformation event PX424, and its specific detection method and application. (II) Background Technology

[0002] Corn (Zea mays L.) is an important food crop, feed, and industrial raw material worldwide. In my country, the planting area and yield of corn have surpassed those of rice, making it the largest food crop. However, due to rapid demand growth, the supply-demand gap and import pressure for corn have increased in recent years. Field weeds compete with crops for survival resources, leading to reduced yields and lower quality. Currently, chemical weeding is the main method of field weed control, offering advantages such as economy, convenience, and efficiency. However, long-term, unreasonable, frequent, and arbitrary use of herbicides not only damages the ecological environment but also leads to the development of weed resistance.

[0003] With the rapid development of transgenic technology in many fields such as crop genetic breeding improvement and ecological environment improvement, the development and application of herbicide-resistant transgenic maize will become an important way to reduce weed damage. Herbicide-resistant transgenic maize is produced by using transgenic biotechnology to transfer genes with herbicide resistance traits into the maize gene sequence through methods such as Agrobacterium tumefaciens-mediated transfer, enabling it to express resistance to specific herbicides. The planting of herbicide-resistant transgenic maize can not only increase maize yield, reduce weed control costs, and increase farmers' income, but also reduce herbicide residue damage to maize and lower environmental pollution.

[0004] A transformation event is a molecular structure consisting of the upstream and downstream flanking regions of the exogenous gene at its insertion site in the genome, and the exogenous gene itself. In transgenic crops, the integration location of T-DNA into the recipient plant's genome is random, but the flanking sequences of the T-DNA insertion site, formed by splicing the left and right end sequences of the T-DNA with the recipient genome sequence for each transgenic event, are unique and serve as specific identifiers of that transgenic event. Therefore, isolating the T-DNA flanking sequences of transgenic plants and establishing specific detection methods based on these flanking sequences can accurately identify different transgenic crops, enabling the protection, detection, and effective supervision and management of the intellectual property rights of transgenic crops and their products. (III) Summary of the Invention

[0005] This invention provides a herbicide-resistant maize transformation event PX424, its specific detection method, and its application. The maize transformation event PX424 of this invention features a single-copy insertion of a foreign gene, stable genetic traits, and high resistance to herbicides such as pyrimisulfuron, glyphosate, glufosinate-ammonium, and nicosulfuron. This invention also clarifies the insertion site of the foreign T-DNA and designs specific detection primers and identification methods, enabling rapid and accurate identification of whether the sample contains DNA molecules from the transgenic maize event PX424.

[0006] The technical solution adopted in this invention is as follows:

[0007] This invention provides a herbicide-tolerant maize transformation event PX424, wherein the transformation event uses the nucleotide sequence shown in SEQ ID NO.1 as the left wing sequence of the exogenous T-DNA and the nucleotide sequence shown in SEQ ID NO.2 as the right wing sequence of the exogenous T-DNA.

[0008] Furthermore, the exogenous T-DNA was inserted into chromosome 1 of the maize genome, and the maize transformation event was deposited in the form of maize seed PX424 (Zea mays L.PX424) at the China Center for Type Culture Collection, accession number: CCTCCNO:P202328, deposit date: June 28, 2023, address: Wuhan University, Wuhan, China.

[0009] Furthermore, the exogenous T-DNA includes three herbicide-resistant genes: the N-Z1 gene, the cp4 epsps gene, and the pat gene. The nucleotide sequence of the N-Z1 gene is shown in SEQ ID NO.3, the nucleotide sequence of the cp4 epsps gene is shown in SEQ ID NO.4, and the nucleotide sequence of the pat gene is shown in SEQ ID NO.5.

[0010] Furthermore, the nucleotide sequences of the exogenous T-DNA, such as SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8, are preferably connected end-to-end in sequence.

[0011] Furthermore, preferably, the DNA sequence of the maize transformation event PX424 is composed of the maize genome sequence SEQ ID NO.1 in the left wing region of the insert sequence, the exogenous T-DNA insert sequence (SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8), and the maize genome sequence SEQ ID NO.2 in the right wing region of the insert sequence, connected in sequence.

[0012] The maize transformation event PX424 described in this invention is a transformation event obtained by using Agrobacterium-mediated transformation, which involves constructing the N-Z1 gene from Bermuda grass, the cp4 epsps gene from Agrobacterium CP4 strain, and the pat gene from Streptomyces viride into the pCAMBIA3300 expression vector and then transforming them into the genome of the recipient maize Hi-II.

[0013] The exogenous T-DNA provided by this invention contains the N-Z1 gene expression cassette, the cp4 epsps gene expression cassette, and the pat gene expression cassette.

[0014] The N-Z1 gene expression cassette provided by this invention includes: a maize ZmUbi promoter for initiating N-Z1 gene expression, the N-Z1 gene, and a CaMV35S terminator for terminating N-Z1 gene expression; the cp4 epsps gene expression cassette includes: a maize ZmUbi promoter for initiating cp4 epsps gene expression, the cp4 epsps gene, and a NOS terminator for terminating cp4 epsps gene expression; the pat gene expression cassette includes: a Scrophularia mosaic virus 35S promoter for initiating pat gene expression, the pat gene, and a NOS terminator for terminating pat gene expression.

[0015] This invention provides specific PCR primers for detecting the maize transformation event PX424. The primers include primer pairs PX424-LB-F and PX424-LB-R for detecting the left wing region, and primer pairs PX424-RB-F and PX424-RB-R for detecting the right wing region. Primer information is shown in Table 1. The primers PX424-LB-F and PX424-LB-R for specific PCR identification of the maize transformation event PX424 detect whether the left side of the exogenous T-DNA is linked to a specific site in the maize genome, while PX424-RB-F and PX424-RB-R detect whether the right side of the exogenous T-DNA is linked to a specific site in the maize genome.

[0016] This invention provides a PCR identification method for the maize transformation event PX424, comprising:

[0017] (1) Extract genomic DNA from the maize sample to be identified;

[0018] (2) Using the extracted genomic DNA as a template, PCR amplification was performed using the primer pairs provided in this invention. The PCR reaction system is shown in Table 2. The primers include primers PX424-LB-F / PX424-LB-R for detecting the left wing region and primers PX424-RB-F / PX424-RB-R for detecting the right wing region.

[0019] (3) Detect the PCR amplification product. If the length of the amplification product is consistent with the theoretical length between the sequences of the PCR primer pair described in the transformation event, it indicates that the sample contains PX424. The amplification product of the primer PX424-LB-F / PX424-LB-R for detecting the left wing region is 787bp, and the amplification product of the primer PX424-RB-F / PX424-RB-R for detecting the right wing region is 862bp.

[0020] Table 1 Primer Information

[0021]

[0022] Table 2 PCR reaction system

[0023]

[0024]

[0025] The PCR reaction program was as follows: denaturation at 94℃ for 5 min, denaturation at 94℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 30 s, for a total of 35 cycles, and a final extension at 72℃ for 7 min.

[0026] The present invention also provides a method for cultivating maize plants tolerant to multiple herbicides containing the maize transformation event PX424, the method comprising: hybridizing maize material containing the maize transformation event PX424 with maize breeding material, and then backcrossing to obtain the maize plants tolerant to multiple herbicides.

[0027] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0028] This invention provides a maize transformation event PX424 resistant to herbicides such as glufosinate, glyphosate, pyrimisulfuron, dimethyl glyphosate, and nicosulfuron, along with its nucleotide sequence, as well as specific primers and methods for detecting the presence of transgenic maize event PX424.

[0029] The transgenic event PX424 provided by this invention is deposited in seed form at the China Center for Type Culture Collection (CCTCC), accession number: CCTCC NO: P202328. PX424 is tolerant to glufosinate, glyphosate, pyrimisulfuron, glyphosate methyl parathion, and nicosulfuron. In hybridization breeding, one, two, or a mixture of these herbicides can be used for transgenic screening. By spraying one, two, or more of these herbicides, plants lacking the specific transgenic maize event PX424 can be effectively eliminated, improving hybridization breeding efficiency. During maize planting, one, two, or a mixture of these herbicides can be used for weed control. Compared to existing technologies, this effectively improves weed control efficiency, reduces the risk of herbicide-resistant weeds, and lowers weed control costs.

[0030] The specific primers and methods provided by this invention for detecting the presence of transgenic maize event PX424 can quickly and accurately identify whether biological samples contain DNA molecules of the specific transgenic maize event PX424. This invention can be used for molecular marker detection of maize transformation event PX424, and is of great significance for traceability and full-process supervision of PX424 research, production, processing and application. (iv) Description of the attached drawings

[0031] Figure 1 This is a schematic diagram of the transformation vector.

[0032] Figure 2 This is a schematic diagram of the PX424 breeding event, a maize transformation event.

[0033] Figure 3 This is a sequence-specific PCR detection image of the left wing of PX424 across three consecutive generations. M: Marker; 1: Non-GMO maize; 2: GMO maize Ruifeng 125; 3: GMO soybean CAL16; 4-6: Different plants of PX424 in the BC3F1 generation; 7-9: Different plants of PX424 in the BC4F1 generation; 10-12: Different plants of PX424 in the BC4F2 generation.

[0034] Figure 4 This is a sequence-specific PCR detection image of the right wing of PX424 across three consecutive generations. M: Marker; 1: Non-GMO maize; 2: GMO maize Ruifeng 125; 3: GMO soybean CAL16; 4-6: Different plants of PX424 in the BC3F1 generation; 7-9: Different plants of PX424 in the BC4F1 generation; 10-12: Different plants of PX424 in the BC4F2 generation.

[0035] Figure 5 Images showing the tolerance of PX424 and CK to glufosinate.

[0036] Figure 6 Images showing the glyphosate tolerance of PX424 and CK.

[0037] Figure 7 Images showing the tolerance of PX424 and CK to pyrimisulfuron.

[0038] Figure 8 Images showing the tolerance of PX424 and CK to glyphosate + nicosulfuron. (V) Detailed Implementation

[0039] The present invention will be further described below with reference to specific embodiments, but this does not limit the present invention in any way.

[0040] Example 1: Obtaining a transformation vector containing exogenous genes

[0041] The PX vector used for maize transformation in this invention has the following spectrum: Figure 1 As shown, the transformation plasmid vector uses pCambia1300 (GenBank: AF234296.1) as the plant transformation vector framework. T-DNA containing expression cassettes for the complete N-Z1 protein, CP4 EPSPS protein, and PAT protein is added to its multiple cloning site region. Specifically, it consists of the following parts:

[0042] The N-Z1 protein expression cassette is defined as follows: N-Z1, driven by the maize polyubiquitin-1 gene promoter (pZmUbi-1) and terminated by the CaMV 35S gene terminator. The CP4 EPSPS protein expression cassette is defined as follows: CP4EPSPS, driven by the maize polyubiquitin-1 gene promoter (pZmUbi-1) and terminated by the Agrobacterium-mediated dicarboxylate synthase (NOS) gene terminator. The PAT protein expression cassette is defined as follows: PAT, driven by the Scrophularia mosaic virus 35S promoter and terminated by the Agrobacterium-mediated dicarboxylate synthase (NOS) gene terminator. The nucleotide sequences of the exogenous T-DNA are shown as SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8 linked together. The names, lengths, and positions of the specific vector components are shown in Table 3. The obtained transformation plasmid was introduced into Agrobacterium LBA4404 using an electric shock method (2500V) to obtain Agrobacterium containing the transformation vector.

[0043] Table 3. Genetic elements contained in exogenous T-DNA

[0044] LB 26 SEQ ID NO.6: 1-26 35S Terminator 185 SEQ ID NO.6: 89-273 N-Z1 1554 SEQ ID NO.6: 280-1833 pZmUbi promoter 2010 SEQ ID NO.6: 1844-3853 NOS Terminator 278 SEQ ID NO.7: 1-277 CP4 EPSPS 1368 SEQ ID NO.7: 278-1645 OsCTP (signal peptide) 222 SEQ ID NO.7: 1646-1867 pZmUbi promoter 2010 SEQ ID NO.7: 1868-3877 pFMV promoter 1420 SEQ ID NO.8: 1-1420 PAT 552 SEQ ID NO.8: 1423-1974 NOS Terminator 278 SEQ ID NO.8: 1978-2255 RB 26 SEQ ID NO.8: 2462-2487

[0045] Example 2: Obtaining the transformant

[0046] Maize genetic transformation was performed using Agrobacterium-mediated transformation, specifically following the method and culture medium formulation reported by Frame et al. (Plant Physiol, 2002, 129:13-22). Glyphosate was used as the screening reagent. The steps are as follows:

[0047] Collect immature embryos (1.0-1.5 mm in size) from corn ears 8-10 days after pollination. Co-culture the Agrobacterium containing the transformation vector constructed in Example 1 with the immature embryos at 22°C for 3-5 days. Transfer the cultured immature embryos to callus induction medium containing 200 mg / L termethin antibiotic (GlaxoSmithKline, USA) and incubate in the dark at 28°C for 10-14 days to kill Agrobacterium. Transfer all callus tissues after induction to selection medium containing 2 mM glyphosate and incubate in the dark at 28°C for 2-3 weeks. After induction, transfer all callus tissues to fresh selection medium containing 2 mM glyphosate and incubate in the dark at 28°C for 2-3 weeks. Transfer the surviving embryogenic tissues to regeneration medium and incubate in the dark at 28°C for 10-14 days, then transfer to fresh regeneration medium and incubate under light at 26°C for 10-14 days. Select fully developed plants and place them on rooting medium. Incubate them at 26°C under light until the roots are fully developed. Transplant the regenerated seedlings after rooting to a greenhouse for growth and propagation, and use them for screening and analysis.

[0048] Example 3: Screening of transformants

[0049] 1. Spray herbicides

[0050] Example 2 produced a total of 480 independent transgenic plants. After hardening off, these 480 T0 generation transformants were transplanted into a greenhouse, where 470 seedlings survived. When the T0 generation transformants reached the 4-5 leaf stage, a compound herbicide of glyphosate, pyrimisulfuron, and glufosinate was sprayed (glyphosate effective dose: 67.5 g / mu; pyrimisulfuron effective dose: 1.8 g / mu; glufosinate effective dose: 30 g / mu). 70 transformants showed no herbicide damage, 350 showed herbicide damage, and 50 transformedants died (Table 4).

[0051] Table 4. Tolerance of T0 generation transformants to glyphosate, pyrimisulfuron-methyl, and glufosinate-ammonium compound herbicides

[0052]

[0053]

[0054] 2. Quantitative PCR

[0055] Quantitative PCR was performed on transformants without phytotoxicity to determine the content of the exogenous gene in 70 surviving transformants, thereby assessing the T-DNA insertion copy number. Transformants with two or more copies were discarded. Plant genomes were extracted from the plants of the above transformants using the CTAB method. The copy number of the CP4EPSPS gene was detected by SYBR Green real-time quantitative PCR to determine the copy number of the exogenous gene. A maize event with a single copy of the CP4EPSPS gene insertion was selected as a reference baseline, and the relative content of the CP4EPSPS gene at the initial stage of the reaction in the above maize transformation events was calculated. zSSIIb (Gene ID: 541656) in the maize genome was used as an internal control gene.

[0056] This example uses the SYBR Green Real-Time PCR Kit (BIO RAD) and the Bio-Rad CFX96. TM The reaction was performed using a real-time PCR instrument, and the results were analyzed using the Ct value comparison method. The system and procedure followed the instructions for the SYBR Green Real-Time PCR Kit. The primer sequences are as follows:

[0057] Table 5 Primers for Quantitative PCR

[0058] SEQ ID NO.13 qSSIIb-3F CGGTGGATGCTAAGGCTGATG SEQ ID NO.14 qSSIIb-4R AAAGGGCCAGGTTCATTATCCTC SEQ ID NO.15 CP4 EPSPS-F GAGCAGACCGCCATTCCCA SEQ ID NO.16 CP4 EPSPS-R GAAGGCCATGCAGGCTATGG

[0059] By analyzing the experimental results of CP4 EPSPS gene copy number, it was confirmed that the exogenous gene had been integrated into the chromosome set of the maize plants tested, among which 32 transgenic maize plants had single-copy insertion of the CP4 EPSPS gene.

[0060] Expression levels were determined in 32 selected single-copy transformants. Leaves were collected from plants at the 12-leaf stage for ELISA detection.

[0061] 3. Detection of target protein expression levels

[0062] The N-Z1 kit used in this study was purchased from Zhongding Biotechnology's protein-specific ELISA detection kit, and the CP4EPSPS and PAT enzyme-linked immunosorbent assay kits were purchased from Shanghai Youlong Biotechnology Co., Ltd.

[0063] N-Z1 reagent kit operation steps:

[0064] 1) Remove the kit from the refrigerated environment in advance and place it at room temperature (20-25℃) for more than 20 minutes to allow all reagents and the required strips to return to room temperature. Shake each liquid reagent well before use.

[0065] 2) Take approximately 30 mg of corn tissue (crush the seeds first), place it in a 2 mL centrifuge tube, add a steel ball, freeze in liquid nitrogen, and grind using a grinder. Add 1000 μL of PBS buffer, incubate at 4°C with shaking for 1 hour, then centrifuge at 12000 rpm for 10 minutes. Collect the supernatant, dilute it a certain factor before detection, and measure the OD. 450 The value is controlled within the measurable range.

[0066] 3) Add 1 mL of double-distilled water to the standard protein, tighten the cap, invert the tube several times to ensure complete dissolution, and then gently mix (concentration 200 ng / mL). Then serially dilute with PBS buffer (Note: Do not perform serial dilution directly in the reaction wells; perform it in EP tubes). It is recommended to prepare the following concentrations: 200, 100, 50, 25, 12.5, 6.25, 3.125, 1.5625, 0.78125, and 0 ng / mL. Use PBS buffer directly as a blank well (0 ng / mL).

[0067] 4) Preparation of washing solution: Dilute the concentrated washing solution in the kit with double-distilled water at a volume ratio of 1:19.

[0068] 5) Biotinylated antibody: Add 20 μL of double-distilled water to the biotinylated antibody and let it dissolve completely. Then, take 1 μL of the biotinylated antibody and dilute it with 10 mL of sample diluent, i.e., dilute 1:10000.

[0069] 6) Streptavidin-HRP: Take 1 μL of Streptavidin-HRP and dilute it with 10 mL of sample diluent, i.e., dilute 1:10000.

[0070] 7) Add 100 μL of PBS buffer (blank control) / standard / sample to each well of the ELISA plate, seal the ELISA plate with Parafilm membrane, and incubate at 37°C for 60 min.

[0071] 8) After the reaction is complete, pour out the liquid in the plate, shake it dry, add 300μL of washing working solution to each well and wash thoroughly 3 times, then pat the liquid in the well dry on absorbent paper.

[0072] 9) Add 100 μL of diluted biotinylated antibody to each well, seal the ELISA plate with Parafilm membrane, and incubate at 37°C for 60 min.

[0073] 10) After the reaction is complete, pour out the liquid in the plate, shake it dry, add 300μL of washing working solution to each well and wash thoroughly 3 times, then pat the liquid in the well dry on absorbent paper.

[0074] 11) Add 100 μL of diluted Streptavidin-HRP to each well, seal the ELISA plate with a Parafilm membrane, and incubate at 37°C for 60 min.

[0075] 12) After the reaction is complete, pour out the liquid in the plate, shake it dry, add 300μL of washing working solution to each well and wash thoroughly 4 times, then pat the liquid in the well dry on absorbent paper.

[0076] 13) Add 100 μL of substrate solution (TMB) to each well, seal the ELISA plate with Parafilm membrane, and incubate at 37°C for about 15 min (shorten the time according to the actual color development, but do not exceed 15 min. Stop incubation when a clear gradient appears in the standard wells).

[0077] 14) Add 100 μL of stop solution to each well to terminate the reaction; the blue color will immediately turn yellow. The order of adding the stop solution should be as similar as possible to the order of adding the substrate solution. Immediately measure the optical density (OD value) of each well using a microplate reader at a wavelength of 450 nm. The microplate reader should be turned on in advance to preheat the instrument and the detection program should be set.

[0078] 15) Based on the OD of the standard sample 450 A standard curve can be plotted using these values. To eliminate systematic errors between measurements, a standard curve is prepared for each sample measurement. The formula for the standard curve of one measurement is: y = 0.5173x + 0.6229(R²). 2 =0.9975).

[0079] 16) The OD of the sample 450 Substitute the value into the standard curve, read the concentration corresponding to the sample from the standard curve, and you can calculate the N-Z1 protein content (μg / g) = sample concentration (ppb) * dilution factor * sample extraction volume (μL) / leaf weight (mg) / 1000.

[0080] CP4 EPSPS kit operation steps:

[0081] 1) Remove the kit from the refrigerated environment and allow it to equilibrate at room temperature (20-25℃) for at least 30 minutes to allow all reagents and the required strips to return to room temperature. Shake well before using each liquid reagent.

[0082] 2) Take 40-50 mg of corn tissue, place it in a 2 mL centrifuge tube, add a steel ball, freeze in liquid nitrogen, and grind using a grinder. Add 600 μL of sample extraction buffer, vortex to mix for 5 min, let stand at room temperature for 5 min, and centrifuge at 12000 rpm for 10 min. Dilute the sample with sample extraction buffer as needed before measurement. Calculate the OD... 450 The value is controlled within the measurable range.

[0083] 3) Dilute the standard to concentrations of 48 ppb, 24 ppb, 12 ppb, 6 ppb, and 3 ppb. Dilute the 20× concentrated wash buffer with deionized water to prepare a 1× working wash solution. Dilute the 11× concentrated enzyme standard solution with enzyme diluent at a volume ratio of 1:10.

[0084] 4) Add 100 μL of sample extraction solution (blank control) / standard / sample to each well of the ELISA plate, gently shake to mix, seal the ELISA plate with Parafilm membrane, and shake on a horizontal shaker in the dark for 45 min at room temperature.

[0085] 5) After the reaction is complete, pour out the liquid in the plate, add 250μL of washing working solution to each well and wash thoroughly 4-5 times, then pat the plate dry on absorbent paper.

[0086] 6) Add 100 μL of enzyme-labeled working solution to each well, gently vortex to mix, seal the ELISA plate with a Parafilm membrane, and incubate at room temperature on a horizontal shaker in the dark for 30 minutes. Repeat step 5.

[0087] 7) Add 100 μL of colorimetric reagent to each well, gently shake to mix, seal the ELISA plate with Parafilm membrane, and shake on a horizontal shaker in the dark for 15 min at room temperature.

[0088] 8) Add 100 μL of stop solution to each well, gently vortex to mix, and measure the OD in a microplate reader within 5 minutes. 450 .

[0089] 9) Based on the OD of the standard sample 450 A standard curve can be plotted using these values. To eliminate systematic errors between measurements, a standard curve is prepared for each sample measurement. The formula for the standard curve of one measurement is: y = 0.0334x + 0.0089(R²). 2 =0.9976).

[0090] 10) The OD of the sample 450 Substitute the value into the standard curve, read the concentration corresponding to the sample from the standard curve, and you can calculate the CP4 EPSPS protein content (μg / g) = sample concentration (ppb) * dilution factor * sample extraction volume (μL) / leaf weight (mg) / 1000.

[0091] PAT kit operation steps:

[0092] Steps 1), 2), 3), 4), and 5) are the same as those for the CP4 EPSPS kit, but the dilution concentrations of the standards are 32 ppb, 16 ppb, 8 ppb, 4 ppb, and 2 ppb.

[0093] 6) Add 100 μL of antibody working solution to each well, gently vortex to mix, seal the ELISA plate with Parafilm, and incubate at room temperature on a horizontal shaker in the dark for 30 min. Repeat step 5.

[0094] 7) Add 100 μL of enzyme-labeled working solution to each well, gently vortex to mix, seal the ELISA plate with Parafilm, and incubate at room temperature on a horizontal shaker in the dark for 30 min. Repeat step 5. The procedure for color development and termination is the same as for the CP4 EPSPS kit.

[0095] 8) A standard curve can be plotted based on the OD450 value of the standard sample. To eliminate systematic errors between each measurement, a standard curve is prepared for each sample measurement. The formula for the standard curve of one measurement is: y = 0.5477x + 0.0605 (R2 = 0.9997).

[0096] 9) Substitute the OD450 value of the sample into the standard curve, read the corresponding concentration of the sample from the standard curve, and then calculate the PAT protein content (μg / g) = sample concentration (ppb) * dilution factor * sample extraction volume (μL) / leaf weight (mg) / 1000.

[0097] Table 6. Expression levels of exogenous proteins in different transformants

[0098]

[0099] Transformants with appropriate expression levels of N-Z1, CP4 EPSPS, and PAT proteins were selected for analysis of exogenous T-DNA insertion sites.

[0100] 4. Analysis of exogenous T-DNA insertion sites in maize transformation events

[0101] (1) Extraction of maize genome

[0102] Genomic DNA was extracted from maize using the CTAB (hexadecyltrimethylammonium bromide) method.

[0103] 1000 mg of young maize leaves from the transformation event were ground into powder in liquid nitrogen and then 0.8 mL of CTAB buffer (20 g / L CTAB, 1.4 M NaCl, 100 mM Tris-HCl, 20 mM EDTA, pH 8.0) preheated in a 65 °C water bath was added. The mixture was thoroughly mixed and then incubated in a 65 °C water bath for 60 min.

[0104] Add an equal volume of chloroform, invert to mix, centrifuge at 12000 rpm for 10 min, and transfer the supernatant to a new centrifuge tube;

[0105] Add 0.7 times the volume of isopropanol, gently agitate the centrifuge tube, centrifuge at 12000 rpm for 1 min, and collect the DNA to the bottom of the tube; discard the supernatant.

[0106] Add 1 mL of 75% ethanol, wash the precipitate, centrifuge at 12000 rpm for 1 min, repeat the washing once, and dry in a clean bench.

[0107] The DNA precipitate was dissolved in an appropriate amount of TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0), and the DNA concentration was measured using Nanodrop. The precipitate was then stored for later use.

[0108] (2) Analysis of flanking DNA sequences

[0109] The flanking sequences on both sides of the insertion site of the exogenous transgenic DNA in the above-mentioned transformation event were determined using the hiTAIL-PCR (High-efficiency thermal asymmetric interlaced PCR) method reported by Liu et al. (Liu, Yao Guang, and Yuanling Chen. 2007. High-efficiency thermal asymmetric interlaced PCR for amplification of unknown flanking sequences. Biotechniques, 43:649-650.). This method uses three nested specific primers combined with degenerate primers for sequential PCR amplification, selectively amplifying the target fragment using different annealing temperatures. Primer sequences are shown in Table 7, PCR reaction systems in Table 8, and PCR reaction conditions in Table 9.

[0110] Table 7 hiTAIL-PCR primer sequences

[0111] LB-SP1 TTTTCCCATAATAATGTGTGAGTAGTTCCC LB-SP2a ACGATGGACTCCAGTCCGGCCCTCCATGTGTTGAGCATATAAGAAACCCTTAG LB-SP3 CTAAAACCAAAATCCAGTACTAAAATCC RB-0b CGTGACTGGGAAAACCCTGGCGTT RB-1b ACGATGGACTCCAGTCCGGCCCAACTTAATCGCCTTGCAGCACATC RB-2b GAAGAGGCCCGCACCGATCGCCCTT AC1 ACGATGGACTCCAGAG LAD1-1 ACGATGGACTCCAGAGCGGCCGCVNVNNNGGAA LAD1-2 ACGATGGACTCCAGAGCGGCCGCBNBNNNGGTT LAD1-3 ACGATGGACTCCAGAGCGGCCGCVVNVNNNCCAA LAD1-4 ACGATGGACTCCAGAGCGGCCGCBDNBNNCGT

[0112] V represents G / A / C, N represents A / T / G / C, B represents G / T / C, and D represents G / A / T.

[0113] Table 8. hiTAIL-PCR reaction system

[0114]

[0115]

[0116] Table 9. HiTAIL-PCR Reaction Conditions

[0117]

[0118] The third-round PCR amplification products were recovered using an Axygen PCR product recovery kit, ligated into the PMD19-T cloning vector (TaKaRa, Code: D102A), transformed into *E. coli*, and the resulting positive clones were sequenced by Hangzhou Youkang Biotechnology Co., Ltd. The obtained sequence information was compared with the maize online database (http: / / www.maizegdb.org) to search for similar maize genome sequences.

[0119] Example 4: Flanking sequences of maize transformation event PX424 and transformant-specific PCR detection

[0120] 1. Flanking sequence analysis

[0121] Fragments containing the left and right flanking regions, obtained by the hiTAIL-PCR method in Example 3, were sequenced. The sequences were then compared and analyzed by BLAST in an online database. The results showed that the sequences of both flanking regions were located on chromosome 1 of maize, indicating that the exogenous gene was integrated into chromosome 1 of maize.

[0122] Analysis of the flanking sequences at the insertion site revealed that the T-DNA left boundary was missing 4 bp, the right boundary was completely missing, and the flanking sequence was missing 15 bp.

[0123] 3. PX424 Specificity Detection

[0124] Reference Figure 2 In Example 3, the T0 generation seedlings of the single-copy transformant screened were backcrossed with the inbred line Ruifeng-1 maize to obtain the F1 generation containing the maize transformation event PX424. The F1 generation containing the maize transformation event PX424 was then backcrossed with Ruifeng-1 maize to obtain the BC1F1 generation containing the maize transformation event PX424. The BC1F1 generation was backcrossed with Ruifeng-1 maize to obtain the BC2F1 generation. The BC2F1 generation was backcrossed with Ruifeng-1 maize to obtain the BC3F1 generation. The BC3F1 generation was backcrossed with Ruifeng-1 maize to obtain the BC4F1 generation. The BC4F1 generation was self-pollinated to obtain the BC4F2 generation.

[0125] Primers were designed targeting the left and right insertion sites of the PX424 maize transformation event, and PCR reactions were performed. Primer information is shown in Table 1, and reaction system is shown in Table 2. The detection targets were: different BC3F1 generation plants of PX424; different BC4F1 generation plants of PX424; and different BC4F2 generation plants of PX424. Negative controls included: non-transgenic maize (Ruifeng-1); transgenic maize Ruifeng 125; and transgenic soybean CAL16.

[0126] PCR results showed that ( Figure 3 and Figure 4The target band was amplified in the PX424 maize transformation event for three consecutive generations. Figure 3 The amplified product of the left wing region is 787 bp in length. Figure 4 The amplified product of the right wing region was 862 bp in length, while the negative control did not amplify the target band. This indicates that the exogenous gene has been integrated into the maize genome and can be stably inherited. Furthermore, primers PX424-LB and PX424-RB, as specific primers for the maize transformation event PX424, can be used to specifically identify the transformation event.

[0127] Example 5: PX424 glufosinate tolerance test

[0128] The experiment employed a single-factor randomized block design. The tested herbicide was glufosinate. The experimental design included four treatments: conventional glufosinate dosage, twice the conventional glufosinate dosage, four times the conventional glufosinate dosage, and no herbicide application (CK). There were three replicates. Plots were 4m x 6m in size, with a plot spacing of 60cm. Double seeds were sown, with a plant spacing of 25cm and a row spacing of 60cm. Spraying was performed on maize at the 3-5 leaf stage. Seedling survival rate, plant height (10 plants randomly selected), and phytotoxicity symptoms were assessed at 1, 2, and 4 weeks post-application. Phytotoxicity symptom grading was based on GB / T 17980.42-2000.

[0129] Experimental data were statistically analyzed and processed using WPS, and analyzed using SPSS data processing system. Differences in emergence rate, seedling survival rate, and damage rate were compared between transgenic herbicide-resistant maize and non-transgenic maize under different treatments. The tolerance level of transgenic herbicide-resistant maize to herbicides was determined. The BC4F2 generation of transgenic maize PX424 screened in Example 3 was used as the experimental subject, and ordinary maize (Zhengdan 958) was used as the control.

[0130] Field trial results for glufosinate showed (Table 10) that the transgenic maize PX424 exhibited high tolerance to glufosinate. Images of glufosinate tolerance in PX424 and the control group (CK) are shown below. Figure 5 As shown.

[0131] Table 10: Tolerance Survey of PX424 to Glufosinate

[0132]

[0133] Example 6: PX424 glyphosate tolerance test

[0134] The experiment employed a single-factor randomized block design. Glyphosate was used as the tested herbicide. The experimental design included four treatments: standard glyphosate dosage, twice the standard glyphosate dosage, four times the standard glyphosate dosage, and no herbicide application (CK). There were three replicates. Plots were 4m x 6m in size, with a plot spacing of 60cm. Double seeds were sown, with a plant spacing of 25cm and a row spacing of 60cm. The herbicide was sprayed at the 3-5 leaf stage of the maize. Seedling survival rate, plant height (10 plants randomly selected), and phytotoxicity symptoms were assessed at 1, 2, and 4 weeks post-application. The phytotoxicity symptom grading was based on GB / T 17980.42-2000.

[0135] Experimental data were statistically analyzed and processed using WPS, and analyzed using SPSS data processing system. Differences in emergence rate, seedling survival rate, and damage rate were compared between transgenic herbicide-resistant maize and non-transgenic maize under different treatments. The tolerance level of transgenic herbicide-resistant maize to herbicides was determined. The BC4F2 generation of transgenic maize PX424 screened in Example 3 was used as the experimental subject, and ordinary maize (Zhengdan 958) was used as the control.

[0136] Field trials of glyphosate showed (Table 11) that the transgenic maize PX424 exhibited high tolerance to glyphosate. Images of glyphosate tolerance in PX424 and the control (CK) are shown below. Figure 6 As shown.

[0137] Table 11: Tolerance Survey of PX424 to Glyphosate

[0138]

[0139] Example 7: PX424 pyrimisulfuron tolerance test

[0140] The experiment employed a single-factor randomized block design. The tested herbicide was pyrimisulfuron. The experimental design included four treatments: conventional pyrimisulfuron dosage, twice the conventional dosage, four times the conventional dosage, and no herbicide application (CK). There were three replicates. Plots were 4m x 6m in size, with a plot spacing of 60cm. Double seeds were sown, with a plant spacing of 25cm and a row spacing of 60cm. The herbicide was sprayed at the 3-5 leaf stage of the maize. Seedling emergence rate, plant height (10 plants randomly selected), and phytotoxicity symptoms were assessed at 1, 2, and 4 weeks post-application. The phytotoxicity symptom grading was based on GB / T 17980.42-2000.

[0141] Experimental data were statistically analyzed and processed using WPS, and analyzed using SPSS data processing system. Differences in emergence rate, seedling survival rate, and damage rate were compared between transgenic herbicide-resistant maize and non-transgenic maize under different treatments. The tolerance level of transgenic herbicide-resistant maize to herbicides was determined. The BC4F2 generation of transgenic maize PX424 screened in Example 3 was used as the experimental subject, and ordinary maize (Zhengdan 958) was used as the control.

[0142] Field trial results of pyrimisulfuron showed (Table 12) that the transgenic maize PX424 exhibited high tolerance to pyrimisulfuron. Images of the tolerance of PX424 and CK to pyrimisulfuron are shown below. Figure 7 As shown.

[0143] Table 12: Tolerance survey of PX424 to pyrimisulfuron.

[0144]

[0145] Example 8: Tolerance test of PX424 glyphosate and nicosulfuron combined herbicide

[0146] The experiment employed a single-factor randomized block design. The tested herbicide was a combination of glyphosate and nicosulfuron. The experimental design included four treatments: conventional doses of glyphosate and nicosulfuron, twice the conventional doses of glyphosate and nicosulfuron, four times the conventional doses of glyphosate and nicosulfuron, and no herbicide application (CK). There were three replicates. The plot size was 4m x 6m, with a plot spacing of 60cm. Double seeds were sown, with a plant spacing of 25cm and a row spacing of 60cm. The herbicide was sprayed at the 3-5 leaf stage of the maize. Seedling emergence rate, plant height (10 plants randomly selected), and phytotoxicity symptoms were assessed at 1, 2, and 4 weeks post-application. The phytotoxicity symptom grading was based on GB / T 17980.42-2000.

[0147] Experimental data were statistically analyzed and processed using WPS, and analyzed using SPSS data processing system. Differences in emergence rate, seedling survival rate, and damage rate were compared between transgenic herbicide-resistant maize and non-transgenic maize under different treatments. The tolerance level of transgenic herbicide-resistant maize to herbicides was determined. The BC4F2 generation of transgenic maize PX424 screened in Example 3 was used as the experimental subject, and ordinary maize (Zhengdan 958) was used as the control.

[0148] Field trials of the glyphosate and nicosulfuron-methyl combined herbicide showed (Table 13) that the transgenic maize PX424 exhibited high tolerance to the combined herbicide. Images depicting the tolerance of PX424 and the control (CK) to the combined herbicide are available in [link to table]. Figure 8 As shown.

[0149] Table 13: Tolerance Survey of PX424 to Glyphosate and Nicosulfuron-methyl Combined Herbicides

[0150]

Claims

1. A DNA sequence of the herbicide-tolerant maize transformation event PX424, characterized in that, The DNA sequence is composed of the maize genome sequence SEQ ID NO.1 (left wing region of the inserted sequence), the exogenous T-DNA insertion sequence, and the maize genome sequence SEQ ID NO.2 (right wing region of the inserted sequence) linked sequentially. The exogenous T-DNA insertion sequence is composed of SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8 linked sequentially. The exogenous T-DNA is inserted into chromosome 1 of the maize genome. The maize transformation event is deposited in the form of maize seed PX424 (Zea mays L.PX424) at the China Center for Type Culture Collection, accession number: CCTCC NO: P202328.

2. A specific PCR identification primer for the herbicide-resistant maize transformation event PX424 as described in claim 1, characterized in that, The primers include primers PX424-LB-F / PX424-LB-R for detecting the left wing region and primers PX424-RB-F / PX424-RB-R for detecting the right wing region; The nucleotide sequences of the primers are as follows: PX424-LB-F: TGCCACGAACATGGAGTCGC; PX424-LB-R:TAGGGTTTCGCTCATGTGTTGAGC; PX424-RB-F: GAAGAGGCCCGCACCGATCGCCCTT; PX424-RB-R:TCCCTTTGAACTGGCCATTGAGGGC.

3. A PCR identification method for the herbicide-resistant maize transformation event PX424 as described in claim 1, characterized in that, The method includes: (1) Extract genomic DNA from the maize sample to be identified; (2) Using the extracted genomic DNA as a template, perform PCR amplification using the primers described in claim 2; (3) Detect the PCR amplification product. If the length of the amplification product is consistent with the theoretical length between the amplification sequences of the primer pair described in claim 2, it indicates that the sample contains PX424.

4. The method as described in claim 3, characterized in that, The amplification product of primers PX424-LB-F / PX424-LB-R for detecting the left wing region is 787 bp in length, and the amplification product of primers PX424-RB-F / PX424-RB-R for detecting the right wing region is 862 bp in length.

5. A method for cultivating multi-herbicide-tolerant maize plants containing the maize transformation event PX424 as described in claim 1, characterized in that, The method is as follows: maize material containing the maize transformation event PX424 is hybridized with maize breeding material, and then backcrossed to obtain the maize plant resistant to multiple herbicides.

Images