Application of rice OsNAC25 gene or its encoded protein in improving rice drought tolerance

Abstract

The present invention belongs to the technical field of rice genetic engineering, and specifically relates to the application of rice OsNAC25 gene or its encoded protein in improving rice drought resistance. The present invention enhances drought resistance of transgenic rice by overexpressing OsNAC25 gene in rice, indicating that OsNAC25 gene or its encoded protein can enhance rice drought resistance and has the potential for production.

Description

Technical Field

[0001] The invention belongs to the technical field of rice genetic engineering, and particularly relates to application of rice OsNAC25 gene or protein encoded by the gene in improving drought resistance of rice. Background Art

[0002] Regarding the regulation of abiotic stress by NAC transcription factors, Ohnishi T et al. transformed soybean NAC-type transcription factor GmNAC20 into the rice genome by Agrobacterium transformation. Transgenic rice plants expressing GmNAC20 showed enhanced tolerance to salinity and cold stress by upregulating abiotic stress response genes. In addition to playing a role in plant adaptation to abiotic stress, OsNAC6 also integrates signals from abiotic and biotic stresses. Arabidopsis NAC gene ATAF1 plays an important role in responding to salt stress and can be used to improve rice salt tolerance. OsNAP is a member of the NAC transcription factor family and functions as a transcriptional activator, playing a role in mediating abiotic stress responses in rice. Abiotic stress-responsive NAC transcription factor SlNAC11 is involved in drought and salt responses in tomato. Compared with WT plants, SlNAC11-RNAi plants have poor tolerance to drought and salt stress. The expression of potato StNAC053 gene is induced by salt stress and drought stress, and its overexpression material can enhance the tolerance of Arabidopsis to salt stress and drought stress by upregulating stress-related genes. StNAC1 gene heterologous expression in Nicotiana benthamiana resulted in overexpression of StNAC1, and its expression was significantly induced under salt stress, which increased the seed germination rate and green leaf rate, and reduced the ROS accumulation and proline content, which improved the salt tolerance of transgenic plants. StNAC1 gene plays a positive regulatory role in plants under salt stress. NAC57 transcription factor responds to salt stress in time and space, and the overexpression material of NAC57 gene improves the salt tolerance of transgenic Arabidopsis by preventing ROS accumulation. Stress is an important factor affecting plant growth, and studying its mechanism of action and molecular mechanism can guide our crop production at the theoretical level. At present, how to improve rice drought tolerance is still the main work in the field of plant molecular research, and the most effective method is to cultivate varieties with excellent traits through molecular genetic means. However, the detailed molecular mechanism by which OsNAC25 transcription factor improves rice drought tolerance is not clear, and there are no reports on OsNAC25 improving rice drought tolerance. Summary of the invention

[0003] The present invention provides an application of rice NAC family transcription factor OsNAC25. Specifically, it is an application of rice OsNAC25 gene or its encoded protein in improving rice drought resistance. Rice OsNAC25 protein encoding gene OsNAC25, its nucleotide sequence is shown in SEQ ID NO.1. The constructed plant overexpression vector pCAMBIA1300-UBI:OsNAC25 was expressed in wild-type Zhonghua 11, and it was found that the drought resistance of the T3 generation of transgenic plants was significantly enhanced compared with the corresponding indicators of wild-type plants, and the drought resistance of the T3 generation of the OsNAC25 gene CRISPR edited strain was consistent with the corresponding indicators of the wild-type plants. It can be seen that the rice OsNAC25 protein encoding gene OsNAC25 described in the present invention is a potential target that can be used as a genetic engineering to improve rice drought resistance, and has important application value.

[0004] The specific technical solutions are as follows:

[0005] The invention provides application of rice OsNAC25 gene or protein encoded by the gene in improving drought resistance of rice.

[0006] The present invention also provides application of rice OsNAC25 gene or protein encoded by the gene in improving drought resistance of rice.

[0007] The nucleotide sequence of the CDs region of the OsNAC25 gene is shown in SEQ ID NO.2, and the amino acid sequence of the protein encoded by the OsNAC25 gene is shown in SEQ ID NO.3.

[0008] The present invention also provides a method for improving drought tolerance of rice, which is to overexpress or superexpress the OsNAC25 gene in rice crops. The nucleotide sequence of the CDs region of the OsNAC25 gene is shown in SEQ ID NO.2.

[0009] Specifically, the following steps are included:

[0010] (1) constructing an OsNAC25 overexpression or superexpression vector;

[0011] (2) The OsNAC25 overexpression or superexpression vector constructed in step (1) is introduced into rice cells to overexpress or superexpress OsNAC25 having a nucleotide sequence in the CDs region as shown in SEQ ID NO.1, and transgenic plants are obtained after cultivation.

[0012] Preferably, the vector is pCAMBIA1300.

[0013] When transforming the recipient plant, the Agrobacterium-mediated transformation method can be used, and the Agrobacterium genetic engineering bacteria can specifically be Agrobacterium EHA105 strain. Step (2) After the OsNAC25 overexpression or superexpression vector is transferred into the Agrobacterium genetic engineering bacteria, it infects rice cells.

[0014] The recipient plant is rice. The rice variety can be japonica rice Nipponbare or ZH11, but is not limited to Nipponbare or ZH11.

[0015] Preferably, the cell source infected by Agrobacterium is callus induced from rice seeds. In addition to callus induced from rice seeds, callus induced from tissue samples obtained from rice plants, or other methods that can cultivate plants after genetic modification are also acceptable.

[0016] The present invention has the following beneficial effects:

[0017] The present invention enhances the drought resistance of transgenic rice compared with wild-type plants by overexpressing or superexpressing the OsNAC25 gene; and when the OsNAC25 gene is knocked out in rice, the drought resistance of the rice is consistent with that of the wild type, indicating that the OsNAC25 gene can improve the drought resistance of rice and has the potential for production application. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Construction and identification of OsNAC25 transgenic and knockout mutants. (A) Schematic diagram of knockout vector and overexpression vector; (B) Quantitative qPCR results of overexpression strains; (C) Sequencing of knockout vector.

[0019] Figure 2 Phenotypic differences of OsNAC25 transgenic materials under drought stress, (A) is a photo of plant phenotypes, (B) is the statistical results of plant survival rate. Among them, ** indicates p < 0.01, and * indicates p < 0.05.

[0020] Figure 3 The difference of SOD content of OsNAC25 under drought stress, (A) SOD content in underground part, (B) SOD content in aboveground part. Among them, ** indicates p < 0.01, and * indicates p < 0.05. DETAILED DESCRIPTION

[0021] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0022] Example 1

[0023] 1. Construction of CRISPR / Cas9 knockout vector

[0024]

[0025] The primer sequences are as follows:

[0026] OsNAC25-Cas1F:AACACCGGACTTAGCATCCC

[0027] OsNAC25-Cas1R: ACCAGGGTACTTGACCTCCT

[0028] 2. Construction of OsNAC25 overexpression vector

[0029] The plant binary expression plasmid pCAMBIA1300-UBI was used to construct an OsNAC25 overexpression vector. Primers OsNAC25-OX-F / R were designed, and the cDNA of Zhonghua 11 was used as a template to amplify the full-length CDS sequence of the OsNAC25 gene (nucleotide sequence as SEQ ID NO.As shown in Figure 2: atggctaacaccggacttagcatccccatggtgaatggtgccacaatccacctcctccctggtttccggttccgtccaactgacgatgagctagtcatcaaatacctctacccccgtgcttttcatgtgccactgccctgtgcgatcatcaccgatgttgacatccatcatcacaacccctgggacatcgtcccagtggcggagagggagaaagggaagcacttcttcacaagaaaggaggtcaagtaccctggtagccgccgtagcaaccgtgttgctggtaatggcttctggagagcagcaggctcggaggtgcccatctattacaaaccagaaggtgctgctaacgacatgctagttgggatgaggcggactctagtgttccactacggaaagtcacgatctgcagagcgcactgaatgggccatgcatgagtttcagcttgctggtgctggtctccttcctcaccctatgatgaggcatgcaaccagcaatggttcagagccaccctgtggctgccttgaagcgacaatcgctaagaaaagtgatggtctctctgcaactcttcgtgccaagcgtgattctgcccctcttatgagaatcatggtagaacccgatagctcatgggtgatctgctgcatctacaagaagaggcagcgtgccccgcctgttgttatccctcctgtcattggcgatgtaggggaagctatcatccctcatgctattggcgatgcaagggaaggccaacttcacttcattgacttcctggggcagccagctcgcaatgatccatcctcgccccatagctgcaccattgacccctcctctttggaggaagggagtgatgagtctgccggtgatggtgaagataaggatggtgatggcatgaatgaagcaaattga, the amino acid sequence of the encoded protein is as shown in SEQ ID NO.At the same time, the pCAMBIA1300-ubi vector was double-digested with KpnI and BamHI to obtain a linearized fragment after recovery, and the full-length CDS of OsNAC25 was ligated with the linearized vector using T4 ligase. The correct overexpression vector was obtained by restriction digestion and sequencing verification: pCAMBIA1300-UBI-OsNAC25. pCAMBIA1300-UBI-OsNAC25 was transformed into Agrobacterium tumefaciens EHA105 competent cells to obtain pCAMBIA1300-UBI-OsNAC25 Agrobacterium bacterial solution.

[0030] The primer sequences are as follows:

[0031] OsNAC25-OX-F: caggtcgactctagaggatccATGGCTAACACCGGACTTAGCA;

[0032] OsNAC25-OX-R:tccaagggcgaattgggtaccATTTGCTTCATTCATGCCATCA.

[0033] 3. Construction of OsNAC25 overexpression strain by Agrobacterium transformation

[0034] In order to obtain knockout and overexpression materials of OsNAC25, the OsNAC25 overexpression vector was transformed into the wild-type Zhonghua 11 variety, and the OsNAC25 knockout vector was transformed into the wild-type Zhonghua 11 (ZH11) variety using Agrobacterium-mediated genetic transformation. The specific steps are as follows:

[0035] 1) Rice callus culture: Select mature and plump rice seeds, about 20 grams, and shell them. On the clean bench, first wash them twice with sterile water. Then, soak the seeds in 75% alcohol for 2 minutes, and then rinse them twice with sterile water again. Sterilize them after each operation. Then, soak the seeds in sodium hypochlorite disinfectant, seal them, and shake them in a shaker for 20 minutes. On the clean bench, rinse the seeds with sterile water until there is no foam. To ensure sterility, place the treated seeds on sterile filter paper and blow dry the surface moisture in the clean bench. Use sterilized tweezers to evenly spread the sterilized seeds on the N6B5 culture medium, make sure to do it on the clean bench, and place the culture dish in a dark room at 28°C for culture. To reduce the risk of seed contamination, be sure to avoid bacterial contamination of the culture medium. During the culture process, ensure that good sterile conditions are maintained, check and record the status of the culture medium, and pay attention to prevent bacterial contamination.

[0036] 2) Agrobacterium infection of callus: The plasmids containing knockout, overexpression and mCherry fusion tags were transferred into Agrobacterium respectively, and then the cultured bacterial solution was collected for centrifugation. The bacteria were resuspended with PHI suspension and the concentration was adjusted to OD600 between 0.08 and 0.1. Subsequently, acetosyringone (As) was added at a ratio of 0.2% (v / v). Next, callus tissue with good growth was collected, placed in a sterile culture bottle, and about 40 ml of pre-prepared PHI Agrobacterium suspension was added, and then allowed to stand at room temperature for 20 minutes, shaking every 5 minutes. Pour out the suspension, place the callus tissue on sterile paper, and dry it on a clean bench. Finally, the callus tissue was transferred to a culture dish with new sterile paper, sealed with a sealing film, and placed in a dark room environment at 19°C for 3 days.

[0037] 3) Screening of resistant callus: The co-cultured callus tissues were transferred to N6B5 screening medium containing 500 mg / L cefotaxime, 400 mg / L carbenicillin and 50 mg / L hygromycin. Most of the callus tissues turned brown about 10 days after screening. The browned callus tissues were removed and the resistant callus tissues were retained for subculture.

[0038] 4) Differentiation and rooting: The positive callus was transferred to a differentiation medium containing 50 mg / L hygromycin B and 250 mg / L carbenicillin on a sterile clean bench. Then, the seedlings growing about 2 cm on the differentiation medium were transferred to a rooting medium containing 50 mg / L hygromycin B and 200 mg / L carbenicillin.

[0039] 5) Seedling strengthening and transplanting: After about two weeks of cultivation, select seedlings about 10 cm tall with well-developed root systems, wash off the culture medium with warm water, and transplant them to the greenhouse.

[0040] The OsNAC25 overexpression strain was tested by PCR using hygromycin primers (hygF / hygR). The results showed that among the 17 randomly selected transgenic plants, 8 were positive for hygromycin, which preliminarily indicated that the pCAMBIA1300-UBI-OsNAC25 overexpression vector had been successfully transferred into rice plants ( Figure 1 ).

[0041] The primer sequences are as follows:

[0042] hygF: 5′-GTGCTTGACATTGGGGAGTT-3′;

[0043] hygR: 5′-GATGTTGGCGACCTCGTATT-3′.

[0044] Twenty-eight OsNAC25 knockout transgenic lines were obtained by CRISPR / Cas9 technology. A total of 27 positive lines were detected by amplifying the hygromycin gene fragment (primers hygF / hygR). After multiple generations of self-pollination, the target fragment containing the target site was amplified by primers Cr-OsNAC25-F / R for knockout type detection. Two homozygous OsNAC25 knockout lines were obtained after removing the transgenic background: one with 1 base inserted (named cr-OsNAC25-10) and the other with 14 bases missing (named cr-OsNAC25-16) ( Figure 1 ).

[0045] The detection primer sequences are as follows:

[0046] Cr-OsNAC25-F: 5′-ACACATAGAAACAAGAAAGCCAGGC-3′;

[0047] Cr-OsNAC25-R: 5′-CAAATCAACAAGCTCTGAGCAACA-3′.

[0048] Example 2

[0049] Overexpression of OsNAC25 improves plant survival under severe drought stress

[0050] Through qPCR quantitative results, we found that OsNAC25 may be involved in regulating the development of seedling plants under drought stress, so we subjected the transgenic materials of ZH11 and OsNAC25 to drought stress at the seedling stage. The preliminary experiment screened the concentration of PEG4000 and found that although PEG could inhibit the growth of OsNAC25 transgenic materials, there was no significant difference between the knockout strain and the overexpression strain. Then we directly did not provide water to the plants at the two-leaf and one-heart stage, and carried out severe drought stress treatment. From 24h, the plants began to show symptoms of leaf wilting and yellowing, and at 48h, there were obvious phenotypic differences between the OsNAC25 overexpression material and the knockout material. The OsNAC25 knockout materials and ZH11 plants were significantly worse than the OsNAC25 overexpression materials and showed a large number of deaths, while the OsNAC25 overexpression materials (OE-OsNAC25-2 and OE-OsNAC25-16) showed good growth and only a small number of plants died (e.g. Figure 2 -A). Then the drought-stressed materials were rehydrated and the plants were allowed to recover for a few days. The survival rates of the OsNAC25 knockout, overexpression materials and ZH11 plants were counted. The survival rate of the OsNAC25 overexpression materials was significantly higher than that of ZH11 and knockout materials (e.g. Figure 2 -B). The results showed that overexpression of OsNAC25 could significantly improve the survival rate of plants under severe drought stress.

[0051] Example 3 Effect of drought stress on SOD content of OsNAC25 material

[0052] Superoxide dismutase (SOD) is widely present in plant cells and can catalyze the dismutation reaction of superoxide anions to generate H 2 O 2 and O 2 SOD content plays an important role in the biological antioxidant process. Samples were taken when the phenotype of OsNAC25 under drought stress was most obvious, and the SOD content was measured. The results are as follows Figure 3First, the aboveground SOD content, the average SOD content of CR-OsNAC25-10 strain was 19.119U / g, the average SOD content of CR-OsNAC25-16 strain was 19.74U / g, the average SOD content of ZH11 strain was 16.23U / g, the average SOD content of OE-OsNAC25-2 strain was 12.25U / g, and the average SOD content of OE-OsNAC25-16 strain was 12.01U / g. The average SOD content of the underground roots was 2.069U / g in CR-OsNAC25-10, 2.891U / g in CR-OsNAC25-16, 3.673U / g in ZH11, 1.091U / g in OE-OsNAC25-2, and 0.514U / g in OE-OsNAC25-16. Compared with ZH11, the aboveground SOD content of OE-OsNAC25-2 and OE-OsNAC25-16 was significantly reduced by 32.48% and 35.1% respectively, and the underground SOD content was significantly reduced by 236.7% and 614.6% respectively compared with ZH11. Compared with ZH11, the SOD content in the aboveground parts of CR-OsNAC25-10 and CR-OsNAC25-16 strains increased by 15.11% and 17.78%, respectively, and the SOD content in the underground parts was significantly reduced compared with ZH11, which was reduced by 77.52% and 27.05%, respectively.

Claims

1. Rice OsNAC25 The use of a gene or an OsNAC25 protein in improving drought tolerance of rice is characterized in that: Overexpression in rice OsNAC25 gene or OsNAC25 protein, the rice OsNAC25 The nucleotide sequence of the gene is shown in SEQ ID NO.1 or SEQ ID NO.2; The amino acid sequence of the OsNAC25 protein is shown in SEQ ID NO.

3. OsNAC25 Genetically encoded.

2. A method for improving drought tolerance of rice, characterized in that: Overexpression or overexpression in rice plants OsNAC25 Gene, OsNAC25 The nucleotide sequence of the gene is shown in SEQ ID NO.1 or SEQ ID NO.

2.

3. The method according to claim 2, characterized in that The following steps are involved: (1) OsNAC25 Genes were connected to plasmids to construct OsNAC25 Gene overexpression or overexpression vector; (2) Convert the OsNAC25 The gene overexpression or overexpression vector is introduced into rice cells, and transgenic plants are obtained after cultivation.

4. The method according to claim 3, characterized in that The plasmid vector described in step (1) is a binary expression vector.

5. The method according to claim 3, characterized in that: In step (2), OsNAC25 After the gene overexpression or overexpression vector is transferred into Agrobacterium genetic engineering bacteria, it infects rice cells.

6. The method according to claim 5, characterized in that The Agrobacterium genetic engineering bacteria is Agrobacterium EHA105 strain.

7. The method according to claim 6, characterized in that In step (2), the cell source of rice infected by the genetically engineered Agrobacterium is the callus tissue of rice seeds.

8. Rice OsNAC25 The use of a gene or an OsNAC25 protein in cultivating drought-tolerant rice is characterized in that: Overexpression in rice OsNAC25 gene or OsNAC25 protein, the rice OsNAC25 The nucleotide sequence of the gene is shown in SEQ ID NO.1 or SEQ ID NO.2; The amino acid sequence of the OsNAC25 protein is shown in SEQ ID NO.

3. OsNAC25 Genetically encoded.

Images