Engineered strain for high-yield nmn production and application thereof

Abstract

The present application relates to engineering strains, and discloses a stable high-yield nicotinamide mononucleotide engineering strain and application thereof. The nicotinamide mononucleotide metabolic pathway with nicotinamide as a synthetic precursor is modified from three aspects of improving the supply of synthetic precursors, rationally modifying the NMN degradation pathway and enhancing the energy supply of the synthesis pathway, so as to improve the endogenous NMN accumulation in Escherichia coli. Through optimization of co-expression strategy and combination of promoter engineering technology, an engineering strain E. coli-NMN capable of efficiently producing nicotinamide mononucleotide is obtained, and the yield of NMN reaches 2.7 g / l. The strain has wide application prospects in the fields of food, medicine, health care products and the like.

Description

Technical Field

[0001] This invention pertains to genetically engineered bacteria, specifically a high-NMN-producing strain and its applications. Background Technology

[0002] β-nicotinamide mononucleotide (NMN) is a biologically active nucleotide that plays a vital role in cell proliferation and function. In recent years, it has become a research hotspot in the field of physiological medicine and a valuable raw material for the pharmaceutical, functional food, and cosmetic industries.

[0003] NMN exerts its physiological functions in the human body by being converted into NAD+. NAD+ is an essential coenzyme for biological tissues (Shinichiro S, et al. Metab. Eng., 2021; 65: 166-177). During biological oxidation, it can transfer hydrogen, activate multi-enzyme systems, promote the synthesis and metabolism of nucleic acids, proteins, and polysaccharides, improve substance transport and regulation, and enhance metabolic function. It is crucial for regulating cellular aging and maintaining normal bodily functions. However, NAD+ has a large molecular weight and cannot be directly absorbed and utilized by cells. NMN, on the other hand, is a natural compound with a smaller molecular weight that can be effectively absorbed by cells. Furthermore, as the most direct and efficient precursor to NAD+, NMN can rapidly penetrate cell membranes after entering the body, promoting the natural synthesis of NAD+ and quickly and efficiently increasing the body's NAD+ levels, thereby promoting cellular energy metabolism and the normal operation of various biological processes. Recent studies have revealed that NMN has enormous therapeutic potential, showing promising therapeutic effects in age-related chronic diseases such as diabetes, cardiovascular problems, and cognitive impairment (Soma M, et al. Mol. Biol. Rep., 2022;49: 9737-9748). With a deeper understanding of NMN and increasing attention to anti-aging and healthy longevity, the future demand for NMN is expected to be substantial.

[0004] Due to the complexity and high cost of chemical synthesis of NMN, biosynthesis of NMN has become an alternative approach. Escherichia coli is widely used in the modification of high-yield NMN strains due to its clear genetic background, ease of operation and regulation, simple culture requirements, and short growth cycle. There are three main biosynthetic pathways for NMN (Huang ZS, et al. ACS.Synthetic. Biology. vol., 11: 2979-2988): (1) direct biosynthesis of NMN from nicotinamide and PRPP via NAMPT; (2) biosynthesis of NMN from nicotinic acid via nicotinic acid phosphoribosyltransferase; and (3) synthesis of NMN via phosphorylation of nicotinamide nucleoside. However, when nicotinic acid is added to the culture medium as a precursor, it makes the medium acidic, thus affecting the bio-metabolism of Escherichia coli. Furthermore, nicotinic acid is only slightly soluble in water, limiting the development of large-scale production. Using nicotinamide nucleoside as a precursor results in relatively high costs, which is not conducive to industrial production. Using nicotinamide as a precursor for NMN synthesis can avoid the impact on culture medium pH and biological metabolism, and it is relatively inexpensive, thus better meeting the needs of large-scale production.

[0005]

[0006] As shown in the formula above, nicotinamide phosphoribosyltransferase (NAMPT) catalyzes the condensation of nicotinamide and PRPP into β-nicotinamide mononucleotide (NMN). However, the lack of endogenous NAMPT in *E. coli* limits the high production capacity of NMN. Furthermore, high NMN production is often constrained by multiple factors, such as insufficient supply of the required precursor PRPP, energy shortages, and inhibition of NMN levels by key enzyme genes in the degradation pathway. If regulation remains at the level of a single factor, NMN levels are difficult to increase. Based on the foregoing, existing technologies struggle to achieve stable high NMN production. Summary of the Invention

[0007] This study aims to construct an NMN metabolic pathway in *E. coli* using nicotinamide as a synthetic precursor. By enhancing the supply of the synthetic precursor, knocking out genes related to the degradation pathway, and enhancing the energy supply for the synthetic pathway, NMN accumulation in *E. coli* is achieved. Simultaneously, by combining co-expression strategies and promoter engineering techniques, the high-yield nicotinamide mononucleotide (NMN) production capacity of the engineered strain *E. coli*-NMN is further optimized. The specific technical solutions adopted in this invention to achieve the above objectives are as follows:

[0008] 1) The nicotinamide phosphoribosyltransferase is VsNAMPT derived from Variovorax sp. (nucleotide sequence as shown in SEQ ID NO:1).

[0009] 2) Construction of plasmids using nicotinamide phosphoribosyltransferase.

[0010] 3) Optimize the co-expression strategy of nicotinamide phosphoribosyltransferase gene and PRPP synthase gene, including single plasmid co-expression and fusion expression.

[0011] 4) Starter project: Replace the T7 starter with starters PL1118, PL1744, PL277, and PUTRssrA-PUTRinfC-rplT respectively.

[0012] 5) Nicotinamide phosphoribosyltransferase was expressed in E. coli BL21(DE3) to construct a coenzyme NMN metabolic pathway with nicotinamide as a synthetic precursor. This heterologous expression host is only an example and does not limit the scope of the present invention. Nicotinamide phosphoribosyltransferase can also be expressed in lactic acid bacteria, streptomyces, yeast, Bacillus subtilis, etc.

[0013] 6) Enhance the supply of NMN synthesis precursors

[0014] Overexpression of the prs gene (nucleotide sequence shown in SEQ ID NO:2) encoding 5-phosphoribose-1-pyrophosphate (PRPP) synthase increases intracellular PRPP concentration and promotes NMN synthesis.

[0015] 7) Knock out NMN degradation-related genes to achieve NMN accumulation.

[0016] By using CRISPR-Cas9 gene editing technology to modify E. coli BL21(DE3), deoD, ushA, pncC and nadR were knocked out, blocking the NMN degradation pathway.

[0017] 8) Enhance the energy supply of the NMN synthesis pathway to achieve NMN accumulation.

[0018] By using CRISPR-Cas9 gene editing technology to modify E.coli BL21(DE3), knocking out amn and add, the adenine metabolic pathway is regulated, ATP is accumulated, and energy is provided for NMN synthesis.

[0019]

[0020] The reaction formula of this invention

[0021] The application of the high-yield NMN engineered strain is characterized by using nicotinamide as a donor to synthesize NMN through the high-yield nicotinamide mononucleotide engineered strain.

[0022] Beneficial effects:

[0023] This invention utilizes bioinformatics and data mining techniques to obtain a novel nicotinamide phosphoribosyltransferase (NAMPT) and successfully heterologously express it in *E. coli*. Through analysis of the NMN synthesis regulatory network, this invention employs multiple strategies to enhance the synthesis level of endogenous NMN in *E. coli*. First, by enhancing the supply of the precursor PRPP, more raw materials are provided for NMN synthesis. Second, by knocking out key enzyme genes related to the NMN degradation pathway, the degradation pathway of NMN is blocked, thereby increasing its accumulation level. Third, by enhancing the energy supply for the NMN synthesis pathway, more energy is provided for NMN synthesis. Finally, by optimizing the co-expression strategy and combining it with promoter engineering techniques, an engineered strain capable of high-yield nicotinamide mononucleotide (NMN) production was constructed.

[0024] Specifically:

[0025] This invention heterologously expresses nicotinamide phosphoribosyltransferase derived from Variovorax sp. in Escherichia coli, modifying the NMN metabolic pathway in E. coli using nicotinamide (NAM) as a synthetic precursor. Compared to other reported engineered strains synthesizing nicotinamide mononucleotides, the stable and high-yielding nicotinamide mononucleotide engineered strain constructed in this invention employs a multi-system combination optimization of the NMN metabolic system using nicotinamide as a synthetic substrate. Nicotinamide is inexpensive, and the addition of nicotinic acid avoids the impact of culture medium pH and biological metabolism, overcoming the constraint of nicotinic acid's slight solubility, and better meeting the needs of large-scale production.

[0026] This invention, based on the multi-system combination optimization of the NMN metabolic system using nicotinamide as a synthetic substrate, incorporates new considerations combining optimized co-expression strategies and promoter engineering, further achieving efficient accumulation of endogenous NMN in Escherichia coli. Ultimately, a stable and high-yielding engineered strain of nicotinamide mononucleotide, E. coli-NMN, was obtained, significantly improving the production efficiency of NMN and demonstrating potential for industrial-scale NMN production. Detailed Implementation

[0027] The specific steps of the present invention are illustrated below through examples, but the scope of the present invention is not limited to these examples.

[0028] The nucleotide sequence mentioned in this invention was synthesized by Genewiz.

[0029] Example 1: Detection of NMN content using fluorescence method

[0030] The principle of NMN content detection by fluorescence method: NMN undergoes a condensation reaction with acetophenone under alkaline conditions, and then is treated with acid to obtain a fluorescent 2,7-naphthylpyridine derivative. This derivative has the strongest fluorescence intensity at excitation light of 382 nm and emission light of 445 nm. The fluorescence is measured by a Tecan multi-functional microplate reader, thereby detecting the NMN content.

[0031] Establishment of the standard curve: A 32 mg / L NMN solution was prepared using NMN standard, and then diluted to obtain a series of NMN standard solutions with concentrations of 0.5 mg / L, 1 mg / L, 2 mg / L, 4 mg / L, 8 mg / L, 16 mg / L, and 32 mg / L. These standard solutions were added to the above fluorescence reaction system, and fluorescence was measured using a Tecan multi-mode microplate reader at excitation light of 382 nm and emission light of 445 nm. The resulting standard curve of fluorescence intensity versus NMN concentration was y = 2539.6x + 49.207 (R² = 0.9964).

[0032] Table 1. Fluorescence reaction system

[0033]

[0034] NMN extraction from samples: For extracellular NMN extraction, after bacterial culture, 1 mL of culture was centrifuged at 15700 g for 5 min at 4℃, and the supernatant was collected for analysis. For intracellular NMN extraction, the precipitate was resuspended in 1 mL of ultrapure water, and the mixture was ultrasonically disrupted (ice bath, power 120 W. Ultrasonication for 2 s, interval 4 s, repeated 30 times), centrifuged at 15700 xg for 5 min at 4℃, and the supernatant was collected for analysis. The fluorescence intensity of the intracellular and extracellular NMN solutions was detected by fluorescence method, and the NMN concentration was determined using a standard curve.

[0035] Example 2: Gene Knockout Strategy of CRISPR / Cas9 Gene Editing System

[0036] The principle of the knockout strategy is as follows: The upstream and downstream homologous arms of the gene to be knocked out are introduced into E. coli BL21(DE3), and the gene of E. coli BL21(DE3) is deleted by homologous recombination through gene editing technology.

[0037] Preparation of E. coli BL21(DE3) / pCas electrocompetent cells: pCas was plasmidized and transformed into E. coli BL21(DE3) competent cells, plated onto solid LB medium (containing 50 μg / mL kanamycin), and cultured at 30℃ for 8-12 h; single colonies were selected and inoculated into liquid LB medium containing kanamycin, and cultured at 30℃ and 220 rpm for 12 h as seed culture; the seed culture was transferred to 50 mL medium at an inoculation rate of 2%, and cultured at 30℃ and 220 rpm until the OD600 reached 0.1-0.2, L-arabinose was added to a final concentration of 100 mM to induce culture until the OD reached 0.5-0.6, and the cells were harvested by centrifugation at 5000 rpm for 10 min to prepare chemically competent cells. After washing twice with chemically competent cell treatment solution, the cells were resuspended in 2 mL of treatment solution, aliquoted into 1.5 mL EP tubes, and stored at -80℃.

[0038] Table 2 Preparation of treatment solution for chemically converted competent cells

[0039]

[0040] Preparation of homologous arm fragments upstream and downstream of the gene to be knocked out: The genome sequence of Escherichia coli BL21(DE3) was queried in GenBank (GenBank number: NC_012971.2). The upstream and downstream 500 bp of the gene to be knocked out were selected as homologous arms. Primers were designed and PCR was performed using the Escherichia coli BL21(DE3) genome as a template to obtain the upstream 500 bp homologous arm C1 and the downstream 500 bp homologous arm C2 of the gene to be knocked out. C1 and C2 were ligated using overlap PCR to obtain the upstream and downstream homologous arm fragments of the gene to be knocked out.

[0041] The sgRNA of the gene to be knocked out was designed using an online website (http: / / chopchop.cbu.uib.no / ), and primers N20-F / N20-R for the sgRNA were designed using snapgene software. The designed sgRNA sequence was introduced into primers N20-F / N20-R, and reverse PCR was performed in a 25 μl system using pTargetF as a template to obtain pTargetF containing sgRNA. After preliminary verification by agarose gel electrophoresis, the product was recovered using a gel extraction kit. The gel-recovered product was self-ligated using a seamless cloning kit. The ligated plasmid was transformed into E. coli DH5α competent cells, and the plasmid was extracted using a plasmid extraction kit. Sequencing verification was performed, and the correctly sequenced plasmid was named pTargetF-sgRNA.

[0042] The upstream and downstream homologous arm fragments of the gene to be knocked out and the pTargetF plasmid containing the sgRNA of the gene to be knocked out were transformed into E. coli BL21(DE3) / pCas and plated on solid LB plates (containing 300 μg / mL streptomycin and 50 μg / mL kanamycin) and incubated at 30°C for 16–24 h. Single clones were picked and cultured in LB liquid medium at 30°C and 220 rpm for 12–14 h. Genomic DNA was extracted according to the Novizan Genomic DNA Extraction Kit instructions and verified by PCR. If the target band size was correct, it was recovered using a DNA gel extraction kit and sequenced to verify the knockout results.

[0043] To further knock out other genes from the already knocked-out strains, pTargetF needs to be eliminated within the bacteria: Inoculate the knocked-out strains into liquid LB containing 50 μg / mL kanamycin, add IPTG to a final concentration of 0.5 mM to induce Cas9 protein cleavage of the pTargetF plasmid, culture at 30℃ and 220 rpm for 12-14 h, passage twice, and use the plate printing method to screen for colonies where pTargetF has been eliminated, preparing transcompetent cells for the next gene editing.

[0044] If further gene editing is not required, pCas needs to be eliminated after eliminating the pTargetF plasmid: Inoculate the pTargetF-eliminated strain into antibiotic-free liquid LB, culture at 42℃ and 220 rpm for 12-14 h, passage twice, and screen for pCas-eliminated colonies using the plate printing method, and preserve them for later use.

[0045] Example 3 Construction of a stable, high-yield NMN engineered strain E. coli BL21(DE3)-ΔdeoD

[0046] Following the gene knockout strategy of the CRISPR / Cas9 gene editing system described in Example 2, deoD (nucleotide sequence shown in SEQ ID NO:9) in E. coli BL21(DE3) was knocked out, and positive clones were screened to obtain strain E001 E. coli BL21(DE3)ΔdeoD. E. coli BL21(DE3) and E001 were separately inoculated into LB medium and cultured at 37°C and 220 rpm for 24 hours. NMN content was detected according to the method described in Example 1. The intracellular NMN content of strain E001 reached 3.2 mg / L, which was 1.7 times higher than that of the control group E. coli BL21(DE3).

[0047] Example 4: Construction of a stable, high-yield NMN engineered strain, E. coli BL21(DE3)-ΔdeoDΔushA

[0048] Following the gene knockout strategy of the CRISPR / Cas9 gene editing system described in Example 2, ushA (nucleotide sequence shown in SEQ ID NO: 10) was knocked out on strain E001, and positive clones were screened to obtain strain E002 E. coli BL21(DE3)ΔdeoDΔushA. E. coli BL21(DE3) and E002 were inoculated into LB medium and cultured at 37°C and 220 rpm for 24 hours. NMN content was detected according to the method described in Example 1. The intracellular NMN content of strain E002 reached 4.5 mg / L, which was 2.4 times higher than that of the control group.

[0049] Example 5: Construction of a stable, high-yield NMN engineered strain, E. coli BL21(DE3)ΔdeoDΔushAΔnadR

[0050] Following the gene knockout strategy of the CRISPR / Cas9 gene editing system described in Example 2, nadR (nucleotide sequence shown in SEQ ID NO:11) was further knocked out from strain E002, and positive clones were screened to obtain strain E003 E. coli BL21(DE3)ΔdeoDΔushA ΔnadR. E. coli BL21(DE3) and E003 were inoculated into LB medium and cultured at 37°C and 220 rpm for 24 hours, respectively. NMN content was detected according to the method described in Example 1. The intracellular NMN content of strain E003 reached 6.1 mg / L, which was 3.3 times higher than that of the control group.

[0051] Example 6 Construction of a stable, high-yield NMN engineered strain, E. coli BL21(DE3)ΔdeoDΔushAΔnadRΔpncC

[0052] Following the gene knockout strategy of the CRISPR / Cas9 gene editing system described in Example 2, pncC (nucleotide sequence shown in SEQ ID NO:12) was further knocked out based on strain E003, and positive clones were screened to obtain strain E004 E. coli BL21(DE3)ΔdeoDΔushAΔnadRΔpncC. E. coli BL21(DE3) and E004 were inoculated into LB medium and cultured at 37°C and 220 rpm for 24 hours. NMN content was detected according to the method described in Example 1. The intracellular NMN content of strain E004 reached 7.6 mg / L, which was 4.1 times higher than that of the control group.

[0053] Example 7 Construction of a stable, high-yield NMN engineered strain E. coli BL21(DE3)ΔdeoDΔushAΔnadRΔpncCΔamn

[0054] Following the gene knockout strategy of the CRISPR / Cas9 gene editing system described in Example 2, amn (nucleotide sequence as shown in SEQ ID NO:13) was further knocked out based on strain E004, and positive clones were screened to obtain strain E005 E. coli BL21(DE3) ΔdeoDΔushAΔnadRΔpncCΔamn. E. coli BL21(DE3) and E005 were inoculated into LB medium and cultured at 37°C and 220 rpm for 24 hours, respectively. The NMN content was detected according to the method described in Example 1. The intracellular NMN content of strain E005 reached 9.1 mg / L, which was 4.9 times higher than that of the control group.

[0055] Example 8: Construction of a stable, high-yield NMN engineered bacterium, E. coli BL21(DE3)ΔdeoDΔushAΔnadRΔpncCΔamnΔadd

[0056] Following the gene knockout strategy of the CRISPR / Cas9 gene editing system described in Example 2, add (nucleotide sequence as shown in SEQ ID NO:14) was further knocked out from strain E005, and positive clones were screened to obtain strain E006 E. coli BL21(DE3) ΔdeoDΔushAΔnadRΔpncCΔamnΔadd. E. coli BL21(DE3) and E006 were inoculated into LB medium and cultured at 37°C and 220 rpm for 24 hours. NMN content was detected according to the method described in Example 1. The intracellular NMN content of strain E006 reached 11.3 mg / L, which was 6.1 times higher than that of the control group.

[0057] Table 3. sgRNA sequences of different genes

[0058]

[0059] Example 9: Construction of the prs overexpression vector (pET22b-pPrs)

[0060] prs encodes 5-phosphoribose-1-pyrophosphate (PRPP) synthase, which catalyzes the synthesis of NMN from 5-phosphoribose-1-pyrophosphate (PRPP) and nicotinamide (NAM). Therefore, overexpression of prs can lead to the accumulation of NMN.

[0061] Table 3. Plasmid digestion system construction

[0062]

[0063] Using the E. coli BL21(DE3) genome as a template, prs (nucleotide sequence shown in SEQ ID NO:2) was amplified by PCR. The prs fragment and pET22b were digested with Nde I and BamH I, respectively. After incubation at 37°C for 2 h, the DNA was verified by agarose gel electrophoresis. The correct DNA product was recovered and ligated overnight at 16°C.

[0064] Table 4 Construction of plasmid enzyme ligation system

[0065]

[0066] The overnight enzyme-linked polymerase chain product was transformed into DH5α, and single clones were picked and sent to Genewiz for sequencing. Single clones containing the correct expression plasmid pET22b-PRS were selected. pET22b-PRS was transformed into E006 to obtain engineered strain E007. E007 was inoculated into LB medium (containing 100 μg / mL ampicillin) and cultured overnight at 37°C with shaking at 220 rpm to obtain the corresponding seed culture. The seed culture was transferred to fresh LB medium (containing 100 μg / mL ampicillin) at a 1% inoculation rate and cultured at 37°C until OD2007. 600 When the concentration of NMN was 0.8 ± 0.1, IPTG was added to bring the final concentration to 0.2 mM. The cells were induced and cultured at 37°C for 24 hours. The NMN content was then detected according to the method described in Example 1. The intracellular NMN content of E007 cells was measured to be 27.2 mg / L, which was 2.4 times higher than that of E006.

[0067] Example 10 Functional expression of nicotinamide phosphoribosyltransferase engineered bacteria (E. coli-pVs)

[0068] VsNAMPT is a nicotinamide phosphoribosyltransferase derived from Variovorax sp. (amino acid sequence shown in SEQ ID NO:1). Its encoding gene was synthesized by a commissioned team. The expression plasmid pET22b-VsNAMPT was constructed according to the plasmid construction strategy described in Example 9 and transformed into E. coli BL21(DE3) to obtain the engineered strain E. coli-pVs.

[0069] E. coli-pVs ​​were inoculated into LB medium (containing 100 μg / mL ampicillin) and cultured overnight at 37°C with shaking at 220 rpm to obtain the corresponding seed culture. The seed culture was then transferred to fresh LB medium (containing 100 μg / mL ampicillin) at a 1% inoculation rate and cultured at 37°C until OD500. 600When the concentration of VsNAMPT was 0.8 ± 0.1, IPTG was added to bring the final concentration to 0.2 mM, and the cells were induced at 37°C for 24 hours. SDS-PAGE analysis showed that VsNAMPT was expressed in soluble form, with a soluble expression rate of 42.4%.

[0070] After induction of expression, E. coli-pVs ​​cells were collected, diluted and resuspended in 0.05 M Tris-HCl buffer (pH 7.5), and nicotinamide (1.5 g / L) was added to construct a whole-cell biosynthesis system. After reacting at 37°C for 12 hours, the NMN content was detected using the fluorescence method described in Example 1. The results showed that VsNAMPT could catalyze the conversion of nicotinamide to NMN with a conversion rate of 76.3%.

[0071] Example 11: Optimizing the co-expression strategy of Prs and VsNAMPT

[0072] Fusion co-expression: Based on the successfully constructed plasmids pET22b-PRS and pET22b-VsNAMPT, upstream and downstream primers were designed, and a linker sequence (GGCGGCGGCGGCGGCTCG GGCGGCGGCGGCGGCTCG) was added between each gene. Using overlap PCR, pET22b-VsNAMPT-linker-PRS was obtained and transformed into strain E006 to obtain engineered strain E008. E008 was inoculated into LB medium (containing 100 μg / mL ampicillin) and cultured overnight at 37°C with shaking at 220 rpm to obtain the corresponding seed culture. The seed culture was then transferred at a 1% inoculation rate to fresh LB medium (containing 100 μg / mL ampicillin) and cultured at 37°C until OD2000. 600 When the concentration of NMN was 0.8 ± 0.1, IPTG was added to bring the final concentration to 0.2 mM, and nicotinamide (1.5 g / L) was added simultaneously. The cells were induced and cultured at 37°C for 24 hours, and the NMN content was detected according to the method described in Example 1. The intracellular NMN content of E008 cells was measured to be 263.8 mg / L, which was 9.7 times higher than that of E007.

[0073] Single plasmid co-expression: Based on the successfully constructed plasmids pET22b-PRS and pET22b-VsNAMPT, upstream and downstream primers were designed, and an SD-AS sequence (AGAAGGAGATATACA) was added between each gene. Using overlap PCR, pET22b-VsNAMPT-SD-AS-PRS was obtained, which was then transformed into strain E006 to obtain engineered strain E009. E009 was inoculated into LB medium (containing 100 μg / mL ampicillin) and cultured overnight at 37°C with shaking at 220 rpm to obtain the corresponding seed culture. The seed culture was then transferred at a 1% inoculation rate to fresh LB medium (containing 100 μg / mL ampicillin) and cultured at 37°C until OD2000. 600 When the concentration of NMN was 0.8 ± 0.1, IPTG was added to bring the final concentration to 0.2 mM, and nicotinamide (1.5 g / L) was added simultaneously. The cells were induced and cultured at 37°C for 24 hours, and the NMN content was detected according to the method described in Example 1. The intracellular NMN content of E009 cells was measured to be 891.6 mg / L, which was 33 times higher than that of E007.

[0074] Example 12 Promoter screening of engineered bacteria for nicotinamide phosphoribosyltransferase

[0075] To reduce raw material costs and improve industrial competitiveness, a constitutive promoter replacement was carried out. The promoters PL1118, PL1744, PL277, and PUTRssrA-PUTRinfC-rplT (nucleotide sequences shown in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, respectively) were seamlessly cloned into the expression plasmid pET22b-VsNAMPT-SD-AS-PRS. The T7 promoter was replaced to obtain plasmids pET22b-PL1118-VsNAMPT-SD-AS-PRS, pET22b-PL1744-VsNAMPT-SD-AS-PRS, pET22b-PL277-VsNAMPT-SD-AS-PRS, and pET22b-PUTRssrA-PUTRinfC-rplT-VsNAMPT-SD-AS-PRS. These plasmids were then transformed into E006 to obtain the engineered strains E. coli-PL1118-NMN and E. coli-PL1118-NMN. coli-PL1744-NMN, E. coli-PL277-NMN, E. coli-PUTRssrA-PUTRinfC-rplT-NMN.

[0076] E. coli-PL1118-NMN, E. coli-PL1744-NMN, E. coli-PL277-NMN, and E. coli-PUTRssrA-PUTRinfC-rplT-NMN were inoculated into LB medium (containing 100 μg / mL ampicillin) and cultured overnight at 37°C with shaking at 220 rpm to obtain the corresponding seed cultures. The seed cultures were then transferred to fresh LB medium (100 μg / mL ampicillin) at a 1% inoculation rate and cultured at 37°C for 24 hours. The NMN content was then determined according to the method described in Example 1. The intracellular NMN contents of E. coli-PL1118-NMN, E. coli-PL1744-NMN, E. coli-PL277-NMN and E. coli-PUTRssrA-PUTRinfC-rplT-NMN were measured to be 1926.6 mg / L, 2282.5 mg / L, 2736.9 mg / L and 1867.4 mg / L, respectively, which were 2.2, 2.6, 3.1 and 2.1 times higher than those of E009.

[0077] Table 4. Comparison of NMN content in different knockout strains and the final strain obtained.

[0078]

[0079] Note: E. coli-pVs ​​were only used to verify the protein's catalytic function, so specific values ​​were not given.

[0080] As shown above, the transformation efficiency of the engineered bacteria formed by gene knockout is less than 7 times, but the transformation efficiency of E. coli-NMN is 1471.5 times, which is much higher than the efficiency of the engineered bacteria mentioned above, showing a significant difference. This indicates that each gene has a synergistic effect in the formation of engineered bacteria.

[0081] (1) VsNAMPT nucleotide sequence (SEQ ID NO:1)

[0082]

[0083] (2) PRS nucleotide sequence (SEQ ID NO:2)

[0084] TTAGTGTTCGAACATGGCAGAGATCGATTCTTCGTTGCTGATACGACGAATCGCTTCGGCCAGCATACCTGACAGGGTCAGAGTACGCACGTTCGGCAGTGATTTGATTTCATCGCTCAGCGGAATGGTATCGCAGACAACGACTTCATCAATTACAGAGTTACGCAGGTTGTTCGCCGCGTTGCCAGAGAAGATCGGGTGAGTCGCGTACGCAAATACACGTTTAGCACCACGTTCTTTCAGAGCTTCAGCAGCTTTACACAGCGTACCGCCAGTGTCGATCATATCATCGACCAGTACGCAGTCACGACCTGCAACGTCACCGATGATATGCATCACCTGTGAAACGTTCGCACGCGGACGACGTTTGTCGATGATTGCCATATCGGTATCGTTCAGCAGCTTAGCGATAGCGCGGGCACGCACAACGCCGCCGATGTCCGGAGAAACCACAATTGGGTTATCCAGATTCAGCTGCAGCATGTCTTCCAGCAGGATCGGGCTACCAAATACGTTATCAACCGGAACGTCGAAGAAACCCTGAATCTGTTCAGCGTGCAGATCCACTGTCAGCACACGGTCAACACCGACGCTGGAGAGGAAGTCTGCAACCACTTTCGCAGTGATTGGTACACGAGCGGAACGGACGCGACGGTCCTGGCGCGCATAGCCAAAGTAGGGGATAACAGCGGTGATACGACCTGCGGAAGCACGACGCAGGGCATCAACCATAACGACTAATTCCATCAGGTTGTCGTTAGTAGGGGCACAAGTGGACTGGATGATGAAAATATCACCACCGCGTACATTTTCATTAATTTGTACGCTGACTTCGCCGTCGCTAAAGCGACCTACAGCGGCGTCGCCGAGTGAAGTGTACAGGCGGTTGGCAATACGTTGTGCTAGTTCCGGGGTGGCGTTACCAGCAAAAAGCTTCATATCAGGCAC

[0085] (3) nucleotide sequence of promoter PL1118 (SEQ ID NO:3)

[0086] TTGACAATTAATCATCCGGCTCTTATAATGTGTGGAATTGCGAGCGGTTAACAATTTCACACAGGAAACAGACC

[0087] (4) nucleotide sequence of promoter PL1744 (SEQ ID NO:4)

[0088] TTGACAATTAATCATCCGGCTCTTATAATGTGTGGAATTGCGAGCCGATAACAATTTCACACAGGAAACAGACC

[0089] (5) Promoter PL277 nucleotide sequence (SEQ ID NO:5)

[0090] TTGACAATCAATCATCCGGCTCGTATAATGTGTGGAATTGTTATCTGCTCACAATTCCACACAGGAAACAGACC

[0091] (6) Nucleotide sequence of promoter PUTRssrA-PUTRinfC-rplT (SEQ ID NO:6)

[0092] ATTGGCTATCACATCCGACACAAATGTTGCCATCCCATTGCTTAATCGAATAAAAATCAGGCTACATGGGTGCTAAATCTTTAACGATAACGCCATTGAGGCTGGTCATGGCGCTCATAAATCTGGTATACTTACCTTTACACATTGCGGGCATTCGTGTTAAAGCAGACTTGAGAAATGAGAAGATTGGCTT TAAAATCCGCGAGCACACTTTGCGTCGCGTCCCATATATGCTGGTCTGTGGTGATAAAGAGGTGGAATCAGGCAAAGTTGCCGTTCGCACCCGCCGTGGTAAAGACCTGGGAAGCATGGACGTAAATGAAGTGATCGAGAAGCTGCAACAAGAGATTCGCAGCCGCAGTCTTAAACAATTGGAGGAATAAGGT

[0093] (7) deoD-C1 nucleotide sequence (SEQ ID NO:7)

[0094] TATCACCAAGAAAGTGAAAGCAACTGGCCTGGACGCGCTGTTTGACGCCACCATCAAAGAGATGAAAGAAGCGGGTGATAACACCATCGTCTTCACCAACTTCGTTGACTTCGACTCTTCCTGGGGCCACCGTCGCGACGTCGCCGGTTATGCTGCGGGTCTGGAGCTGTTCGACCGCCGTCTGCCGGAGCTGATGTCTCTGCTGCGCGATGACGACATCCTGATCCTCACTGCTGACCACGGTTGTGATCCGACCTGGACCGGTACTGACCACACGCGTGAACACATTCCGGTACTGGTTTACGGCCCGAAAGTAAAACCGGGCTCACTGGGTCACCGTGAAACCTTCGCGGATATTGGTCAGACTCTGGCAAAATATTTTGGTACTTCTGATATGGAATATGGCAAAGCCATGTTCTGATAATGGGTGCGGCTTGATGCCCTCACCCCGGCCCTCTCCCACAGGGAGAGGGTGAAAACATGTTGATAAGGATAAAACA

[0095] (8) deoD-C2 nucleotide sequence (SEQ ID NO: 8)

[0096] TTGTGTTTCGCTGAAAGGCGAACGTCGTGTTAAGCCGGAGCAGGAGACTGCTCCGGCTTTTTAGTATCTATTCATCAATAGCAACTGATTTATAGATTTACTATTATTTTTCATATGGATAGAAAATAAAATCCATTCAAGTATCTATTCACGAATCTATTCATTTATGTTCAGCCGTCATCCAGGAAGGGCATATCAGCAACTCTGGTGGACAACCATAAATTTCTGCCATTTTGCTTTTGATGTTTGAGCTAAGCCGTTCCGTCTTTTCGATCTGTTTTAGAGAATTAATCGAGATACCTAACATTTTACTTACTTCAGCAAGCGATAATTTATGCCTGATACGCACGGCGGCTAGCCAGGAAATACGCTGGCTGAACATTAAATTGATAATCTCCCGTTCCTGGTTTTCCAGATCGATCATATTTCCTTCCCTGGATATTTTAATCAGCGAGTTACCTTACCGCCCCCGCTATCCACGTCGACAACTTCCGTAGCTC

[0097] (9) deoD nucleotide sequence (SEQ ID NO:9)

[0098] ATGGCTACCCCACACATTAATGCAGAAATGGGCGATTTCGCTGACGTAGTTTTGATGCCAGGCGACCCGCTGCGTGCGAAGTATATTGCTGAAACTTTCCTTGAAGATGCCCGTGAAGTGAACAACGTTCGCGGTATGCTGGGCTTCACCGGTACTTACAAAGGCCGCAAAATTTCCGTAATGGGTCACGGTATGGGTATCCCGTCCTGCTCCATCTACACCAAAGAACTGATCACCGATTTCGGCGTGAAGAAAATTATCCGCGTGGGTTCCTGTGGCGCAGTTCTGCCGCACGTAAAACTGCGCGACGTCGTTATCGGTATGGGTGCCTGCACCGATTCCAAAGTTAACCGTATCCGTTTTAAAGACCATGACTTTGCCGCTATCGCTGACTTTGACATGGTGCGTAACGCGGTAGACGCGGCTAAAGCACTGGGTGTTGATGCTCGCGTGGGTAACCTGTTCTCCGCTGACCTGTTCTACTCTCCGGACGGCGAAATGTTCGACGTGATGGAAAAATACGGCATCCTCGGCGTGGAAATGGAAGCGGCTGGTATCTACGGCGTCGCTGCAGAGTTTGGCGCGAAAGCCCTGACCATCTGCACCGTGTCTGACCACATCCGCACTCACGAGCAGACCACTGCCGCTGAGCGTCAGACCACCTTCAACGACATGATCAAAATCGCACTGGAATCCGTTCTGCTGGGCGATAAAGAGTAA

[0099] (10) ushA nucleotide sequence (SEQ ID NO:10)

[0100]

[0101] (11) nadR nucleotide sequence (SEQ ID NO:11)

[0102]

[0103] (12) pncC nucleotide sequence (SEQ ID NO:12)

[0104] ATGACTGACAGTGAACTGATGCAGTTAAGTGAACAGGTTGGGCAGGCGCTGAAAGCCCGTGGCGCAACCGTAACAACTGCCGAGTCTTGTACCGGTGGTTGGGTAGCGAAAGTGATTACCGATATTGCCGGTAGCTCCGCCTGGTTTGAACGCGGATTTGTCACCTACAGTAACGAAGCCAAAGCGCAGATGATCGGCGTACGCGAAGAGACGCTGGCGCAGCATGGCGCGGTGAGTGAACCCGTCGTGGTGGAAATGGCGATAGGCGCACTGAAAGCGGCTCGTGCTGATTATGCCGTGTCTATTAGTGGTATCGCCGGGCCGGATGGCGGCAGTGAAGAGAAGCCTGTCGGCACCGTCTGGTTTGCTTTTGCCACTGCCCGCGGTGAAGGCATTACCCGGCGGGAATGCTTCAGCGGCGACCGTGATGCGGTGCGTCGTCAGGCTACTGCGTATGCATTGCAGACCTTGTGGCAACAATTTCTACAAAACACTTGA

[0105] (13) amn nucleotide sequence (SEQ ID NO:13)

[0106]

[0107] (14) add nucleotide sequence (SEQ ID NO:14)

[0108]

Claims

1. A high-yield nicotinamide mononucleotide engineered strain, characterized in that, The strain was constructed using the following steps: The following genes were expressed in the strain: nicotinamide phosphoribosyltransferase, genes related to enhancing NMN synthesis precursors, genes related to NMN degradation knocked out, genes that enhance ATP supply were knocked out, co-expression methods were optimized, and promoters were combined to obtain a stable and high-yielding engineered strain of nicotinamide mononucleotide. The strains mentioned are Escherichia coli, lactic acid bacteria, Streptomyces, yeast, or Bacillus subtilis; The nicotinamide phosphoribosyltransferase is VsNAMPT derived from Variovorax sp., whose nucleotide sequence is shown in SEQ ID NO:1; and nicotinamide phosphoribosyltransferase with greater than 30% homology to the nucleotide sequence of VsNAMPT. The enhanced NMN synthesis precursor gene is an overexpressed endogenous 5-phosphoribose-1-pyrophosphate synthase gene prs, with the nucleotide sequence shown in SEQ ID NO:2; The NMN degradation-related genes are deoD, ushA, nadR, and pncC; the nucleotide sequence of deoD is shown in SEQ ID NO:9, the nucleotide sequence of ushA is shown in SEQ ID NO:10, the nucleotide sequence of nadR is shown in SEQ ID NO:11, and the nucleotide sequence of pncC is shown in SEQ ID NO:12; the enhanced ATP supply is achieved by knocking out amn and add; the nucleotide sequence of amn is shown in SEQ ID NO:13, and the nucleotide sequence of add is shown in SEQ ID NO:

14.

2. The high-yield nicotinamide mononucleotide engineered strain according to claim 1, characterized in that... The gene co-expression method is either single plasmid co-expression or fusion expression.

3. The high-yield nicotinamide mononucleotide engineered strain according to claim 1, characterized in that... The promoters include PL1118, PL1744, PL277, and PUTRssrA-PUTRinfC-rplT, with nucleotide sequences of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, respectively.

4. The application of an engineered strain in the preparation of nicotinamide mononucleotide, characterized in that... Using nicotinamide as a donor, NMN is synthesized by the high-yield nicotinamide mononucleotide engineered strain described in any one of claims 1-3.

Images