Specific primers and kit for identifying wild strains and vaccine strains of Eimeria acervulina and their uses
By designing specific primers and their kits, combined with PCR and HRM methods, accurate identification of wild-type and vaccine strains of Eimeria acervulina was achieved, solving the problems of confusing test results and drug residues in existing technologies, and providing a safe and efficient identification method.
Patent Information
- Application Number
- CN202311681247.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-08
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2043-12-08
AI Technical Summary
Existing technologies make it difficult to effectively distinguish between wild strains and vaccine strains of Eimeria acervulina, resulting in confusing test results and safety risks. Long-term use of anticoccidial drugs also leads to drug resistance and drug residue problems.
Specific primers and kits were designed to identify wild-type and vaccine strains of Eimeria acervulina by PCR and high-resolution melting (HRM) analysis. Specific primers were used for nucleic acid amplification and the amplified products were analyzed by electrophoresis and sequencing.
The accurate identification of wild-type and vaccine strains of Eimeria acervulina was achieved with simple operation, high repeatability and strong specificity, avoiding drug residues and safety hazards.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present application relates to the field of molecular biological detection technology, and in particular to a specific primer and a kit for identifying wild strains and vaccine strains of Eimeria acervulina and their uses. Background Art
[0002] Coccidiosis in chickens is a common parasitic disease caused by Eimeria species. It is extremely devastating, resulting in significant economic losses worldwide each year. Currently, there are nine species of chicken coccidia worldwide, with Eimeria acervulina, Eimeria maxima, Eimeria tenella, and Eimeria necatrix causing the greatest damage. Eimeria acervulina is primarily transmitted through oocysts and infects the duodenum and anterior small intestine of chickens. Animals infected with Eimeria acervulina, particularly chicks, often experience clinical symptoms such as loss of appetite, lethargy, diarrhea, and even bloody stools. Production performance is also significantly reduced, severely impacting market yields.
[0003] Currently, the livestock industry primarily relies on anticoccidial drugs for the prevention and control of Eimeria acervulina, such as sulfonamides (sulfaquinoxaline, sulfachloropyrazine), triazines (diclazuril, toltrazuril), quinolines (butoxyquin, benzyloxyquin), pyridines (clofenton), plant alkaloids (halofuginone), and polyether ionophores (monensin, salinomycin, and maduramicin). With the widespread use of these drugs, drug-resistant strains have been reported. Furthermore, drug use inevitably leads to an increase in drug residues in poultry meat, raising public health concerns. Immunization is a potential alternative technology. Currently, live vaccines are increasingly used for the control of Eimeria acervulina. However, live vaccines can colonize in intestinal tissue, potentially affecting molecular detection of Eimeria acervulina in clinical samples. Furthermore, the use of these vaccines carries the safety risk of virulence reversion. Therefore, considering the effectiveness and safety of the live vaccine of Eimeria acervulina, it is urgent to establish a method to distinguish the vaccine strain of Eimeria acervulina from the wild strain. Summary of the Invention
[0004] Based on this, it is necessary to provide a specific primer and a kit in one embodiment of the present application, which can be used to identify the wild strain and vaccine strain of Eimeria acervulina.
[0005] Specific technical solutions include:
[0006] In a first aspect, the present application provides a specific primer for identifying a wild strain and a vaccine strain of Eimeria acervulina, the nucleotide sequences of the specific primers are shown in SEQ ID NO.1 and SEQ ID NO.2.
[0007] In a second aspect, the present application also provides a product for identifying wild strains and vaccine strains of Eimeria acervulina, wherein the product comprises the specific primers.
[0008] In one embodiment, the product includes one or more of a reagent, a kit, and a chip.
[0009] In one embodiment, the product comprises a product suitable for PCR technology.
[0010] In one embodiment, the product further comprises at least one of a nucleic acid amplification reagent, a positive quality control standard, and a negative quality control standard.
[0011] In one embodiment, the nucleic acid amplification reagent includes PCR buffer, DNA polymerase, dNTPs, Mg 2+ and one or more of fluorescent dyes.
[0012] In one embodiment, the positive quality control standard includes the whole genome of the wild strain and vaccine strain of Eimeria acervulina or a recombinant plasmid containing the nucleotide fragments shown in SEQ ID NO.3 and SEQ ID NO.4.
[0013] In a third aspect, the present application also provides the use of the specific primers or the product in identifying wild strains and vaccine strains of Eimeria acervulina.
[0014] In one embodiment, a method for identifying a field strain and a vaccine strain of Eimeria acervulina comprises the following steps:
[0015] Extracting genomic DNA from the sample to be tested;
[0016] Using the genomic DNA as a template, the specific primers or the product are used to perform nucleic acid amplification; and
[0017] The obtained amplified products are analyzed, and based on the analysis results, it is determined that the sample to be tested is a wild strain and / or a vaccine strain of Eimeria acervulina.
[0018] In one embodiment, the step of analyzing the obtained amplification products comprises analyzing the amplification products by agarose gel electrophoresis, sequencing and HRM.
[0019] In one embodiment, the determination method includes the following steps:
[0020] The electrophoresis result shows a 130 bp to 140 bp electrophoretic band, and / or the sequencing peak diagram shows a single peak, and the sequence obtained by sequencing is identical to SEQ ID NO. 3, and the sample to be tested is determined to be a wild-type strain of Eimeria acervulina;
[0021] The electrophoresis result shows a 150 bp to 160 bp electrophoretic band, and / or the sequencing peak diagram shows a single peak, and the sequence obtained by sequencing is identical to SEQ ID NO. 4, indicating that the test sample is a vaccine strain of Eimeria acervulina.
[0022] The electrophoresis results show an electrophoretic band of 130bp-140bp and an electrophoretic band of 150bp-160bp, and / or the sequences obtained by sequencing are identical to the nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4, respectively, indicating that the test sample contains both the vaccine strain and the wild strain of Eimeria acervulina.
[0023] Compared with traditional technologies, this application has the following beneficial effects:
[0024] The present application provides a specific primer that can realize the identification of wild strains and vaccine strains of Eimeria acervulina. The primer and a kit containing the primer are used to detect wild strains and vaccine strains of Eimeria acervulina, which is simple to operate, highly reproducible and highly specific. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more fully understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present application. Those skilled in the art can also derive other drawings based on these drawings without inventive effort.
[0026] Figure 1 The electrophoresis results of PCR amplification products of Eimeria acervulina EAGZ vaccine strain and Eimeria acervulina GD test strain are shown. Lanes 1 and 2 show the PCR amplification products of Eimeria acervulina GD test strain, with a band size of approximately 136 bp. Lanes 3 and 4 show the amplification products of Eimeria acervulina EAGZ vaccine strain, with a band size of approximately 158 bp. Lane M is the DL500 marker.
[0027] Figure 2 This is the peak diagram of the differential sites of PCR products of Eimeria acervulina EAGZ vaccine strain and Eimeria acervulina GD test strain; the differential sequence is GATAAACAAAGAAACAAGTGGA;
[0028] Figure 3The results of kit specificity detection are shown. Lanes 1 and 2 show the amplification products of the vaccine and test strains of Eimeria nematophila, lanes 3 and 4 show the amplification products of the vaccine and test strains of Eimeria maxima, lanes 5 and 6 show the amplification products of the vaccine and test strains of Eimeria tenella, lanes 7 and 8 show the amplification products of the precocious and wild-type strains of Eimeria brucei, lanes 9-11 show negative controls with final primer concentrations of 0.2 μM, 0.4 μM, and 0.5 μM in the reaction system, lanes 12-13 and 14-15 show the amplification products of the vaccine and test strains of Eimeria acervulina, lane 16 shows the blank control, and lane M shows the DL500 marker. DETAILED DESCRIPTION
[0029] To make the above-mentioned objects, features, and advantages of the present application more clearly understood, the specific embodiments of the present application are described in detail below. The following description sets forth many specific details to facilitate a full understanding of the present application. However, the present application can be implemented in many other ways than those described herein, and those skilled in the art can make similar modifications without violating the scope of the present application. Therefore, the present application is not limited to the specific embodiments disclosed below.
[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application pertains. The terms used herein in the specification of this application are for the purpose of describing specific embodiments only and are not intended to limit this application.
[0031] The term "and / or" as used herein includes any one of two or more related listed items, and also includes any and all combinations of the related listed items, wherein the said any and all combinations include any combination of any two related listed items, any more related listed items, or all related listed items. For example, "A and / or B" includes three parallel solutions of A, B and A+B. For another example, the technical solution of "A, B, C, and / or, D" includes any one of A, B, C, and D, and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the four-item combination of A, B, C, and D.
[0032] As used herein, the terms "multiple", "plurality", "multiple groups", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or greater than or equal to two.
[0033] In this document, the terms "first," "second," and "third" in the "first aspect," "second aspect," and "third aspect" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or quantity, nor as implicitly indicating the importance or quantity of the technical features indicated. Furthermore, "first," "second," and "third" serve only as non-exhaustive enumeration and description, and should be understood not to constitute closed-ended limitations on quantity.
[0034] As used herein, the terms "optionally," "optional," and "optional" mean optional or dispensable, that is, they refer to either option selected from the two parallel options of "with" or "without." If multiple "options" appear in a technical solution, unless otherwise specified and there are no contradictions or mutual constraints, each "option" is independent of the other. In this application, "further" and the like are used for descriptive purposes to indicate differences in content, but should not be construed as limiting the scope of protection of this application.
[0035] In the open technical features or technical solutions described by the terms "comprise", "include" and the like as used in this article, unless otherwise specified, additional members other than the listed members are not excluded, and it can be regarded as providing both closed features or solutions consisting of the listed members and open features or solutions including additional members other than the listed members.
[0036] As used herein, "ranges" may be defined in the form of lower and upper limits. A given range is defined by selecting a lower limit and an upper limit, the selected lower and upper limits defining the boundaries of the particular range. Ranges defined in this manner may be inclusive or exclusive, any of the limits may be independently included or excluded, and any combination thereof may be arbitrary, i.e., any lower limit may be combined with any upper limit to form a range.
[0037] As used herein, the term "primer" refers to an oligonucleotide that can be used in an amplification method (e.g., polymerase chain reaction (PCR), high-resolution melting curve (HRM)) to amplify a target sequence based on a polynucleotide sequence corresponding to a target gene or a portion thereof. Typically, at least one of the primers used to amplify a polynucleotide sequence is sequence-specific for the polynucleotide sequence. The exact length of the primer depends on many factors, including temperature, primer source, and the method used. For example, for identification, diagnosis, and prognosis applications, oligonucleotide primers typically contain at least 10, 15, 20, 25, or more nucleotides, depending on the complexity of the target sequence, but may also contain fewer nucleotides. In the present disclosure, the term "primer" refers to a pair of primers that can hybridize to the double-stranded portion of a target DNA molecule or hybridize to regions of a target DNA molecule that flank the nucleotide sequence to be amplified.
[0038] This application performs a large amount of resequencing on wild strains and vaccine strains of Eimeria acervulina, and conducts comparative analysis to find multiple differential target sequences. Multiple sets of primers are designed based on different target sequences. Through PCR and first-generation sequencing, primer pairs with strong specificity and good stability are screened out, which can be used to identify wild strains and vaccine strains of Eimeria acervulina.
[0039] One embodiment of the present application provides a specific primer for distinguishing wild-type and vaccine strains of Eimeria acervulina, wherein the nucleotide sequence of the upstream primer of the specific primer is GTAACAATGCTCACAAAC, and the nucleotide sequence of the downstream primer of the specific primer is AGAAAGCCTAATGATAGT. The primer has strong specificity and good stability.
[0040] One embodiment of the present application further provides a product for identifying wild strains and vaccine strains of Eimeria acervulina, which includes the above-mentioned specific primers.
[0041] In a specific example, the product includes at least one of a reagent, a kit, and a chip.
[0042] In one specific example, the product includes a product suitable for use with PCR technology.
[0043] PCR is the abbreviation of "Polymerase Chain Reaction", which means polymerase chain reaction. It is a method of enzymatically synthesizing specific DNA fragments in vitro using the principle of double-stranded DNA replication. It consists of a cycle of several steps, including high-temperature denaturation, low-temperature annealing (renaturation), and thermophilic extension. These reactions are repeated in cycles to rapidly amplify the target DNA. Its characteristic is that it can use a trace amount of DNA as a template to rapidly amplify a large number of copies. This application covers multiple derivative forms of the reaction, including but not limited to conventional PCR, quantitative real-time PCR, nested PCR, multiplexed PCR, etc.
[0044] Among them, ordinary PCR is the first generation PCR, which uses an ordinary PCR amplifier to amplify the target gene and conducts qualitative analysis of the product by agarose gel electrophoresis.
[0045] Real-time fluorescence quantitative PCR is a method that adds fluorescent groups to the DNA amplification reaction, monitors the total amount of product after each PCR cycle in real time by accumulating fluorescent signals, and then performs quantitative analysis of the target sequence in the sample to be tested.
[0046] Among them, real-time fluorescence quantitative PCR includes DNA-binding dye methods such as the SYBR Green I dye method and probe-based chemical methods such as TaqMan probes. The SYBR Green I dye method uses SYBR Green I dye, a dye that only binds to the minor groove of double-stranded DNA and does not bind to single-stranded DNA chains. It does not emit fluorescence in the free state and can only emit light when incorporated into double-stranded DNA. Therefore, in the PCR system, as the specific PCR product is exponentially amplified, the dye is incorporated into double-stranded DNA during the extension phase of each cycle, and its fluorescence signal intensity is positively correlated with the amount of PCR product. The core of the TaqMan probe method is the use of probe molecules. The TaqMan probe is single-stranded DNA with a luminescent group coupled to the 5' end and a quencher group coupled to the 3' end. The free intact probe cannot detect a fluorescent signal. The fluorescence emitted by the luminescent group will be absorbed and quenched by the quencher group. The probe is hydrolyzed, and the fluorescent signal can be detected when the luminescent group and the quencher group are separated. At the beginning of the reaction, the template chain is thermally denatured and melted to form a single strand. The TaqMan probe preferentially anneals to the template chain, and the primer subsequently anneals to the template. The chain is then extended. During the extension process, the Taq enzyme exerts 5'-3' exonuclease activity. When encountering the probe, it will remove the probe base by base from the 5' end. The luminescent group will separate from the quenching group, so the fluorescence detection system can receive the fluorescent signal. Every time a DNA chain is amplified, a fluorescent molecule is formed. The accumulation of the fluorescent signal and the formation of the PCR product are synchronized.
[0047] In a specific example, nucleic acid amplification reagents include PCR buffer, DNA polymerase, dNTPs, Mg 2+ and one or more of fluorescent dyes.
[0048] In a specific example, the above-mentioned product also includes at least one of a nucleic acid amplification reagent, a positive quality control standard and a negative quality control standard.
[0049] In a specific example, the positive quality control standard includes the whole genome of the wild strain and vaccine strain of Eimeria acervulina or a recombinant plasmid containing the nucleotide fragments shown in SEQ ID NO.3 and SEQ ID NO.4.
[0050] One embodiment of the present application also provides the use of the above-mentioned specific primers or the above-mentioned products in distinguishing wild strains and vaccine strains of Eimeria acervulina. The method of distinguishing wild strains and vaccine strains of Eimeria acervulina using the primers and kit provided in this application is simple to operate, has good stability, strong specificity, and accurate results. In a specific example, the method of distinguishing wild strains and vaccine strains of Eimeria acervulina comprises the following steps a to c:
[0051] Step a: extracting genomic DNA from the sample to be tested.
[0052] In a specific example, conventional DNA extraction methods or commercial DNA extraction kits can be used to extract the DNA of the sample to be tested.
[0053] Step b, using the above genomic DNA as a template, and using the above primers or the above product to perform nucleic acid amplification.
[0054] In a specific example, the working concentration of the specific primer is 0.2 μM to 0.6 μM, optionally, 0.3 μM to 0.4 μM, and further optionally, the working concentration of the specific primer is 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM or 0.6 μM.
[0055] In a specific example, each 50 μL amplification system includes 25 μL of 2×Premix Taq DNA mix, 1.5 μL to 2.5 μL of 10 μM upstream primer, 1.5 μL to 2.5 μL of 10 μM downstream primer, 100 ng to 500 ng of the sample DNA to be tested, and double-distilled water to make up to 50 μL.
[0056] In a specific example, each 50 μL amplification system includes 25 μL of 2×Premix Taq DNA mix, 2 μL of 10 μM upstream primer, 2 μL of 10 μM downstream primer, 100 ng of the sample DNA to be tested, and double-distilled water to make up to 50 μL.
[0057] In a specific example, the amplification program is pre-denaturation at 90°C~95°C for 5 minutes; 90°C~94°C for 20s~30s, 50°C~55°C for 20s~30s, 72°C~73°C for 20s~30s, for 20~30 cycles; and extension at 70°C~72°C for 8min~10min.
[0058] In a specific example, the amplification program is pre-denaturation at 95°C for 5 min; 30 cycles of 94°C for 30 s, 50°C for 30 s, and 72°C for 30 s; and extension at 72°C for 10 min.
[0059] Step c: analyzing the obtained amplified products and determining whether the sample to be tested is a wild strain and / or vaccine strain of Eimeria acervulina based on the analysis results.
[0060] Specifically, the step of analyzing the obtained amplification product includes analyzing the amplification product using at least one method selected from agarose gel electrophoresis, sequencing, and HRM.
[0061] HRM, short for high-resolution melting, is a new gene analysis technique based on the formation of distinct melting curves at different melting temperatures of single nucleotides. It offers high sensitivity and can detect differences in single bases. It eliminates the need for designing specific probes, requiring only a pair of primers and the use of PCR reagents containing saturated fluorescent dyes during the PCR amplification phase. This approach offers low cost, short experimental cycles, and simple operation, enabling a truly closed-tube procedure. The primers provided in this application are suitable for HRM analysis.
[0062] Among them, saturated fluorescent dyes, such as Eva Green, LC Green, and SYTO9, not only have strong binding affinity with DNA, but also have low inhibitory effects. These characteristics ensure that the dye can be saturatedly embedded in the DNA double strand, and at the same time, the fluorescent dye released during the dissolution process will not continue to bind to the DNA double strand.
[0063] The primers and kit can be used to quickly detect and distinguish wild strains and vaccine strains of Eimeria acervulina using ordinary PCR and nucleic acid electrophoresis.
[0064] Specifically, the determination method includes the following:
[0065] The electrophoresis results showed an electrophoretic band of approximately 136 bp, and / or the sequencing peak diagram showed a single peak, and the sequence obtained by sequencing was identical to SEQ ID NO. 3, indicating that the sample to be tested was a wild-type strain of Eimeria acervulina.
[0066] The electrophoresis results show an electrophoretic band of approximately 158 bp, and / or the sequencing peak diagram shows a single peak, and the sequence obtained by sequencing is identical to SEQ ID NO. 4, indicating that the sample to be tested is the Eimeria acervulina vaccine strain;
[0067] The electrophoresis results showed an electrophoretic band of approximately 136 bp and an electrophoretic band of 158 bp, and / or the sequences obtained by sequencing were identical to SEQ ID NO. 3 and SEQ ID NO. 4, respectively, indicating that the sample to be tested contained both the vaccine strain and the wild strain of Eimeria acervulina.
[0068] The embodiments of the present application will be described in detail below with reference to the examples. It should be understood that these examples are intended to illustrate the present application only and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manuals or conventional conditions in this area, or according to the conditions recommended by the manufacturer, or with reference to experimental methods known in the art.
[0069] In the following specific examples, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument testing accuracy or operational accuracy are allowed.
[0070] Example 1 Assembly of a PCR Detection Kit for Identifying Field and Vaccine Strains of Eimeria acervulina
[0071] The PCR detection kit provided in this example for distinguishing wild-type and vaccine strains of Eimeria acervulina includes specific primer pairs for wild-type and vaccine strains of Eimeria acervulina, Premix Taq DNA mix (TAKARA Co. Ltd.), a positive quality control standard, a negative quality control standard, and ultrapure water. The specific primer pair for distinguishing wild-type and vaccine strains of Eimeria acervulina includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is GTAACAATGCTCACAAAC, SEQ ID NO. 1; the nucleotide sequence of the downstream primer is AGAAAGCCTAATGATAGT, SEQ ID NO. 2.
[0072] The kit includes Premix Taq DNA mix (Cat. No. RP901A) purchased from TaKaRa. The concentration of the upstream and downstream primer stock solutions is 10 μM. In addition, the negative quality control standard is reverse osmosis water with a purity of at least 18.25 MΩ·cm. The positive quality control standard is genomic DNA of the Eimeria acervulina GD test strain and the Eimeria acervulina EAGZ vaccine strain, or a recombinant plasmid constructed from the nucleotide fragments shown in SEQ ID NOs. 3 and 4 and a cloning vector such as pMD18T.
[0073] The specific composition of each reaction system is shown in Table 1 below.
[0074] Table 1
[0075]
[0076] Wherein, the nucleotide sequence of SEQ ID NO.3 is as follows:
[0077] GTAACAATGCTCACAAACAAATGAGCAAATAAACACAAGTAAACAAGTAAAAAAATAAACAAATAAACGCGTTAGTAGGTTAATAACTAAACAAAACAACAAACAGGAGACAGAAACAACTATCATTAGGCTTTCT.
[0078] The nucleotide sequence of SEQ ID NO.4 is as follows:
[0079] GTAACAATGCTCACAAACAAATGAACAAATAAACAGATAAACAAAGAAACAAGTGGACAGGTAAACAAGTAAAAATATAAACAAATAAACGCGTTAGTAGGTTAATAACTAAACAAAACAACAAACAGGAGACAGAAACAACTATCATTAGGCTTTCT.
[0080] Example 2 Identification of Field and Vaccine Strains of Eimeria acervulina
[0081] Using the kit assembled in Example 1 to identify wild-type and vaccine strains of Eimeria acervulina comprises the following steps:
[0082] (a) Genomic DNA was extracted from the purified Eimeria acervulina EAGZ vaccine strain and Eimeria acervulina GD test strain using a rapid DNA extraction kit.
[0083] (b) PCR amplification was performed using extracted sample genomic DNA as a template using primer pairs specific for the wild-type and vaccine strains of Eimeria acervulina. The PCR reaction system consisted of 25 μL of Premix Taq DNA mix, 2 μL of a 10 μM upstream primer, 2 μL of a 10 μM reverse primer, and 1 μL of the test sample DNA. The volume was then made up to 50 μL with double-distilled water (ddH2O). The PCR reaction protocol was as follows: 95°C for 5 min; 30 cycles of 94°C for 30 sec, 50°C for 30 sec, and 72°C for 30 sec; and 72°C for 10 min.
[0084] (c) After the reaction, take 5 μL of the PCR product and perform electrophoresis on a 3% agarose gel to observe whether the PCR product corresponding to the Eimeria acervulina GD test strain shows a 136 bp electrophoresis band and whether the PCR product corresponding to the Eimeria acervulina EAGZ vaccine strain shows a 158 bp electrophoresis band.
[0085] The results are as follows Figure 1 As shown, lanes 1 and 2 are the PCR amplification products of the Eimeria acervulina GD test strain, with a band size of approximately 136 bp, and lanes 3 and 4 are the amplification products of the Eimeria acervulina EAGZ vaccine strain, with a band size of approximately 158 bp.
[0086] (d) The PCR product was cloned into pMD18T vector and sent to a sequencing company for sequencing.
[0087] The results are as follows Figure 2As shown, the sequencing result of the 136 bp amplified band of the Eimeria acervulina GD test strain is a single peak, and the measured sequence is a perfect match with SEQ ID NO. 3 after alignment. The sequencing result of the 158 bp amplified band of the Eimeria acervulina EAGZ vaccine strain is a single peak, and the measured sequence is a perfect match with SEQ ID NO. 4 after alignment. Specifically, when SEQ ID NO. 3 and SEQ ID NO. 4 are aligned, the sequence "GATAAACAAAGAAACAAGTGGA" is inserted.
[0088] Example 3 Specificity Test
[0089] The PCR kit assembled in Example 1 of the present application was used to perform PCR amplification on the genomic DNA of the vaccine strains and test strains of Eimeria acervulina (Ea), Eimeria tenella (Et), Eimerianecatrix (En), Eimeria maxima (Em) and Eimeria brunette (Eb).
[0090] PCR reaction system (50 μL): 25 μL Premix Taq DNA mix, 2 μL 10 μM upstream primer, 2 μL 10 μM reverse primer, 1 μL test sample DNA, and the balance is double-distilled water (ddH2O).
[0091] The PCR reaction program was: 95°C for 5 min; 94°C for 30 sec, 50°C for 30 sec, 72°C for 30 sec, 30 cycles; 72°C for 10 min. Figure 3 As shown, both the vaccine strain and the test strain of Eimeria acervulina had corresponding amplified bands. The size of the amplified band of the vaccine strain was about 158 bp, and the size of the amplified band of the test strain was about 136 bp, while no specific bands were amplified for other strains.
[0092] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0093] The above-described embodiments merely represent several implementation methods of the present application. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art could make various modifications and improvements without departing from the spirit of the present application, all of which fall within the scope of protection of the present application. Therefore, the scope of protection of the present patent application shall be determined by the appended claims, and the specification may be used to interpret the content of the claims.
Claims
1. Use of specific primers for distinguishing wild strains and vaccine strains of Eimeria acervulina in preparing a product for distinguishing wild strains and vaccine strains of Eimeria acervulina, the nucleotide sequences of the specific primers being shown in SEQ ID NO.1 and SEQ ID NO.
2.
2. The use according to claim 1, characterized in that The product is selected from one of a reagent, a kit and a chip.
3. The use according to claim 1, characterized in that The product is selected from products suitable for PCR technology.
4. The use according to claim 2, characterized in that The product also includes at least one of a nucleic acid amplification reagent, a positive quality control standard, and a negative quality control standard.
5. The use according to claim 4, characterized in that The nucleic acid amplification reagent includes PCR buffer, DNA polymerase, dNTPs, Mg 2+ and one or more of fluorescent dyes.
6. The use according to claim 4, characterized in that The positive quality control standard is a recombinant plasmid containing the nucleotide fragments shown as SEQ ID NO.3 and SEQ ID NO.
4.
7. The use according to any one of claims 1 to 6, characterized in that The method for distinguishing between a field strain and a vaccine strain of Eimeria acervulina comprises the following steps: Extracting genomic DNA from the sample to be tested; Using the genomic DNA as a template, the specific primers or the product are used to perform nucleic acid amplification; and The obtained amplified products are analyzed, and based on the analysis results, it is determined that the sample to be tested is a wild strain and / or a vaccine strain of Eimeria acervulina.
8. The use according to claim 7, characterized in that The step of analyzing the obtained amplification product comprises analyzing the amplification product by using at least one method selected from agarose gel electrophoresis, sequencing and HRM.
9. The use according to claim 8, characterized in that The determination methods include the following: The electrophoresis results showed a 130 bp to 140 bp electrophoretic band, the sequencing peak diagram showed a single peak, and the sequence obtained by sequencing was identical to SEQ ID NO. 3, indicating that the sample to be tested was a wild-type strain of Eimeria acervulina. The electrophoresis results showed a 150 bp to 160 bp electrophoretic band, the sequencing peak diagram showed a single peak, and the sequence obtained by sequencing was identical to SEQ ID NO. 4, indicating that the sample to be tested was the Eimeria acervulina vaccine strain; The electrophoresis results showed an electrophoretic band of 130bp to 140bp and an electrophoretic band of 150bp to 160bp. The sequences obtained by sequencing were identical to SEQ ID NO.3 and SEQ ID NO.4, respectively, and it was determined that the test sample contained both the vaccine strain and the wild strain of Eimeria acervulina.
Citation Information
Patent Citations
Multiplex PCR method for quickly identifying species of chicken coccidia and kit
CN101928771A
Specific primer pair, identification product and method for identifying wild virus strain and vaccine strain of Eimeria maxima
CN116064880A