A GP-pKlotho nano-drug, its preparation method and application
By preparing GP-pKlotho nanodrugs, targeting the renal proximal epithelial cells to release Klotho DNA, optimizing the translation of a large number of Klotho mRNA and proteins, solving the problem of insufficient expression of Klotho protein after AKI and CKD, and achieving effective renal injury repair and functional protection.
Patent Information
- Application Number
- CN202311504710.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-13
- Publication Date
- 2025-07-18
- Estimated Expiration
- 2043-11-13
AI Technical Summary
In the prior art, the expression of Klotho protein after acute renal injury (AKI) or chronic kidney disease (CKD) is significantly inhibited, resulting in poor treatment effect.
GP-pKlotho nanodrugs were prepared, and DNA encoding antigen proteins was encapsulated in GP through intravenous injection to form GP-pKlotho, targeting the proximal epithelial cells of the kidneys, releasing Klotho DNA into the cell nucleus, and optimizing the translation of a large amount of Klotho mRNA and protein.
It significantly improves the expression level of Klotho protein after AKI and CKD, effectively repairs renal injury, reduces renal tubular fibrosis and oxidative stress, improves phosphate metabolism disorders, and has the characteristics of high safety, fast R&D and strong immunity.
Smart Images

Figure CN117679530B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biomaterials, and particularly relates to a GP-pKlotho nano-drug, a preparation method thereof and an application thereof. Background Art
[0002] Acute kidney injury (AKI) is a critical illness with high morbidity and mortality, especially for patients admitted to the intensive care unit (ICU). AKI is mainly caused by sepsis, ischemia / reperfusion, and nephrotoxins, and is characterized by a rapid loss of renal function, leading to the accumulation of metabolic waste, electrolyte, and fluid disorders.
[0003] Chronic kidney disease (CKD) is a common kidney disease characterized by a gradual loss of renal function, eventually leading to renal failure. Studies have found that the incidence, mortality of CKD, and its related risk factors, such as hypertension, diabetes, obesity, etc., are significantly correlated. The occurrence and development mechanism of CKD include damage to the glomerular filtration membrane, renal tubular dysfunction, inflammatory response, etc. Existing evidence shows that the efficacy of standard renal therapies in improving AKI or CKD is limited. Therefore, it is necessary to adopt innovative methods to prevent or treat AKI or CKD kidney diseases.
[0004] The human Klotho gene (GenBank: BAA23382.1) encodes a membrane protein containing 1012 amino acids with a single transmembrane region. In healthy people, the Klotho protein can be normally expressed. The Klotho protein is a membrane protein encoded by the KL gene, and its expression in the kidney is related to kidney diseases. The main function of the Klotho protein in the kidney is to regulate phosphate metabolism and maintain the function of renal tubules.
[0005] The therapeutic effects of Klotho protein are mainly reflected in the following aspects: Anti-fibrotic effect: Studies have found that Klotho protein can inhibit the fibrotic process of renal tubular epithelial cells. Fibrosis is one of the important mechanisms for the progression of CKD. The increase in Klotho protein can reduce renal tubular fibrosis and protect kidney function. Anti-oxidant effect: Klotho protein has an anti-oxidant effect and can reduce the damage of oxidative stress to the kidneys. Oxidative stress is one of the important factors in the development of CKD. The increase in Klotho protein can reduce the damage of oxidative stress to the kidneys. Regulation of phosphate metabolism: Klotho protein can regulate the reabsorption of phosphate by renal tubules, thereby maintaining the balance of serum phosphate levels. Phosphate metabolism disorder is one of the common problems in CKD patients. The increase in Klotho protein can improve phosphate metabolism disorder and reduce the damage of phosphate to the kidneys. Generally speaking, the principle of Klotho protein in treating kidney diseases is mainly to protect kidney function and reduce the progression of kidney diseases through anti-fibrotic, anti-oxidant and regulation of phosphate metabolism. However, Klotho protein expression is significantly inhibited after AKI or CKD. However, the specific treatment methods and mechanisms of Klotho protein after AKI or CKD have not been found for the application of nano-drugs in acute kidney injury. Summary of the Invention
[0006] In view of this, one of the objectives of the present invention is to provide a preparation method of GP-pKlotho nano-drug, the second objective of the present invention is to provide a GP-pKlotho nano-drug prepared by the above preparation method, the third objective of the present invention is to provide the application of the GP-pKlotho nano-drug in the treatment of acute kidney injury (IR-AKI) or chronic kidney disease (CKD) caused by ischemia-reperfusion, the fourth objective of the present invention is to provide a pharmaceutical preparation containing GP-pKlotho nano-drug, and the fifth objective of the present invention is to provide the application of the pharmaceutical preparation in the treatment of IR-AKI or CKD; to solve the problem that when the existing Klotho drugs are used to treat acute / chronic kidney diseases, the expression of Klotho protein is significantly inhibited and the treatment effect is not good.
[0007] To achieve the above objectives, the present invention provides the following technical solutions:
[0008] A preparation method of GP-pKlotho nano-drug, comprising the following steps:
[0009] S1. Compound 1 (chemical formula: )(After precipitation in excess anhydrous hexane, the guanidine-functionalized monomer and dichloromethane solution were degassed by freeze-thaw cycles and added to the solution of Compound 1; the mixed solution was heated to room temperature and stirred for 30 - 90 minutes, and an excess of ethyl vinyl ether was added to terminate the polymerization reaction; then it was filtered, washed, and dried under vacuum to obtain Compound 2 (chemical formula: ).
[0010] S2. Compound 2 was added to trifluoroacetic acid in a ratio of 1:1 and dissolved in dichloromethane. After the reaction was completed, it was stirred for 4 hours and dried under vacuum to obtain organic Compound 3 (abbreviation: GP);
[0011] S3. The synthesized Compound 3 (chemical formula: ) was redissolved in dichloromethane and precipitated in anhydrous diethyl ether, filtered, washed, and dried; Compound 3 and Klotho plasmid (pKlotho) were placed in a culture medium in a mass ratio of 2 mg:1 μg and cultured for 10 - 30 minutes to synthesize the GP-pKlotho nanocompound.
[0012] Furthermore, in step S1, a Grubbs catalyst was added to the dichloromethane solution in advance for catalytic reaction.
[0013] Furthermore, in step S1, Compound 2 was a pale yellow powder with a reaction yield of 90% - 98%.
[0014] Furthermore, after the reaction in step S2 was completed, excess trifluoroacetic acid was removed by azeotropic distillation with methanol.
[0015] Furthermore, in step S3, the washing and drying steps were as follows: Compound 3 was fully dissolved in water, transferred to a dialysis tube with a molecular weight cut-off (MWCO) of 3000 g / mol, dialyzed in ultrapure water for 1 - 5 days, and then Compound 3 was lyophilized to obtain a white powder.
[0016] Furthermore, Compound 1, Compound 2, and Compound 3 were characterized by 1H NMR and gel permeation chromatography (GPC) respectively to evaluate the chemical composition and molecular weight distribution.
[0017] The GP-pKlotho nanodrug prepared by the above method for preparing the GP-pKlotho nanodrug.
[0018] The application of the above GP-pKlotho nanodrug in the preparation of drugs for acute kidney disease / chronic kidney disease.
[0019] A GP-pKlotho nanodrug preparation, comprising the above GP-pKlotho nanodrug and one or more pharmaceutically acceptable drug carriers or compounds.
[0020] Use of the above-mentioned GP-pKlotho nano-drug preparation in the preparation of drugs for acute kidney disease / chronic kidney disease.
[0021] The beneficial effects of the present invention are as follows:
[0022] 1. For the GP-pKlotho nano-drug disclosed in the present invention, through animal experiments, it is determined that the optimal treatment concentration of GP-pKlotho after AKI or CKD in mice is 1 mg / kg. The results of the toxicity experiment of GP-pKlotho show that there is no significant difference compared with the control after four weeks of administration (20 mg / kg) to normal mice. The results indicate that the GP-pKlotho nano-drug has no obvious toxicity to mice when intravenously administered at 20 mg / kg, which means that the GP-pKlotho nano-drug is a safe nano-material that can be used for intravenous injection. The GP-pKlotho nano-drug synthesized in the present invention can repair kidney injury caused by AKI or CKD, aiming to allow the release of GP-pKlotho in the kidney after AKI or CKD, thus avoiding systemic toxicity. The specific mechanism is as follows: The principle of the GP-pKlotho drug is to optimize the DNA encoding the antigen protein, wrap GP to form GP-pKlotho. GP protects Klotho DNA from being degraded by DNase, can efficiently escape from lysosomes after being endocytosed by cells, and smoothly enters the nucleus. After a large amount of Klotho mRNA is transcribed in the nucleus, Klotho protein is translated in the cytoplasm, so that a large amount of Klotho protein is obtained in the vaccinated body to resist or relieve kidney injury after AKI or CKD. The present invention has the advantages of fast R & D and production, strong immunity, high safety, and can be stored at room temperature for a long time.
[0023] 2. The GP-pKlotho nano-drug disclosed in the present invention is a safe DNA nano-material that can be used for intravenous injection, and can be used to treat hypotension in ischemic kidneys and acute kidney injury and chronic kidney injury caused by cardiovascular surgery (the translation / transcription of Klotho mRNA and protein is restricted after renal IR-AKI or CKD), aiming to allow GP-pKlotho to release Klotho DNA after renal IR-AKI or CKD and express Klotho protein. The specific mechanism is that after intravenous injection, GP-pKlotho passively targets proximal epithelial cells of the kidney, releases Klotho DNA in the cells, and Klotho DNA enters the nucleus. Compared with the non-injected group, the optimized Klotho DNA translates 5 - 15 times more Klotho mRNA, and the Klotho protein increases by 3 - 8 times, showing strong therapeutic advantages in treating hypotension in ischemic kidneys and acute kidney injury and chronic kidney injury caused by cardiovascular surgery.
[0024] Other advantages, objects, and features of the present invention will be set forth in part in the description which follows, and in part will be obvious to those skilled in the art upon examination of the following, or may be learned by practice of the invention. The objects and other advantages of the invention may be realized and attained by means of the instrumentalities and combinations particularly pointed out hereinafter. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] In order to make the objects, technical solutions, and advantages of the present invention clearer, the present invention will be described in detail preferably with reference to the accompanying drawings, wherein:
[0026] Figure 1 It is a schematic diagram of the synthesis principle of the GP-pKlotho nano-drug of the present invention. Figure 1 A is the molecular structure diagram of Compound 1. Figure 1 B is the molecular structure diagram of Compound 2. Figure 1 C is the molecular structure diagram of Compound 3. Figure 1 D is the molecular structure diagram of pKlotho. Figure 1 E is the molecular structure diagram of the GP-pKlotho nano-drug after synthesis.
[0027] Figure 2 It is the transmission electron microscope result diagram of the GP-pKlotho nano-drug of the present invention. Figure 2 A is the morphological result diagram of the GP-pKlotho nano-drug. Figure 2 B is the nuclear magnetic resonance spectrum diagram of the GP-pKlotho nano-drug molecule. Figure 2 C, Figure 2 D is the potential diagram of the GP-pKlotho nano-drug at different times and different batches. Figure 2 E, Figure 2 F is the particle size diagram of the GP-pKlotho nano-drug at different times and different batches. Figure 2 G is a schematic diagram of the result of the degradation of the GP-pKlotho-protected klotho plasmid by DnaseI after 6, 12, 24, and 48 hours.
[0028] Figure 3 It is the result diagram of the Klotho codon optimization of the GP-pKlotho drug of the present invention. Figure 3 A is a schematic diagram of the optimized Klotho1 plasmid. Figure 3 B is a schematic diagram of the optimized Klotho2 plasmid. Figure 3 C is a schematic diagram of the optimized Klotho3 plasmid. Figure 3 D is a schematic diagram of the GC content of the optimized Klotho1. Figure 3 E is a schematic diagram of the GC content of the optimized Klotho2. Figure 3 F is a schematic diagram of the GC content of the optimized Klotho3.Figure 3 G is a schematic diagram of the simulated secondary protein structure of optimized Klotho1; Figure 3 H is a schematic diagram of the simulated secondary protein structure of optimized Klotho2; Figure 3 I is a schematic diagram of the simulated secondary protein structure of optimized Klotho3;
[0029] Figure 4 are schematic diagrams of the changes in Klotho expression of three optimized Klothos in HK cells or mouse kidneys; Figure 4 A is a schematic diagram of the quantitative analysis of the mRNA expression changes of three optimized Klotho plasmids in HK cells; Figure 4 B is a schematic diagram of the protein expression changes of three optimized Klotho plasmids in HK cells; Figure 4 C is a quantitative schematic diagram of the protein expression changes of three optimized Klotho plasmids in HK cells; Figure 4 D is a schematic diagram of the fluorescence changes in protein expression of three optimized Klotho plasmids in HK cells; Figure 4 E is a quantitative schematic diagram of the fluorescence changes in protein expression of three optimized Klotho plasmids in HK cells; Figure 4 F is a schematic diagram of immunohistochemistry of protein expression of three optimized Klotho plasmids in mouse kidneys;
[0030] Figure 5 are the results of the treatment of three types of acute kidney injury with the GP-pKlotho nanomedicine of the present invention, Figure 5 A is a schematic diagram of the changes in CRE and BUN after treatment with the GP-pKlotho nanomedicine after IR-AKI injury, Figure 5 B is a schematic diagram of the changes in CRE and BUN after treatment with the GP-pKlotho nanomedicine in CIS injury. Figure 5 C is a schematic diagram of the changes in CRE and BUN after treatment with the GP-pKlotho nanomedicine in FA injury. Figure 5 D is a schematic diagram of the HE of the kidney after treatment with the GP-pKlotho nanomedicine in IR-AKI injury, Figure 5 E is a schematic diagram of the HE of the kidney after treatment with the GP-pKlotho nanomedicine after CIS injury. Figure 5 F is a schematic diagram of the HE of the kidney after treatment with the GP-pKlotho nanomedicine after FA injury, Figure 5 G is a schematic diagram of the mRNA changes of KIM-1 and NGAL after treatment with the GP-pKlotho nanomedicine after IR-AKI injury, Figure 5 H is a schematic diagram of the mRNA changes of KIM-1 and NGAL after treatment with the GP-pKlotho nanomedicine after CIS injury, Figure 5Figure I shows the schematic diagram of the mRNA changes of KIM-1 and NGAL after treatment with GP-pKlotho nano-drug following FA injury;
[0031] Figure 6 These are the results of treating two types of chronic kidney injury with the GP-pKlotho nano-drug of the present invention. Figure 6 Figure A shows the schematic diagram of the changes in CRE and BUN after treatment with GP-pKlotho nano-drug following Bi-AKI-14d injury. Figure 6 Figure B shows the schematic diagram of the changes in CRE and BUN after treatment with GP-pKlotho nano-drug in CKD injury. Figure 6 Figure C shows the HE staining of the mouse kidney after treatment with GP-pKlotho nano-drug following Bi-AKI-1d injury. Figure 6 Figure D shows the HE staining of the mouse kidney after treatment with GP-pKlotho nano-drug in CKD injury.
[0032] Figure 7 These are the results of treating CKD chronic kidney injury with the GP-pKlotho nano-drug of the present invention for myocardial hypertrophy. Figure 7 Figure A shows the schematic diagram of the results of the heart-to-body weight ratio and the heart weight-to-tibia length ratio after treatment with GP-pKlotho nano-drug in CKD injury. Figure 7 Figure B shows the HE staining of the mouse heart after treatment with GP-pKlotho nano-drug in CKD injury. Figure 7 Figure C shows the schematic diagram of the quantification results of myocardial hypertrophy after HE staining of the mouse heart after treatment with GP-pKlotho nano-drug in CKD injury. Figure 7 Figure D shows the schematic diagram of the echocardiogram results of the mouse heart after treatment with GP-pKlotho nano-drug in CKD injury. Figure 7 Figure E shows the schematic diagram of the statistical results of the left ventricular diastolic length of the mouse heart after treatment with GP-pKlotho nano-drug in CKD injury. Figure 7 Figure F shows the schematic diagram of the statistical results of the left ventricular posterior wall diastolic thickness of the mouse heart after treatment with GP-pKlotho nano-drug in CKD injury. Figure 7 Figure G shows the schematic diagram of the mRNA results of ANF in the mouse heart after treatment with GP-pKlotho nano-drug in CKD injury. Figure 7 Figure H shows the schematic diagram of the mRNA results of BNP in the mouse heart after treatment with GP-pKlotho nano-drug in CKD injury. Figure 7 Figure I shows the schematic diagram of the mRNA results of β-MHC in the mouse heart after treatment with GP-pKlotho nano-drug in CKD injury.
[0033] Figure 8This is the toxicity assessment result of the GP-pKlotho nano-drug of the present invention. Figure 8 A, Figure 8 B are the test results of the renal function indicators CRE and BUN respectively; Figure 8 C is the blood hemoglobin index of the mice after 4 weeks of treatment with the nano-drug, Figure 8 D is the blood white blood cell index of the mice after 4 weeks of treatment with the nano-drug, Figure 8 E is the blood red blood cell index of the mice after 4 weeks of treatment with the nano-drug, Figure 8 F is the hematocrit index of the blood of the mice after 4 weeks of treatment with the nano-drug, Figure 8 G is the change in the body weight of the mice after 4 weeks of treatment with the nano-drug; Figure 8 H is a schematic diagram of the hemolysis situation of the nano-drug in the blood; Figure 8 I is the HE staining of the tissues of the heart, liver, spleen, lung and kidney after 4 weeks of injection of the nano-drug. Detailed implementation manners
[0034] The following specific examples illustrate the implementation manners of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific implementation manners. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.
[0035] Example 1
[0036] Preparation and physicochemical property analysis of GP-pKlotho nano-drug
[0037] The compound is prepared by ring-opening metathesis polymerization
[0038] S1. After compound 1 ( Figure 1 A) is precipitated in excess anhydrous hexane, the guanidine-functionalized monomer and dichloromethane solution (Grubbs catalyst is added in advance) are degassed in a freeze-thaw cycle and added to the compound 1 solution. Then it is heated to room temperature and stirred for 30 - 90 minutes, and an excess of ethyl vinyl ether is added to terminate the polymerization reaction; then it is filtered, washed, and dried under vacuum to obtain a pale yellow powder as compound 2 ( Figure 1 B).
[0039] S2. 10 ml of trifluoroacetic acid is added to compound 2 to remove the tert-butoxycarbonyl protecting the amino group. Compound 2 is dissolved in dichloromethane after being added with trifluoroacetic acid in a ratio of 1:1. After the reaction is completed, it is stirred for 4 hours and dried under vacuum to obtain compound 3 ( Figure 1 C).
[0040] S3. The synthesized compound 3 was redissolved in dichloromethane and precipitated in anhydrous ether, followed by filtration, washing, and drying. Compound 3 and pKlotho( Figure 1 D) were placed in DMEM F12 medium at a mass ratio of 2 mg:1 μg for 10 - 30 minutes to synthesize the GP-pKlotho nanocompound( Figure 1 E).
[0041] The results are as shown in Figure 2 A - G. The GP-pKlotho nanodrug is spherical with uniform size. The particle size of the GP-pKlotho nanodrug is about 120 nm, and the surface charge is about 18 mv.
[0042] Example 2
[0043] Optimizing the CDS sequence of Klotho using codon degeneracy
[0044] (1) When expressing heterologous proteins, we hope to improve the expression efficiency of exogenous proteins through sequence design and induce the body to produce more proteins. Generally speaking, in host cells, the codons with high usage frequency (optimal codons) have high corresponding tRNA abundances. The mRNA composed of codons with high usage frequency also has high protein expression. There is a deviation in the codon usage frequency between the heterologous sequence and the optimal codons of the host cell. It is possible that the tRNA abundance corresponding to the codons in the heterologous protein sequence is very low in the host cell. The codons corresponding to low-abundance tRNAs are rare codons in the host cell. Rare codons will cause ribosomes to spend a lot of time finding the matching low-abundance tRNAs, resulting in ribosome stalling on the mRNA and even causing mRNA degradation. Therefore, codon optimization is required for heterologous protein expression, and synonymous codons corresponding to high-abundance tRNAs are selected to improve protein translation efficiency. The results are as shown in Figure 2 B.
[0045] The optimized CDS sequences of Klotho1 - 3 are as follows:
[0046]
[0047]
[0048]
[0049]
[0050] Klotho 3 sequence:
[0051]
[0052]
[0053] (2)GP-pKlotho can be efficiently expressed in HK2
[0054] The codon-optimized Klotho plasmids were synthesized into pKlotho1, pKlotho2, and pKlotho3. After transfection of HK2 cells for 72 hours, the following detections were carried out:
[0055] 1) Detection of Klotho mRNA expression by QPCR
[0056] Total RNA of the kidney was extracted using a total RNA extraction kit and transcribed into cDNA by SSRTII reverse transcriptase (Beijing Tsingke). Reaction system: 7.5 μL cDNA, 10 μL SYBR reverse transcriptase polymerase (Applied Biosystems, Waltham, MA), 1.25 μL specific primers, and the total volume was 20 μL.
[0057] The conditions were set as follows: 98°C for 30 s, 95°C for 30 s, 95°C for 15 s, 40 denaturation cycles, 60°C for 1 min, and β-actin was used as an internal standard.
[0058] The specific primer pairs were as follows:
[0059] Klotho: Forward: GTGCGTCCATCTGGGATACG; (SEQ ID NO.7)
[0060] Klotho: Reverse: TGTCGCGGAAGACGTTGTT; (SEQ ID NO.8)
[0061] The results were as Figure 4 shown in A. In HK2 cells, the expression level of Klotho2 after codon optimization was significantly higher than that of Klotho1 and Klotho3.
[0062] 2) Detection of Klotho expression by Western blot
[0063] Proteins in the kidney tissue were extracted, denatured at 95°C for 5 minutes after adding the loading buffer, separated by 10% SDS-PAGE, transferred to a 0.22 µm PVDF membrane, blocked with 5% dry skim milk in TBS-Tween-20 (TBS containing 0.1% Tween20) for 0.15 hours, incubated with Klotho antibody (1:1000) overnight at 4°C, incubated with anti-rabbit secondary antibody (1:2000) for 1 hour the next day, developed with ECL, photographed, and then analyzed using Imager J. The results were as Figure 4As shown in B-D, when GP-pKlotho1-3 was transfected into HK2 cells, the expression level of Klotho2 was significantly higher than that of Klotho1 and Klotho3.
[0064] 3) Immunohistochemistry
[0065] The kidneys were removed, fixed in 4% paraformaldehyde, embedded in paraffin, cut into 3.5-μm sections, deparaffinized, and then antigen retrieval was performed by incubating with 0.1 M sodium citrate (pH 6.0) at 95°C for 15 min. After incubation with blocking buffer, the tissue sections were exposed to monoclonal klotho antibody (1:100 dilution; CST, USA), then incubated with secondary antibody, and DAB was used for color development. Ten fields of view were randomly selected at a magnification of 10 for evaluation and scoring.
[0066] The results were as Figure 4 As shown in D-F, after injection of GP-pKlotho1-3, the expression level of Klotho2 in the kidneys was significantly higher than that of Klotho1 and Klotho3.
[0067] Example 3
[0068] Role of GP-pKlotho nanomedicine in acute kidney injury
[0069] Two hundred C57BL / 6 mice (Beijing HFK Biotechnology Co., Ltd.) weighing 20-22 g were selected. The mice were randomly divided into three models on average (n = 10), and each model was divided into 4 groups.
[0070] Model 1: Sham group, IR-AKI group, GP-pKlotho, IR-AKI + GP-pKlotho.
[0071] Model 2: Sham group, Cis-AKI group, GP-pKlotho, Cis-AKI + GP-pKlotho.
[0072] Model 3: Sham group, FA-AKI group, GP-pKlotho, FA-AKI + GP-pKlotho.
[0073] In Model 1, the bilateral kidneys of the mice in the AKI group were clamped for 35 minutes; in the AKI + GP-pKlotho group, GP-pKlotho (1 mg / kg) was intravenously injected 10 min after AKI; in the sham operation group, the same dose of PBS was injected; in the sham operation + GP-pKlotho (1 mg / kg) group, the same dose of PBS and GP-pKlotho were injected. Serum samples were collected and stored at -80 °C, and creatinine (CRE) and blood urea nitrogen (BUN) were detected using a CRE detection kit (Nanjing Jiancheng Bioengineering Institute, C011-2-1) and a BUN kit (Nanjing Jiancheng Bioengineering Institute, C013-2-1). The results are as Figure 5 shown in A, GP-pKlotho alleviated AKI in a dose-dependent manner, and the best therapeutic effect was achieved at 1 - 20 mg / kg.
[0074] In Model 2, the group with intraperitoneal injection of Cis (3 mg / kg); in the Cis (3 mg / kg) + GP-pKlotho (1 mg / kg) group, 200 μl of GP-pKlotho at 1 mg / kg was intraperitoneally injected; in the sham operation group, the same volume of PBS was injected; in the sham operation + GP-pKlotho group, the same volume of PBS and GP-pKlotho were injected. Serum samples were collected and stored at -80 °C, and CRE and BUN were detected using a CRE detection kit (Nanjing Jiancheng Bioengineering Institute, C011-2-1) and a BUN kit (Nanjing Jiancheng Bioengineering Institute, C013-2-1). The results are as Figure 5 shown in B, GP-pKlotho alleviated acute kidney injury caused by Cis in a dose-dependent manner, and the best therapeutic effect was achieved at 1 - 20 mg / kg.
[0075] In Model 3, the group with intraperitoneal injection of FA (250 mg / kg); in the FA (250 mg / kg) + GP-pKlotho (1 mg / kg) group, 200 μl of GP-pKlotho at 1 mg / kg was intraperitoneally injected; in the sham operation group, the same volume of PBS was injected; in the sham operation + GP-pKlotho group, the same volume of PBS and GP-pKlotho were injected. Serum samples were collected and stored at -80 °C, and CRE and BUN were detected using a CRE detection kit (Nanjing Jiancheng Bioengineering Institute, C011-2-1) and a BUN kit (Nanjing Jiancheng Bioengineering Institute, C013-2-1). The results are as Figure 5 shown in C, GP-pKlotho alleviated acute kidney injury caused by FA in a dose-dependent manner, and the best therapeutic effect was achieved at 1 - 20 mg / kg.
[0076] According to the above method, GP-pKlotho was intravenously injected into mice at a dose of 1 mg / kg. The mice were sacrificed 24 h after AKI, the mice were sacrificed 72 h after Cis, and the mice were sacrificed 48 h after FA. Two kidneys were removed, and the kidney tissues were stained with HE and the number of damaged renal tubules was counted to evaluate whether GP-pKlotho treatment improved acute kidney injury; The results are as Figure 5 shown in D-F of Figure 5 wherein obvious congestion areas appeared at the junction of the renal cortex and medulla after renal injury, and the congestion areas in the GP-pKlotho treatment group were significantly reduced (
[0077] in D-F); The loss of renal tubules was alleviated after treatment with GP-pKlotho.
[0078] QPCR was used to detect the mRNA expression of kidney injury molecule 1 (KIM-1) and neutrophil gelatinase-associated lipocalin (NGAL). The specific method is as follows:
[0079] Total RNA of the kidney was extracted using a total RNA extraction kit and transcribed into cDNA by SSRTII reverse transcriptase (Beijing Tsingke). Reaction system: 7.5 μL cDNA, 10 μL SYBR reverse transcriptase polymerase (Applied Biosystems, Waltham, MA), 1.25 μL specific primers, and the total volume was 20 μL.
[0080] The conditions were set as follows: 98 °C for 30 s, 95 °C for 30 s, 95 °C for 15 s, 40 denaturation cycles, 60 °C for 1 min, and β-actin was used as an internal standard.
[0081] The specific primer pairs are as follows:
[0082] KIM-1 forward: TCCGTGGCCCTTTTTGCTTA; (SEQ ID NO.9)
[0083] KIM-1 reverse: CTGCCTCTCCACCAACCTTT; (SEQ ID NO.10)
[0084] NGAL forward: TGAGTGTCATGTGTCTGGGC; (SEQ ID NO.11)
[0085] NGAL reverse: GAACTGATCGCTCCGGAAGT; (SEQ ID NO.12)
[0086] The results are as Figure 5As shown in Figures G - I, in the kidneys of acute kidney injury, the expression levels of KIM-1 and NGAL were significantly increased, while the treatment group could significantly inhibit the increase in the expression of KIM-1 and NGAL mRNA ( Figure 5 in Figures G, H, and I).
[0087] Example 3
[0088] Effect of GP-pKlotho Nanodrug on Renal Injury after CKD
[0089] Two hundred C57BL / 6 mice (Beijing HFK Biotechnology Co., Ltd.) weighing 20 - 22 g were selected and randomly divided into two models (n = 10 on average), and each model was divided into 4 groups.
[0090] Model 1: Sham group, Bi-AKI-14d group, GP-pKlotho, Bi-AKI-14d + GP-pKlotho.
[0091] Model 2: Sham group, CKD group, GP-pKlotho, CKD + GP-pKlotho.
[0092] 1) Establishment of AKI-14d model: The bilateral kidneys of mice in the AKI-14d group were clamped for 35 minutes; in the AKI-14d + GP-pKlotho group, different doses (1 mg / kg) of GP-pKlotho were intravenously injected 10 minutes after AKI-14d; in the sham operation group, the same dose of PBS was injected; in the sham operation + GP-pKlotho (1 mg / kg) group, the same dose of PBS and GP-pKlotho were injected. Serum samples were collected, stored at -80°C, and creatinine (CRE) and blood urea nitrogen (BUN) were detected using a CRE detection kit (Nanjing Jiancheng Bioengineering Institute, C011-2-1) and a BUN kit (Nanjing Jiancheng Bioengineering Institute, C013-2-1). The results were as Figure 6 shown in Figure A, and GP-pKlotho could relieve chronic renal injury caused by AKI-14d, with the best therapeutic effect at 1 mg / kg.
[0093] 2) Establishment of the CKD model: 1. Depilate the back, place the animal in the prone position on the operating table and disinfect the surgical area; 2. Incise the skin 1 cm to the left of the spinal column and 2 cm below the rib margin on the back. Yellow adipose tissue can be seen. Then, incise the fascia along the middle of the yellow adipose tissue and push aside the fat to expose the kidney; 3. Adjust the position to the right lateral position, extrude the kidney and dissect the tissues at both poles of the kidney (do not damage the adrenal gland). Dissect the connective tissues around the renal pedicle and between the lower part of the kidney and the ureter to completely free the kidney; 4. Place 4 / 0 suture lines approximately 0.4 cm above and below the renal hilum. Cut the **capsule at both poles, tighten the suture lines and excise the kidney tissues at both poles; 5. Drop antibiotics, suture and disinfect the surgical incision; 6. After 14 days, expose the right kidney, clamp the renal hilum with a vascular clamp and place a 6 / 0 suture line just below the vascular clamp. Ligate (ensure ligation of the ureter) and electrocoagulate and excise the kidney just above the vascular clamp; 7. Drop antibiotics, suture and disinfect the surgical incision. The model is formed after 8 weeks. At 10 min after the second CKD surgery, different doses (1 - 20 mg / kg) of GP-pKlotho were intravenously injected into the mice; in the sham operation group, the same dose of PBS was injected; in the sham operation + GP-pKlotho (1 mg / kg) group, equal doses of PBS and GP-pKlotho were injected. Serum samples were collected and stored at -80 °C. Creatinine (CRE) and blood urea nitrogen (BUN) were detected using a CRE detection kit (Nanjing Jiancheng Bioengineering Institute, C011-2-1) and a BUN kit (Nanjing Jiancheng Bioengineering Institute, C013-2-1). The results are as Figure 6 shown in B below. GP-pKlotho can alleviate CKD, and the treatment effect is the best at 1 mg / kg.
[0094] According to the above method, GP-pKlotho at 1 mg / kg was intravenously injected into the mice. The kidney tissues were stained with HE and the number of damaged renal tubules was counted to evaluate whether GP-pKlotho treatment improved acute kidney injury; the results are as Figure 6 shown in C - D below. After kidney injury, obvious congested areas appeared at the junction of the renal cortex and medulla. The congested areas in the GP-pKlotho treatment group were significantly reduced; the loss of renal tubules was alleviated after treatment with GP-pKlotho.
[0095] Example 4
[0096] GP-pKlotho alleviates myocardial hypertrophy after CKD
[0097] After 8 weeks of the CKD model, the mice were anesthetized and sacrificed, and their body weight, heart weight were measured, the length of the bones and muscles of the mice was measured, and statistical data analysis was performed. The results showed that the heart-to-body weight ratio in the experimental group increased significantly, and the heart-to-body weight ratio decreased significantly after GP-pKlotho treatment. The results showed that the heart-to-bone and muscle length in the experimental group increased significantly, and the heart-to-bone and muscle length decreased significantly after GP-pKlotho treatment. The results were as Figure 7 shown in D: The Sham group, CKD group, and CKD + GP-pKlotho were detected using a rodent ultrasonic imaging system (MYLAB™ Sigma Vet). The results showed that GP-pKlotho could relieve CKD-induced myocardial hypertrophy.
[0098] QPCR was used to detect the mRNA expression of ANF, BNP, and β-MHC
[0099] Total RNA of the kidney was extracted using a total RNA extraction kit and transcribed into cDNA by SSRTII reverse transcriptase (Beijing Tsingke). Reaction system: 7.5 mL cDNA, 10 uL SYBR reverse transcriptase polymerase (Applied Biosystems, Waltham, MA), 1.25 mL specific primers, and the total volume was 20 mL.
[0100] The conditions were set as follows: 98°C for 30 s, 95°C for 30 s, 95°C for 15 s, 40 denaturation cycles, 60°C for 1 min, and β-actin was used as an internal standard.
[0101] The specific primer pairs were as follows:
[0102] ANF forward: GTTGTCGCAGTTGTGACTGAG; (SEQ ID NO.13)
[0103] ANF reverse: GTGCAGCCTGTCCAAGAGTT; (SEQ ID NO.14)
[0104] BNP forward: AAGCTGCTGGAGCTGATAAGA; (SEQ ID NO.15)
[0105] BNP reverse: -GTTACAGCCCAAACGACTGAC; (SEQ ID NO.16)
[0106] β-MHC forward: GTGCCAAGGGCCTGAATGAG; (SEQ ID NO.17)
[0107] β-MHC reverse: -GCAAAGGCTCCAGGTCTGA; (SEQ ID NO.18)
[0108] The results are as Figure 7 shown in E - I. In the kidneys with chronic kidney injury, the expression levels of ANF, BNP, and β - MHC were significantly increased, while the treatment group could significantly inhibit the increase in the expression of ANF, BNP, and β - MHC mRNA ( Figure 7 in G, H, I).
[0109] Example 5
[0110] (1) Toxicity assessment of GP - pKlotho nanomedicine
[0111] HK - 2 cells were co - cultured with GP - pKlotho at different concentrations (0, 1, 25, 50, 100, 200, 400, 800 μg / mL). After 24 h, cell viability was measured. 800 μg / mL had no effect on cell viability, indicating the biosafety of the prepared GP - pKlotho in in vitro experiments.
[0112] GP - pKlotho was dissolved in water, PBS, F12 medium, or FBS. After 24 h, the dissolution of GP - pKlotho was observed. No precipitate was formed after 24 h, indicating that GP - pKlotho had good solubility.
[0113] After treating mice with GP - pKlotho (20 mg / kg) for 7 days, blood was collected to analyze CRE, BUN, WBC, HGB, RBC, HTC, and ALT in the blood, and the heart, liver, spleen, lung, and kidney were subjected to HE staining. The results are as Figure 8 shown in G. Compared with the control group, there was no significant change in the body weight of the mice treated with GP - pKlotho. Blood analysis showed that CRE, BUN, WBC, HGB, RBC, and HTC in the blood had no significant difference compared with the control group ( Figure 8 in A, B, C, D, E, F); after HE staining of the heart, liver, spleen, lung, and kidney, microscopic examination showed no obvious pathological changes in each organ ( Figure 8 in I).
[0114] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present invention rather than to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention, and they should all be covered within the scope of the claims of the present invention.
Claims
1. A preparation method of GP-pKlotho nano-drug, characterized in that, Comprising the following steps: S1. After the compound 1 is precipitated in excess anhydrous hexane, the guanidine-functionalized monomer and dichloromethane solution are degassed by freeze-thaw cycles and added to the compound 1 solution; the mixed solution is heated to room temperature and stirred for 30 - 90 minutes, and an excess of ethyl vinyl ether is added to terminate the polymerization reaction; then it is filtered, washed, and dried under vacuum to obtain compound 2; wherein a Grubbs catalyst is added in advance to the dichloromethane solution for catalytic reaction; S2. Compound 2 is added with trifluoroacetic acid in a ratio of 1:1 and dissolved in dichloromethane, stirred for 4 hours after the reaction is completed, and dried under vacuum to obtain organic compound 3; S3. The synthesized compound 3 was redissolved in dichloromethane and precipitated in anhydrous ether, followed by filtration, washing, and drying. Compound 3 and the codon-optimized Klotho plasmid were placed in a culture medium at a mass ratio of 2 mg:1 μg and cultured for 10 - 30 minutes to synthesize the GP-pKlotho nanomedicine. The codon-optimized Klotho plasmid sequence is shown in SEQ ID NO.3, and the transcribed protein sequence is shown in SEQ ID NO.
4. The structural formula of compound 1 is , and the structural formula of compound 2 is , and the structural formula of compound 3 is .
2. The preparation method of the GP-pKlotho nano-drug according to claim 1, characterized in that, In step S1, compound 2 is a pale yellow powder, and its reaction yield is 90% - 98%.
3. The preparation method of the GP-pKlotho nano-drug according to claim 2, characterized in that, After the reaction in step S2 is completed, the excess trifluoroacetic acid is removed by azeotropic distillation with methanol.
4. The preparation method of the GP-pKlotho nano-drug according to claim 3, characterized in that, The washing and drying steps in step S3 are as follows: compound 3 is fully dissolved in water, transferred to a dialysis tube with a molecular weight cut-off of 3000 g / mol, dialyzed in ultrapure water for 1 - 5 days, and then compound 3 is freeze-dried to obtain a white powder.
5. The preparation method of the GP-pKlotho nano-drug according to claim 1, characterized in that, Compound 1, compound 2, and compound 3 are respectively characterized by 1H NMR and gel permeation chromatography to evaluate the chemical composition and molecular weight distribution.
6. The GP-pKlotho nanomedicine prepared by the preparation method of the GP-pKlotho nanomedicine according to any one of claims 1 - 4.
7. Use of the GP-pKlotho nanomedicine according to claim 6 in the preparation of a medicament for treating acute kidney disease or chronic kidney disease.
8. A GP-pKlotho nano-drug preparation, characterized in that, Comprising the GP-pKlotho nanomedicine according to claim 6 and one or more pharmaceutically acceptable drug carriers.
9. Use of the GP-pKlotho nanomedicine preparation according to claim 8 in the preparation of a medicament preparation for treating acute kidney disease or chronic kidney disease.
Citation Information
Patent Citations
Therapeutic recombinant klotho proteins and compositions and methods involving the same
CN109219663A