A SNP molecular marker associated with fleshy root core traits of fruit radish and its application

Abstract

The present invention belongs to the technical field of molecular markers, and specifically relates to a SNP molecular marker related to the fleshy root bran core trait of fruit radish and its application. The present invention uses radish "XYB36-2" as a reference genome, and finds a first SNP molecular marker and a second SNP molecular marker that are closely linked to the fleshy root bran core trait of radish; the first SNP molecular marker corresponds to the 22720532bp of chromosome 8 of the XYB36-2 radish genome, and the base is G / T; the second SNP molecular marker corresponds to the 24855343bp of chromosome 8 of the XYB36-2 radish genome, and the base is G / T. The SNP molecular marker provided by the present invention can be used to quickly, stably, efficiently, and at low cost to identify the fleshy root bran core trait of fruit radish, laying the foundation for the breeding of fleshy root bran core-resistant fruit radishes, and the accuracy rate of identifying the fleshy root bran core-resistant phenotype is 83.6%.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and in particular relates to a SNP molecular marker associated with a fruit radish fleshy root hollow core trait and an application thereof. Background Art

[0002] Radish (Raphanus sativus L.) is one of the major vegetables in my country, with an annual cultivation area of ​​18 million mu. In recent years, the green radish variety, fruit radish, has been favored by my country's vegetable consumer market for its crisp, sweet, refreshing and juicy fresh-eating characteristics. However, in the agricultural production process, it was found that most fruit radishes showed hollow heart symptoms during the development period of the fleshy roots, the harvest period and the shelf life, resulting in serious loss of water and nutrients in the fleshy roots, and they were inedible. This physiological disease seriously affects the formation of the yield and quality of fruit radishes, limiting the further development of the radish industry.

[0003] Traditional methods of investigating the phenotype of chaff core rely on damaging sampling surveys, and the survival rate of the investigated materials is extremely low, which limits breeders from using traditional breeding methods to cultivate chaff core-tolerant fruit radish varieties. Developing a non-damaging phenotype investigation method is of great significance for the cultivation of chaff core-tolerant radish varieties.

[0004] SNP (single nucleotide polymorphism) is the smallest unit of genomic variation. Developing SNP into molecular markers can identify a certain genetic trait in a targeted manner. Discovering SNPs that are highly associated with the bran-tolerance phenotype and developing them into effective molecular markers is crucial to achieving non-destructive identification of the bran-tolerance phenotype of fruit radishes and breeding new bran-tolerance fruit radish varieties. Summary of the invention

[0005] The purpose of the present invention is to provide and develop SNP molecular markers related to the hollow core trait of fleshy roots of fruit radish, so as to quickly, stably, efficiently and at low cost identify the hollow core trait of fleshy roots of fruit radish without damaging the fleshy roots, thereby laying a foundation for the breeding of fleshy root hollow core-resistant fruit radishes.

[0006] The present invention provides a SNP molecular marker associated with the fleshy root hollow core trait of fruit radish, wherein the SNP molecular marker comprises a first SNP molecular marker and a second SNP molecular marker;

[0007] The first SNP molecular marker corresponds to the 22720532 bp of chromosome 8 of the XYB36-2 radish genome, and the base is G / T;

[0008] The second SNP molecular marker corresponds to the 24855343 bp of chromosome 8 of the XYB36-2 radish genome, and the base is G / T.

[0009] The present invention also provides a DNA fragment related to the fleshy root hollow core trait of fruit radish, wherein the DNA fragment comprises a first DNA fragment and a second DNA fragment;

[0010] The first DNA fragment includes the nucleotide sequence shown in SEQ ID NO.1, wherein Y is G / T;

[0011] The second DNA fragment includes the nucleotide sequence shown in SEQ ID NO.2, wherein Y is G / T.

[0012] The present invention also provides the use of the SNP molecular marker or DNA fragment or primer combination or kit described in the above technical solution in identifying fleshy root hollowness-resistant fruit radish.

[0013] The present invention also provides the use of the SNP molecular marker or DNA fragment or primer combination or kit described in the above technical solution in the auxiliary breeding of fleshy root and hearth-tolerance fruit radish.

[0014] The present invention also provides a method for identifying fleshy root chaff-resistant fruit radish, comprising the following steps:

[0015] Using the DNA of the fruit radish sample to be tested as a template, PCR amplification is performed using a primer pair for detecting the first SNP molecular marker or a primer pair for detecting the first DNA fragment described in the above technical solution to obtain a first PCR amplification product;

[0016] Using the DNA of the fruit radish sample to be tested as a template, PCR amplification is performed using a primer pair for detecting the second SNP molecular marker or a primer pair for detecting the second DNA fragment described in the above technical solution to obtain a second PCR amplification product;

[0017] If the first PCR amplification product corresponds to the deoxyribonucleotide pair G:G at position 22720532 of chromosome 8 of the XYB36-2 radish genome, and the second PCR amplification product corresponds to the deoxyribonucleotide pair G:G at position 24855343 of chromosome 8 of the XYB36-2 radish genome, then the fruit radish sample to be tested is a fleshy root and hollowness-resistant fruit radish.

[0018] Beneficial effects:

[0019] The present invention uses Jingyan Green Show Radish and Green Like Jade Radish as parents, and uses Illumina Hiseq 2500 sequencing platform to perform whole genome resequencing on parent materials and F2 population extreme phenotype mixed pool materials. Using radish "XYB36-2" as a reference genome (http: / / brassicadb.cn / ) to analyze the SNP site polymorphism between parents, it is found that the SNP site closely linked to the fleshy root dregs trait of radish is found, including the first SNP molecular marker and the second SNP molecular marker; the first SNP molecular marker corresponds to the 22720532bp of chromosome 8 of the XYB36-2 radish genome, and the base is G / T; the second SNP molecular marker corresponds to the 24855343bp of chromosome 8 of the XYB36-2 radish genome, and the base is G / T. Based on the above SNP sites, the fleshy root dregs trait of fruit radish can be identified quickly, stably, efficiently and at low cost, laying a foundation for the breeding of fleshy root dregs resistant to dregs. The results of the embodiment show that the accuracy rate of identifying the fleshy root bran-resistant phenotype using the SNP molecular marker provided by the present invention is 83.6%. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0021] Figure 1 This is the classification standard for the hollow core of radish fleshy roots; the red box indicates the hollow core, and the scale is 5 cm;

[0022] Figure 2 The results of the identification of the hollow heart phenotype of Green Like Jade Radish, Jingyan Green Show Radish and their offspring; A is the hollow heart phenotype of Green Like Jade Radish, Jingyan Green Show Radish and F1 inbred line, P74 is Jingyan Green Show Radish, P75 is Green Like Jade Radish, and the scale is 5 cm; B is the hollow heart grade distribution result of the F2 segregating genetic population of Green Like Jade Radish and Jingyan Green Show Radish;

[0023] Figure 3 The results corresponding to the key regulatory sites for controlling the tolerance of fleshy roots of fruit radish to hearth in Example 2 were mined by BSA mixed pool sequencing;

[0024] Figure 4 The KASP genotyping PCR method is used to perform genotyping results on different genetic materials; A is the P08SNP1 typing result, the red-marked sample on the Y-axis is G:G homozygous, the blue-marked sample on the X-axis is T:T homozygous, and the green sample in the middle of the polymerization is G:T heterozygous; B is the P08SNP2 typing result, the red-marked sample on the Y-axis is G:G homozygous, the blue-marked sample on the X-axis is T:T homozygous, and the green sample in the middle of the polymerization is G:T heterozygous. DETAILED DESCRIPTION

[0025] The present invention provides a SNP molecular marker associated with the fleshy root hollow core trait of fruit radish, wherein the SNP molecular marker comprises a first SNP molecular marker and a second SNP molecular marker;

[0026] The first SNP molecular marker corresponds to the 22720532 bp of chromosome 8 of the XYB36-2 radish genome, and the base is G / T;

[0027] The second SNP molecular marker corresponds to the 24855343 bp of chromosome 8 of the XYB36-2 radish genome, and the base is G / T.

[0028] The present invention also provides a DNA fragment related to the fleshy root hollow core trait of fruit radish, wherein the DNA fragment comprises a first DNA fragment and a second DNA fragment;

[0029] The first DNA fragment includes the nucleotide sequence shown in SEQ ID NO.1, wherein Y is G / T;

[0030] The second DNA fragment includes the nucleotide sequence shown in SEQ ID NO.2, wherein Y is G / T.

[0031] The nucleotide sequence information described in SEQ ID NO.1-2 of the present invention is as follows:

[0032] SEQ ID NO.1: 5'-AAATTACTCTAATAATATATTTATTGGTTTGCTCCTCGT AACGGCTGAGTATTTTTTTTTGTTTCATAATGAATATACTTTCATAAAAACTCCCACTCACYTTAATCAAACTCAATGCGATAATACTTTCATAAACATCGAATTTCATGTATTTCGAAATAGGAAAGATATCCTTTTGACTTTTTTTCTTTGTTCTGAAAA-3'; where Y is G / T;

[0033] SEQ ID NO.2: 5'-AGTATACTCACAGAAGCTGAATCGATGGTGACAATTCCGTGGAGATTTA GCTGAACTCTCACTTTGACACATGCTGCTTCTGCGTGGGAAATTTGAAAAG YACGAATCTACAAAAAACATCACAGAACAGACTAAGAGTTCCAGTACAGA GAGCCAGAGACTAATGGTGGTATAATCAGCCAAAACATACTTAGATTGTAG-3'; where Y is G / T.

[0034] The SNP molecular marker or DNA fragment provided by the present invention is closely related to the fleshy root hollowness trait of fruit radish. In view of the role of the SNP molecular marker or DNA fragment provided by the present invention, the use of the SNP molecular marker or DNA fragment or its primer combination or its kit described in the above technical scheme in identifying fleshy root hollowness-resistant fruit radish, and the use of the SNP molecular marker or DNA fragment or its primer combination or its kit described in the above technical scheme in assisted breeding of fleshy root hollowness-resistant fruit radish also fall within the protection scope of the present invention.

[0035] The present invention also provides a method for identifying fleshy root chaff-resistant fruit radish, comprising the following steps:

[0036] Using the DNA of the fruit radish sample to be tested as a template, PCR amplification is performed using a primer pair for detecting the first SNP molecular marker or a primer pair for detecting the first DNA fragment described in the above technical solution to obtain a first PCR amplification product;

[0037] Using the DNA of the fruit radish sample to be tested as a template, PCR amplification is performed using a primer pair for detecting the second SNP molecular marker or a primer pair for detecting the second DNA fragment described in the above technical solution to obtain a second PCR amplification product;

[0038] If the first PCR amplification product corresponds to the deoxyribonucleotide pair G:G at position 22720532 of chromosome 8 of the XYB36-2 radish genome, and the second PCR amplification product corresponds to the deoxyribonucleotide pair G:G at position 24855343 of chromosome 8 of the XYB36-2 radish genome, then the fruit radish sample to be tested is a fleshy root and hollowness-resistant fruit radish.

[0039] The present invention uses the DNA of the fruit radish sample to be tested as a template, and uses the primer pair for detecting the first SNP molecular marker or the primer pair for detecting the first DNA fragment described in the above technical scheme to perform PCR amplification to obtain a first PCR amplification product. In the present invention, the reaction system for the PCR amplification is preferably 10 μL, including 50 ng of radish genomic DNA, 5 μL of KASP V4.0 2×Master Mix, 0.14 μL of KASP 72×assay mix and the balance of ddH2O. The KASPV4.0 2×Master Mix described in the present invention preferably includes a fluorescent group probe, a fluorescent quenching probe, a high-fidelity DNA synthase and dNTP. The KASP 72×assay mix described in the present invention preferably includes 100 μmol·L -1 Forward primer, 100 μmol·L -1 Upstream primer, 100 μmol·L -1 The volume ratio of the reverse primer and ddH2O is preferably 12:12:30:46; the reaction procedure of the PCR amplification preferably includes: pre-denaturation at 95°C for 15 min; denaturation at 94°C for 20 s, annealing at 61°C for 60 s (0.6°C drop per cycle), 10 cycles; denaturation at 94°C for 20 s, annealing at 55°C for 60 s, 26 cycles.

[0040] The present invention uses the DNA of the fruit radish sample to be tested as a template, and uses the primer pair for detecting the second SNP molecular marker or the primer pair for detecting the second DNA fragment described in the above technical solution to perform PCR amplification to obtain a PCR amplification product. The reaction system and procedure of the PCR amplification of the present invention have been described above and will not be repeated here.

[0041] The present invention can judge the fleshy root and hollow core phenotype of the fruit radish sample to be tested based on the first PCR amplification product and the second PCR amplification product. Specifically, if the first PCR amplification product corresponds to the deoxyribonucleotide pair at position 22720532 of chromosome 8 of the XYB36-2 radish genome, which is G:G, and the second PCR amplification product corresponds to the deoxyribonucleotide pair at position 24855343 of chromosome 8 of the XYB36-2 radish genome, which is G:G, then the fruit radish sample to be tested is a fleshy root and hollow core resistant fruit radish, and the other results are all fleshy root and hollow core fruit radish. The present invention preferably makes a judgment based on the fluorescence result. Specifically, if the fluorescence signal of the first PCR amplification product is displayed as red, and the fluorescence signal of the second PCR amplification product is displayed as red, then the fruit radish sample to be tested is a fleshy root and hollow core resistant fruit radish, and the other results are all fleshy root and hollow core fruit radish.

[0042] In the specific implementation of the present invention, it is preferred to refer to the "Radish Germplasm Resource Description Specification" published by the National Crop Germplasm Resource Platform (http: / / www.cgris.net), and radish hollowness is divided into 5 levels. Level 0: no hollowness; Level 1: a small number of scattered, dot-shaped or strip-shaped white tissues in the center of the fleshy root; Level 3: about 1 / 3 of the tissues from the center of the fleshy root are whitish; Level 5: about 2 / 3 of the tissues from the center of the fleshy root are whitish; Level 7: the entire fleshy root is completely hollow. Among them, the hollowness level 0 and level 1 phenotypes are regarded as hollowness-resistant phenotypes, and the hollowness levels 3 to 7 are regarded as hollowness phenotypes.

[0043] To further illustrate the present invention, a SNP molecular marker associated with the fleshy root hollow core trait of fruit radish provided by the present invention and its application are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0044] Example 1

[0045] 1. Evaluation criteria for the fleshy root core characteristics of fruit radish

[0046] A survey of the hollow core phenotype of 57 fruit radish planting resources stored in the Vegetable Research Institute of Beijing Academy of Agricultural and Forestry Sciences was conducted. The degree of hollow core of fruit radish was divided into 5 levels according to the reference standard ( Figure 1 ):

[0047] Bran level 0: no bran tissue;

[0048] Hollow heart level 1: There are a few scattered, dot-shaped or strip-shaped whitish tissues in the center of the fleshy root;

[0049] Hollow heart level 3: About 1 / 3 of the tissue from the center of the fleshy root to the outside is whitish;

[0050] Hollow heart level 5: About 2 / 3 of the tissue from the center of the fleshy root to the outside is whitish;

[0051] Hollow heart level 7: The entire fleshy root is completely hollow inside;

[0052] Among them, the bran heart level 0 and 1 phenotypes are regarded as bran heart resistant phenotypes, and the bran heart levels 3 to 7 are regarded as bran heart phenotypes.

[0053] 2. Based on the evaluation criteria of step 1, Jingyan Green Show Radish (a heart-breaking variety, heart-breaking level 7) and Green Like Jade Radish (a heart-breaking resistant variety, heart-breaking level 0) were used as parents to construct a segregating genetic population. Jingyan Green Show Radish (hereinafter referred to as P74) and Green Like Jade Radish (hereinafter referred to as P75) were purchased from Jingyan Yinong (Beijing) Seed Co., Ltd. Through the investigation of the heart-breaking phenotype of the F2 segregating population, it was found that the F1 generation plants showed a heart-breaking level 3 phenotype, and the heart-breaking phenotype of individual plants in the F2 segregating genetic population showed different levels of distribution ( Figure 2 ). Therefore, it is shown that the hollow core of radish fleshy roots is a quantitative genetic trait controlled by major effect genes.

[0054] Example 2

[0055] Discovery of key QTL loci controlling radish fleshy root quality and heart-dryness tolerance

[0056] 1. In order to explore the genetic mechanism controlling the hollowness of radish flesh, BSA pool sequencing analysis was performed on the F2 segregating genetic population in Example 1. From 354 F2 segregating genetic populations, 20 individual plants with extreme hollowness (grade 7) and extreme hollowness tolerance (grade 0) phenotypes were selected, and equal amounts of genomic DNA were evenly mixed to construct the extreme hollowness tolerance phenotype pool pp1 and the extreme hollowness phenotype pool pp2;

[0057] 2. The genomic DNA of leaves of different radish genetic materials was extracted by CTAB method, and the whole genomic DNA was dissolved by ddH2O; the genomic DNA samples of P74, P75, pp1 and pp2 were resequenced by Illumina Hiseq 2500 sequencing platform. The SNP site polymorphism between the parents was analyzed using radish "XYB36-2" as the reference genome (http: / / brassicadb.cn / ), and 4.82, 5.03, 6.56 and 6.82Gb clean reads were obtained, respectively, and the sequencing depth reached 12.6×, 13.1×, 17.1× and 17.8×, and the data volume met the needs of subsequent analysis.

[0058] 3. GATK (v3.8) software was used to analyze the variation frequency of SNP sites between the genomes of each genetic material. First, the SNP variation sites were filtered according to the following criteria: 1. SNP sites with multiple genotypes were filtered out, and only di-allelic genotype sites were retained; 2. SNP sites with mixed pool reads support less than 4 were filtered out; 3. SNP sites with homozygous and consistent genotypes between mixed pools were filtered out; 4. SNP sites that were not homozygous and inconsistent between the two parents were filtered out. Finally, 641,047 high-quality SNP sites were obtained. Subsequently, the SNP-index algorithm was used to analyze the variation frequency of high-quality SNP sites between mixed pools, and it was found that only the ΔSNP-index value in the range of 22,090,000 to 25,400,000 (3.31Mb) of radish chromosome 8 (corresponding to the XYB36-2 radish gene) was significantly higher than 0.5 (P<0.001; Figure 3 ). Therefore, there is a major QTL interval controlling the tolerance of fleshy roots to heartburn on chromosome 8 of radish.

[0059] Example 3

[0060] Mining and rapid identification of SNP loci for the bran-resistant phenotype of fleshy roots in fruit radish

[0061] 1. Based on the conclusion of Example 2, it was further found that there were 18538 SNP sites in the range of controlling the bran resistance of radish fleshy roots, of which 6551 SNP sites had a ΔSNP-index greater than 0.5 and a P value less than 0.001. In order to develop reliable SNP molecular markers for detecting bran resistance phenotypes, based on the radish reference genome (radish "XYB36-2" genome) sequence, high-quality SNP sites at 22720532 and 24855343 were selected on both sides of the major regulatory interval of radish chromosome 8 for cloning verification. Specific primers were designed 100bp upstream and downstream of each SNP site.

[0062] 2. Using the genomic DNA of the parental material as a template, a DNA fragment containing a specific SNP was amplified using a high-fidelity polymerase. The PCR product was sequenced and analyzed, and the results are shown in Table 1.

[0063] Table 1 Amplification results corresponding to different materials

[0064]

[0065] According to Table 1, it can be seen that the nucleotide pair at position 22720532 of chromosome 8 is T:T homozygous in the P74 material and G:G homozygous in the P75 material, and the SNP site is named P08SNP1 (the site corresponding to the first SNP molecular marker); the nucleotide pair at position 24855343 of chromosome 8 is T:T homozygous in the P74 material and G:G homozygous in the P75 material, and the SNP site is named P08SNP2 (the site corresponding to the second SNP molecular marker).

[0066] 3. To test whether the above SNP loci can be developed into reliable molecular markers, the KASP genotyping PCR method was used to perform genotyping analysis on P74, P75, F1 generation (2 plants) and F2 extreme phenotype plants (4 plants with extreme resistance and 4 plants with extreme heartburn);

[0067] KASP genotyping PCR reaction system: 50ng radish genomic DNA, 5μL KASP V4.02×Master Mix, 0.14μL KASP 72×assay mix, add ddH2O to 10μL (suitable for 96-well plate). Among them, KASP V4.0 2×MasterMix is ​​a product of LGC, which consists of FAM fluorescent group probe (excitation wavelength is 485nm, emission wavelength is 520nm), HEX fluorescent group probe (excitation wavelength is 528nm, emission wavelength is 560nm), FAM fluorescent quenching probe, HEX fluorescent quenching probe, high-fidelity DNA synthase and dNTP. KASP 72×assay mix consists of 100μmol·L-1 forward primer, 100 μmol·L -1 Upstream primer, 100 μmol·L -1 The reverse primer and ddH2O were mixed in a volume ratio of 12:12:30:46; one blank negative control was set for each batch of PCR reaction;

[0068] KASP genotyping PCR reaction program: 95°C pre-denaturation for 15 min; 94°C denaturation for 20 s, 61°C annealing for 60 s (0.6°C drop per cycle), 10 cycles; 94°C denaturation for 20 s, 55°C annealing for 60 s, 26 cycles;

[0069] The fluorescence signals of KASP genotyping PCR products were collected under different excitation wavelengths using the bidirectional single excitation plate reader PHERAstar. The PHERAstar data were scanned by KrakenTM software, and the polymorphism of specific SNP sites was analyzed. Among them, the homozygous allele type samples connected to the FAM fluorescent label sequence showed blue marks, and the test samples were aggregated near the X axis; the homozygous allele type samples connected to the HEX fluorescent label sequence showed red marks, and the test samples were aggregated near the Y axis; the heterozygous allele type samples showed green marks, and the test samples were aggregated between the X and Y axes; the pink marks represented the samples that could not be clearly typed by the amplified products; and the black marks represented the negative control group.

[0070] The results of KASP genotyping PCR showed that the SNP site P08SNP1 and P08SNP2 detection primers can accurately type different genetic materials ( Figure 4 ). The P08SNP1 site is T:T homozygous or G:T heterozygous, and the plant phenotype is brackish heart level 7; this site is G:G homozygous, and the fleshy root phenotype is brackish heart level 0. The P08SNP2 site is T:T homozygous or G:T heterozygous, and the fleshy root phenotype is brackish heart level 7; this site is G:G homozygous, and the plant phenotype is brackish heart level 0. The SNP site P08SNP1 site G:G homozygous and the P08SNP2 site G:G homozygous can be used as molecular markers to identify the brackish heart resistance phenotype of fruit radish fleshy roots, so they are named SNP molecular markers P08SNP1[G:G] and P08SNP2[G:G] respectively;

[0071] If the P08SNP1 site is T:T homozygous and the P08SNP2 site is T:T homozygous, the material has a bran-heart phenotype; if the P08SNP1 site is G:T heterozygous and the P08SNP2 site is T:T homozygous or G:T heterozygous or G:G homozygous, the material has a bran-heart phenotype; if the P08SNP1 site is G:G homozygous and the P08SNP2 site is G:G homozygous, the material has a bran-heart-resistant phenotype.

[0072] Example 4

[0073] Evaluation of the application of SNP molecular markers P08SNP1[G:G] and P08SNP2[G:G] in detecting the core-dryness phenotype of fruit radish

[0074] In order to clarify the accuracy of SNP molecular markers P08SNP1[G:G] and P08SNP2[G:G] in identifying the phenotype of fruit radish fleshy root resistant to chaff, the genotype and chaff phenotype association analysis was performed on individual plants of the F2 segregation population (354 samples). In the F2 segregation population, 67 plants were homozygous for G:G at the P08SNP1 locus and homozygous for G:G at the P08SNP2 locus, of which 56 plants showed the phenotype of fleshy root resistant to chaff, and 11 plants showed the phenotype of fleshy root resistant to chaff. The accuracy of phenotypic identification by P08SNP1[G:G] and P08SNP2[G:G] double markers was 83.6% (Table 2).

[0075] Table 2 Analysis of phenotype and genotype of fleshy root core in F2 segregating population of fruit radish

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083] Based on the above content, it can be seen that the molecular markers P08SNP1[G:G] and P08SNP2[G:G] developed by the present invention are closely related to the radish fleshy root hollow core phenotype. The joint detection of molecular markers P08SNP1[G:G] and P08SNP2[G:G] has a high success rate in identifying the radish fleshy root hollow core resistance phenotype. The method can be applied to the large-scale screening of the fruit radish hollow core resistance phenotype under non-damage conditions, and can also be applied to molecular marker-assisted selection to quickly screen excellent breeding materials from backcross and segregation populations.

[0084] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A DNA fragment related to the fleshy root hollow core trait of fruit radish, characterized in that: The DNA fragments include a first DNA fragment and a second DNA fragment; The first DNA fragment includes the nucleotide sequence shown in SEQ ID NO.1, wherein Y is the first polymorphic site, and its base is G / T; The second DNA fragment includes the nucleotide sequence shown in SEQ ID NO.2, wherein Y is the second polymorphic site, and its base is G / T; The fruit radish whose genotypes corresponding to the first polymorphic site and the second polymorphic site in the genome are both G:G exhibits the trait of fleshy root and hearth resistance.

2. Use of a reagent for detecting SNP molecular markers or a reagent for detecting the DNA fragment according to claim 1 in identifying fleshy root and hearth-resistant fruit radish, characterized in that: The SNP molecular markers include a first SNP molecular marker and a second SNP molecular marker; The first SNP molecular marker corresponds to the 22720532 bp of chromosome 8 of the XYB36-2 radish genome, and the base is G / T; The second SNP molecular marker corresponds to the 24855343 bp of chromosome 8 of the XYB36-2 radish genome, and the base is G / T; If the genotype corresponding to position 22720532 of chromosome 8 of the XYB36-2 radish genome in the genome of the fruit radish to be tested is G:G, and the genotype corresponding to position 24855343 of chromosome 8 of the XYB36-2 radish genome is G:G, then the fruit radish to be tested is a fleshy root chaff-tolerant fruit radish; Alternatively, if the genotype corresponding to the first polymorphic site described in claim 1 in the genome of the fruit radish to be tested is G:G, and the genotype corresponding to the second polymorphic site described in claim 1 is G:G, then the fruit radish to be tested is a fleshy root hollowness-resistant fruit radish.

3. Use of a reagent for detecting SNP molecular markers or a reagent for detecting the DNA fragment according to claim 1 in auxiliary breeding of fleshy root and hollow-resistant fruit radish, characterized in that: The SNP molecular markers include a first SNP molecular marker and a second SNP molecular marker; The first SNP molecular marker corresponds to the 22720532 bp of chromosome 8 of the XYB36-2 radish genome, and the base is G / T; The second SNP molecular marker corresponds to the 24855343 bp of chromosome 8 of the XYB36-2 radish genome, and the base is G / T; If the genotype corresponding to position 22720532 of chromosome 8 of the XYB36-2 radish genome in the genome of the fruit radish to be tested is G:G, and the genotype corresponding to position 24855343 of chromosome 8 of the XYB36-2 radish genome is G:G, then the fruit radish to be tested is a fleshy root chaff-tolerant fruit radish; Alternatively, if the genotype corresponding to the first polymorphic site described in claim 1 in the genome of the fruit radish to be tested is G:G, and the genotype corresponding to the second polymorphic site described in claim 1 is G:G, then the fruit radish to be tested is a fleshy root hollowness-resistant fruit radish.

4. A method for identifying fleshy root rot-resistant fruit radish, characterized in that: The method comprises the steps of detecting the SNP molecular marker or the DNA fragment according to claim 1; The SNP molecular marker includes a first SNP molecular marker and a second SNP molecular marker; the first SNP molecular marker corresponds to 22720532bp of chromosome 8 of the XYB36-2 radish genome, and the base is G / T; the second SNP molecular marker corresponds to 24855343bp of chromosome 8 of the XYB36-2 radish genome, and the base is G / T; if the genotype corresponding to position 22720532 of chromosome 8 of the XYB36-2 radish genome in the genome of the fruit radish to be tested is G:G, and the genotype corresponding to position 24855343 of chromosome 8 of the XYB36-2 radish genome is G:G, then the fruit radish to be tested is a fleshy root bran-resistant fruit radish; The method comprises the following specific steps: using the DNA of the fruit radish sample to be tested as a template, performing PCR amplification using a primer pair for detecting the first SNP molecular marker or a primer pair for detecting the first DNA fragment described in claim 1 to obtain a first PCR amplification product; Using the DNA of the fruit radish sample to be tested as a template, PCR amplification is performed using a primer pair for detecting the second SNP molecular marker or a primer pair for detecting the second DNA fragment described in claim 1 to obtain a second PCR amplification product; If the first PCR amplification product corresponds to the deoxyribonucleotide pair G:G at position 22720532 of chromosome 8 of the XYB36-2 radish genome, and the second PCR amplification product corresponds to the deoxyribonucleotide pair G:G at position 24855343 of chromosome 8 of the XYB36-2 radish genome, then the fruit radish sample to be tested is a fleshy root bran-resistant fruit radish; Alternatively, if the deoxyribonucleotide pair of the first PCR amplification product corresponding to the first polymorphic site described in claim 1 is G:G, and the deoxyribonucleotide pair of the second PCR amplification product corresponding to the second polymorphic site described in claim 1 is G:G, then the fruit radish sample to be tested is a fleshy root and hollow-resistant fruit radish.

Images