A composite protein source and its application
Through the innovative ratio of compound protein sources, the problem of fish meal replacement in the aquaculture industry has been solved, the protein digestibility and intestinal health of fish have been improved, and the demand of the aquaculture industry for high-quality protein sources has been met.
Patent Information
- Application Number
- CN202311692532.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-08
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2043-12-08
AI Technical Summary
The aquaculture industry has an increasing demand for high-quality protein sources, but fish meal production is insufficient and the price is high. Existing alternative proteins such as soy protein have problems such as amino acid imbalance, anti-nutritional factors and poor palatability in aquatic feed, making it difficult to replace fish meal.
A composite protein source of mealworm powder, chlorella powder, ethanol clostridium protein and cottonseed protein concentrate in a mass ratio of 1:1:5:5-1:1:7:3 is used to partially or completely replace fish meal to achieve amino acid balance and complementary advantages for use in fish feed.
Improve the apparent digestibility of fish protein and protease activity, promote intestinal amino acid absorption, enhance intestinal health and antioxidant capacity, improve intestinal tight connections, and do not affect fish growth.
Smart Images

Figure CN117717124B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of aquatic feed, and in particular to a composite protein source and application thereof. Background Art
[0002] The Food and Agriculture Organization of the United Nations (FAO) notes that aquaculture is experiencing rapid growth, providing nearly one-third of human animal protein consumption, leading to an increasing demand for high-quality protein sources. Fishmeal, due to its high protein content, balanced essential amino acids and essential fatty acids, and excellent palatability, is considered the optimal protein source for aquaculture feeds. However, current fishmeal production cannot meet the needs of the aquaculture industry (FAO, 2022). With rising fishmeal prices and a high reliance on imports, reducing and replacing fishmeal usage is crucial in aquaculture due to trade barriers.
[0003] Existing technologies typically use a single protein source and / or soy protein to replace fish meal in feed. This not only has drawbacks such as an imbalance in essential amino acids, the presence of anti-nutritional factors, and poor palatability, but also limits its use in aquaculture feeds due to the fact that soybeans are also used for human food. Furthermore, soybean meal, the main plant-based alternative protein source, has an import dependency rate of up to 80%. Therefore, developing more novel protein sources is a key approach to addressing the shortage of high-quality protein sources and promoting the sustainable development of the aquaculture industry.
[0004] In view of this, the present invention is proposed. Summary of the Invention
[0005] The purpose of the present invention is to provide a composite protein source and its application to solve or improve the above technical problems.
[0006] This application can be implemented as follows:
[0007] In a first aspect, the present application provides a composite protein source comprising mealworm powder, chlorella powder, ethanolic clostridial protein and cottonseed protein concentrate in a mass ratio of 1:1:5:5-1:1:7:3.
[0008] In an optional embodiment, the complex protein source includes mealworm powder, chlorella powder, ethanolic clostridial protein and cottonseed protein concentrate in a mass ratio of 1:1:6:4.
[0009] In a second aspect, the present application provides a use of the composite protein source according to the aforementioned embodiment in fish feed.
[0010] In a third aspect, the present application provides a fish feed comprising fish meal and the composite protein source according to the aforementioned embodiment, wherein the amount of the fish meal and the composite protein source in the fish feed is 5-15 wt %.
[0011] In an alternative embodiment, the fish feed contains 5-15 wt% of a complex protein source and does not contain fish meal.
[0012] In an alternative embodiment, the fish feed contains rapeseed meal, soybean meal, corn starch, cellulose, fish oil, soybean oil, mineral premix, vitamin premix, sodium benzoate, sodium carboxymethyl cellulose, and choline chloride.
[0013] In an optional embodiment, the fish feed further contains, by mass percentage, 23-27% rapeseed meal, 24-28% soybean meal, 13-17% corn starch, 3.2-4.8% cellulose, 3-3.5% fish oil, 3-3.5% soybean oil, 3-7% mineral premix, 0.35-0.45% vitamin premix, 0.015-0.025% sodium benzoate, 2-4% sodium carboxymethyl cellulose and 0.1-0.12% choline chloride.
[0014] In an optional embodiment, the fish feed contains, by mass percentage, 1.2% of mealworm meal, 1.2% of chlorella powder, 7.2% of ethanolic clostridium protein, 4.8% of cottonseed protein concentrate, 25% of rapeseed meal, 26% of soybean meal, 15% of corn starch, 4.08% of cellulose, 3.5% of fish oil, 3.5% of soybean oil, 5% of mineral premix, 0.39% of vitamin premix, 0.02% of sodium benzoate, 3% of sodium carboxymethyl cellulose and 0.11% of choline chloride.
[0015] In an alternative embodiment, the fish feed is freshwater fish feed.
[0016] In an optional embodiment, the fish feed is allogynogenetic gibel carp feed.
[0017] In an optional embodiment, the crude protein content in the fish feed is 34-34.5 wt%, the crude fat content is 6.8-7.8 wt%, and the ash content is 8.4-8.8 wt%.
[0018] The beneficial effects of this application include:
[0019] The present application creatively adopts a compound of mealworm powder, chlorella powder, ethanol clostridial protein and cottonseed protein concentrate in a mass ratio of 1:1:5:5-1:1:7:3 to achieve complementary advantages and amino acid balance. It is used to partially or completely replace fish meal in fish feed, especially to completely replace fish meal in fish feed. It will not only not have an adverse effect on fish, but will help to improve the apparent digestibility of protein and the activity of protease in fish, and is beneficial to the digestion of protein by fish; moreover, this composite protein source can promote the absorption of protein by the fish intestine, increase the length of microvilli, improve intestinal tight junctions, and is beneficial to intestinal health; in addition, this composite protein source can also enhance the intestinal amino acid perception of fish, improve the antioxidant capacity of fish, etc. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.
[0021] Figure 1 (A) shows the results of intestinal trypsin and chymotrypsin activity in each group of the experimental example; (B) shows the results of relative mRNA expression of amino acid or peptide transporter-related genes; (C) shows the results of quantitative analysis of intestinal tissue structure;
[0022] Figure 2 (A) is the result of the relative expression of intestinal pro-inflammatory gene mRNA in each group of the experimental example; (B) is the result of the relative expression of anti-inflammatory gene mRNA; (C) is the result of HE staining of intestinal tissue structure;
[0023] Figure 3 (A) is the result of the relative expression of intestinal tight junction-related gene mRNA in the experimental example; (B) is a transmission electron microscopy image of the intestinal tissue structure;
[0024] Figure 4 The results of the relative expression of intestinal amino acid sensing receptor related gene mRNA in each group of the experimental example are shown in FIG.
[0025] Figure 5 The results of liver oxidative stress-related enzyme activities in each group of the experimental examples are shown in FIG.
[0026] Figure 6 The results of the amino acid metabolism-related enzyme activities in the liver of each group in the experimental example are shown in FIG.
[0027] Figure 7 This is the GO analysis result diagram comparing the B100 group and the control group in the experimental example;
[0028] Figure 8 This is the KEGG enrichment analysis result diagram comparing the B100 group and the control group in the experimental example. DETAILED DESCRIPTION
[0029] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are described clearly and completely below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are used. Where the manufacturer of the reagents or instruments is not specified, all are conventional products that can be purchased commercially.
[0030] The composite protein source provided in this application and its application are described in detail below.
[0031] The present application proposes a composite protein source, which includes mealworm powder, chlorella powder, ethanolic clostridial protein and cottonseed protein concentrate in a mass ratio of 1:1:5:5-1:1:7:3.
[0032] In this application, Clostridium autoethanogenum protein is a novel bacterial protein extracted and processed from mash produced during the ethanol production process using industrial waste gas CO2. Clostridium autoethanogenum protein has a crude protein content exceeding 85%, and its lysine, methionine, and threonine content are higher than those in fish meal. For example, Clostridium autoethanogenum protein can be purchased from Beijing Shougang Langze New Energy Technology Co., Ltd.
[0033] Cottonseed protein concentrate is a non-grain plant protein that uses low-temperature drying and solvent extraction technology to effectively reduce the thermal denaturation of the protein and more thoroughly remove the gossypol toxin. For example, cottonseed protein concentrate can be purchased from Xinjiang Jinlan Plant Protein Co., Ltd.
[0034] Mealworm powder is an insect protein processed from mealworms, which has the functions of waste conversion and energy conservation and emission reduction. For example, mealworm powder can be purchased from Guangdong Zehecheng Biotechnology Co., Ltd.
[0035] Chlorella powder is a single-cell plant protein made from Chlorella vulgaris, a microalgae with strong photosynthetic capacity, fast growth rate, and high nutritional value. For example, Chlorella powder can be purchased from Demot Biotechnology Co., Ltd.
[0036] The above-mentioned mealworm powder and chlorella powder are rich in trace elements (such as chlorella powder contains chlorella growth factor, and mealworm powder contains chitin), which are beneficial to fish feeding, growth and immunity.
[0037] The above four protein sources are not only rich in protein but also have a suitable amino acid composition. However, it should be noted that existing research shows that using large amounts of ethanolic Clostridium protein and cottonseed protein concentrate to replace fish meal in feed can have a negative impact on the growth and health of aquaculture animals, limiting their use as fish meal replacements.
[0038] The present application creatively adopts a compound of mealworm powder, chlorella powder, ethanol clostridial protein and cottonseed protein concentrate in a mass ratio of 1:1:5:5-1:1:7:3 to achieve complementary advantages and amino acid balance. Using them to partially or completely replace fish meal in fish feed will not only not have an adverse effect on fish, but will help improve the apparent protein digestibility and protease activity of fish, and facilitate the digestion of protein by fish; moreover, the composite protein source can promote the absorption of protein by the fish intestine, increase the length of microvilli, improve intestinal tight junctions, and benefit intestinal health; in addition, the composite protein source can also enhance the intestinal amino acid perception of fish and improve the antioxidant capacity of fish.
[0039] For reference, the mass ratio of mealworm powder, chlorella powder, ethanolic clostridium protein and cottonseed protein concentrate can be 1:1:5:5, 1:1:5.5:4.5, 1:1:6:4, 1:1:6.5:3.5 or 1:1:7:3, etc., or any other value within the range of 1:1:5:5-1:1:7:3.
[0040] In some typical embodiments, the composite protein source includes mealworm powder, chlorella powder, ethanolic clostridial protein, and cottonseed protein concentrate in a mass ratio of 1:1:6:4. This typical ratio can achieve better results than other ratios.
[0041] Accordingly, the present application also provides the use of the above-mentioned composite protein source in fish feed.
[0042] In some typical embodiments, the above-mentioned composite protein source is used in allogynogenetic gibel crucian carp feed, specifically, used to partially or completely replace fish meal in existing allogynogenetic gibel crucian carp feed.
[0043] In addition, the present application also provides a fish feed, which contains fish meal and the above-mentioned composite protein source, and the total amount of fish meal and composite protein source in the fish feed is 5-15wt%, such as 5wt%, 8wt%, 10wt%, 12wt% or 15wt%.
[0044] In some typical embodiments, the fish feed contains 5-15 wt% of the composite protein source and does not contain fish meal, that is, under this condition, the composite protein source completely replaces the fish meal in the existing allogynogenetic gibel crucian carp feed.
[0045] Furthermore, the fish feed also contains rapeseed meal, soybean meal, corn starch, cellulose, fish oil, soybean oil, mineral premix, vitamin premix, sodium benzoate, sodium carboxymethyl cellulose, and choline chloride. The rapeseed meal and soybean meal serve as protein sources, the fish oil and soybean oil serve as fat sources, and the mineral premix and microbial premix provide minerals and microorganisms, respectively.
[0046] For reference, the fish feed may contain, in percentage by mass, 23-27% (e.g., 23%, 24%, 25%, 26% or 27%) of rapeseed meal, 24-28% (e.g., 24%, 25%, 26%, 27% or 28%) of soybean meal, 13-17% (e.g., 13%, 14%, 15%, 16% or 17%) of corn starch, 3.2-4.8% (e.g., 3.2%, 3.5%, 3.8%, 4%, 4.2%, 4.5% or 4.8%) of cellulose, 3-3.5% (e.g., 3%, 3.1%, 3.2%, 3.3%, 3.4% or 3.5%) of fish oil, 3-3.5% (e.g., 3%, 3.6%, 3.8%, 4%, 4.2%, 4.5% or 4.8%) of 1%, 3.2%, 3.3%, 3.4% or 3.5% (such as 1%, 3.2%, 3.3%, 3.4% or 3.5%) soybean oil, 3-7% (such as 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5% or 7%) mineral premix, 0.35-0.45% (such as 0.35%, 0.4% or 0.45%) vitamin premix, 0.015-0.025% (such as 0.015%, 0.02% or 0.025%) sodium benzoate, 2-4% (such as 2%, 2.5%, 3%, 3.5% or 4%) sodium carboxymethyl cellulose and 0.1-0.12% (such as 0.1%, 0.11% or 0.12%) choline chloride.
[0047] In some typical embodiments, the fish feed contains, by mass percentage, 1.2% mealworm meal, 1.2% chlorella powder, 7.2% ethanolic clostridium protein, 4.8% cottonseed protein concentrate, 25% rapeseed meal, 26% soybean meal, 15% corn starch, 4.08% cellulose, 3.5% fish oil, 3.5% soybean oil, 5% mineral premix, 0.39% vitamin premix, 0.02% sodium benzoate, 3% sodium carboxymethyl cellulose, and 0.11% choline chloride.
[0048] Vitamin premix can be purchased from Guangzhou Nutriera Biotechnology Co., Ltd. Mineral premix can be prepared as follows: NaCl: 500.0 mg / kg diet; MgSO4·7H2O: 8155.6 mg / kg diet; NaH2PO4·2H2O: 12500.0 mg / kg diet; KH2PO4: 16000.0 mg / kg diet; CaHPO4·2H2O: 7650.6 mg / kg diet; FeSO4·7H2O: 2286.2 mg / kg diet; C6H 10 CaO6·5H2O: 1750.0mg / kg diet; ZnSO4·7H2O: 178.0mg / kg diet; MnSO4·H2O: 61.4mg / kg diet; CuSO4·5H2O: 15.5mg / kg diet; CoSO4·7H2O: 0.9mg / kg diet; KI: 1.5mg / kg diet; Na2SeO3: 0.6mg / kg diet; Corn starch: 899.7mg / kg diet.
[0049] In some embodiments, the crude protein content of the fish feed provided herein may be 34-34.5 wt %, the crude fat content may be 6.8-7.8 wt %, and the ash content may be 8.4-8.8 wt %.
[0050] In the present application, the above-mentioned fish feed is preferably freshwater fish feed. In some more typical embodiments, the above-mentioned fish feed is omnivorous freshwater fish feed. In some more typical embodiments, the above-mentioned fish feed is allogynogenetic silver crucian carp feed.
[0051] The features and performance of the present invention are further described in detail below with reference to the embodiments.
[0052] The sources of some raw materials in the following examples and comparative examples are as follows:
[0053] Ethanol Clostridium protein: purchased from Beijing Shougang Langze New Energy Technology Co., Ltd.
[0054] Cottonseed protein concentrate: purchased from Xinjiang Jinlan Plant Protein Co., Ltd.
[0055] Tenebrio molitor powder: purchased from Guangdong Zehecheng Biotechnology Co., Ltd.
[0056] Chlorella powder: purchased from Demot Biotechnology Co., Ltd.;
[0057] Vitamin premix: purchased from Guangzhou Nutriera Biotechnology Co., Ltd.
[0058] Mineral premix was prepared as follows: NaCl: 500.0 mg / kg diet; MgSO4·7H2O: 8155.6 mg / kg diet; NaH2PO4·2H2O: 12500.0 mg / kg diet; KH2PO4: 16000.0 mg / kg diet; CaHPO4·2H2O: 7650.6 mg / kg diet; FeSO4·7H2O: 2286.2 mg / kg diet; C6H 10 CaO6·5H2O: 1750.0mg / kg diet; ZnSO4·7H2O: 178.0mg / kg diet; MnSO4·H2O: 61.4mg / kg diet; CuSO4·5H2O: 15.5mg / kg diet; CoSO4·7H2O: 0.9mg / kg diet; KI: 1.5mg / kg diet; Na2SeO3: 0.6mg / kg diet; Corn starch: 899.7mg / kg diet.
[0059] The remaining raw materials were purchased directly.
[0060] Example 1
[0061] The present embodiment provides a feed for allogynogenetic crucian carp, which is expressed in percentage by mass and contains 1.2% of yellow mealworm powder, 1.2% of chlorella powder, 7.2% of ethanolic clostridium protein, 4.8% of cottonseed protein concentrate, 25% of rapeseed meal, 26% of soybean meal, 15% of corn starch, 4.08% of cellulose, 3.5% of fish oil, 3.5% of soybean oil, 5% of mineral premix, 0.39% of vitamin premix, 0.02% of sodium benzoate, 3% of sodium carboxymethyl cellulose and 0.11% of choline chloride.
[0062] The difference between Examples 2-3, the control group, and Comparative Examples 1-6 and Example 1 is that the feed composition is different, as shown in Table 1.
[0063] Among them, 1:1:8:2, 1:1:6:4 and 1:1:4:6 all represent the weight ratios of mealworm powder, chlorella powder, ethanolic clostridium protein and cottonseed protein concentrate.
[0064] A corresponds to corresponding examples 1-3, B corresponds to embodiments 1-3, and C corresponds to corresponding examples 4-6.
[0065] Among them, A33 is Comparative Example 1, specifically referring to a composite protein source replacing 33% of fish meal in feed; A67 is Comparative Example 2, specifically referring to a composite protein source replacing 67% of fish meal in feed; A100 is Comparative Example 3, specifically referring to a composite protein source replacing 100% of fish meal in feed. B33 is Example 1, B67 is Example 2, B100 is Example 3, C33 is Comparative Example 4, C67 is Comparative Example 5, and C100 is Comparative Example 6, and their specific meanings are the same as A33, A67, and A100.
[0066] The above 10 groups of feeds were experimental feeds with equal nitrogen and fat content.
[0067] Table 1 Feed composition and chemical composition (% dry matter)
[0068]
[0069]
[0070] Test example
[0071] The following experiments were performed on the above control group, comparative examples and embodiments.
[0072] Experimental fish: Juvenile silver carp, Zhongke No. 5, weighing 15 g each, were used. The fish were temporarily housed in the aquaculture system for one month before the experiment officially began.
[0073] Grouping and Rearing: The experiment was conducted in 10 large cages (2 m x 2 m x 1.8 m) at the Laohe Fishery in Dayuan Town, Shishou District, Jingzhou City. The water temperature was 31.6 ± 2.4°C, the dissolved oxygen level was >5 mg / L, and the ammonia nitrogen level was <0.4 mg / L. Natural light was used. The fish were fed three times daily (7:30 AM, 11:30 AM, and 5:30 PM) for an 8-week culture period.
[0074] Sampling: After the experiment, the total weight of each fish in each tank was weighed and recorded. Three whole fish samples were weighed and bagged. Three fish per tank were collected for body length and weight measurement. After dissection, the visceral mass and liver weights were measured. Blood was then drawn and centrifuged at 3000 rpm for 15 minutes. The supernatant plasma was collected and stored at -80°C. Liver and intestinal tissues were then collected and stored at -80°C. Intestinal tissue sections were fixed in fixative.
[0075] Digestibility Study: After the experimental breeding period, all fish were transferred to an indoor aquaculture system and fed a diet containing 0.1% yttrium trioxide. After the fish had stabilized for 7 days, feces were collected by siphoning during the peak defecation period of the day. Fresh, formed, and plump feces were collected and promptly stored at -20°C. The experiment was terminated when the fecal sample volume was sufficient for analysis and testing.
[0076] Biochemical Analysis: Proximate compositional analysis of feed and fish was performed according to the methods of the Association of Official Analytical Chemists (AOAC, 2003). Moisture content of samples was determined by oven drying at 105°C to a fixed weight. Ash content was determined by incineration in a muffle furnace at 550°C for 12 h. Crude protein content was measured using a Kjeltec 8400 Analyzer Unit (FOSS Tecator, Haganas, Sweden). Crude fat content was determined by ether extraction using a Soxtec system (Soxtec™ 2005, FOSS Tecator, Haganas, Sweden). Amino acid hydrolysis of feed and feces was performed according to the method described by Liu et al. (2016) and determined using an amino acid analyzer (A300, MembraPure GmbH, Germany). Yttrium oxide content in feces and feed was determined by Hubei Acrede Testing Co., Ltd. (Wuhan).
[0077] Hepatic malondialdehyde, reduced glutathione, catalase, superoxide dismutase, total antioxidant capacity, alanine aminotransferase, and aspartate aminotransferase were measured according to the instructions of commercially available assay kits (A003-1-2, A006-2-1, A007-1-1, A001-3-2, A015-2-1, C009-2-1, and C010-2-1; Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu). Enzyme-specific activity was expressed as units per milligram of soluble protein. Protein concentration of tissue homogenates was determined using a protein assay kit (A045-2, Nanjing Jiancheng Bioengineering Institute).
[0078] Plasma triglycerides, cholesterol, and glucose were measured using commercial kits (290-63701, 294-65801, 298-65701; Wako Pure Chemicals, Japan). Plasma free amino acids were measured using a commercial kit (A026-1-1; Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu).
[0079] Intestinal tissue sections: Intestinal tissue preserved in paraformaldehyde was dehydrated with graded ethanol, cleared with xylene, embedded in molten paraffin, and then cut into 4-6 μm sections using a microtome and baked in an oven at 60°C for 1 hour. Sections were stained with hematoxylin and eosin and observed under a light microscope. ImageJ software was used for quantitative analysis of intestinal villi.
[0080] Intestinal tissue was preserved in glutaraldehyde solution, rinsed three times with 0.1 mol / L phosphate buffer, and fixed with 1% osmium sulfate in 0.1 mol / L phosphate buffer. After dehydration, infiltration, and embedding, the samples were cut into 60-80 nm ultrathin sections using an ultramicrotome. Sections were double-stained with uranium-lead and observed using a transmission electron microscope. Intestinal microvilli were quantitatively analyzed using ImageJ software.
[0081] Real-time fluorescence quantitative PCR analysis: Total RNA was extracted from the intestinal tissue of the allogynogenetic crucian carp using TRIzol reagent. RNA integrity was detected by agarose gel electrophoresis. RNA concentration was determined using an ND-2000 UV-Vis spectrophotometer. Total RNA was then reverse transcribed using the M-MLV First-Strand Synthesis Kit (Invitrogen, Shanghai). qPCR primers were designed using NCBI primer BLAST, see Table 2. Real-time fluorescence quantitative PCR was performed on a LightCycle 480II system (Roche, Basel, Switzerland). The efficiency of real-time fluorescence quantitative PCR was calculated from the standard curve, and the primer amplification efficiency was verified to be approximately 100%. Relative expression was calculated according to Vandesompele et al. (2002). β-actin was used as the normalized internal reference, and the data of each treatment group were compared with those of the control group.
[0082] Liver transcriptome analysis: Filtering sequencing data using SOAPnuke:
[0083] (1) Removal of reads containing sequencing adapters;
[0084] (2) removing reads with a low-quality base ratio greater than 20%;
[0085] (3) Reads with a ratio of unknown bases ('N' bases) greater than 5% were removed to obtain clean reads, which were stored in FASTQ format. Clean reads were mapped to the reference genome using HISAT2. Clean reads were aligned with the reference coding gene set using Bowtie2, and then the expression levels of genes were calculated using RSEM. Basically, differential expression analysis was performed using DESeq2 with a Q value ≤ 0.05. In order to gain a deeper understanding of phenotypic changes, GO and KEGG enrichment analysis was performed on the annotated differently expressed genes using Phyper based on the Hypergeometric test. Bonferroni used a strict threshold (Q value ≤ 0.05) for the Q value correction term and the significance level of the pathway.
[0086] Digestive Enzyme Activity: Intestinal trypsin and chymotrypsin activities were measured using the method of Liu et al. (2017). Intestinal samples were mixed with 4x 0.65% saline and homogenized on ice. The homogenate was centrifuged at 12,000 g for 20 min at 4°C, and the supernatant was collected. Trypsin activity was measured using a specific substrate (Na-benzoyl-L-arginine 4-nitroanilide hydrochloride), and chymotrypsin activity was measured using a specific substrate (N-succinyl-ala-ala-pro-phepnitroanilide).
[0087] Calculation formula:
[0088] Specific growth rate (% / day) = 100 × (ln final weight - ln initial weight) / number of days;
[0089] Feed efficiency (%) = 100 × (weight gain + weight of dead fish) / dry weight of feed;
[0090] Protein efficiency = (final body weight - initial body weight) / protein intake;
[0091] Protein deposition rate (%) = 100 × protein deposition in the body / protein intake;
[0092] Feeding rate (% BW / d) = 100 × dry matter intake / (number of days × (final weight + initial weight) / 2);
[0093] Fatness (g / cm 3 ) = 100 × body weight / (body length) 3 ;
[0094] Viscera-to-body ratio (%) = 100 × (viscera weight / body weight);
[0095] Liver to body ratio (%) = 100 × (liver weight / body weight).
[0096] Data Analysis: Data are presented as mean ± standard error (mean ± SE). All data were analyzed using IBM SPSS statistical software. One-way analysis of variance (ANOVA) was performed after homogeneity of variance testing. Duncan's method was used to compare the significance of the above results, with a significance level of (P < 0.05).
[0097] The above results are shown in Tables 3 to 6 and Figures 1 to 8 shown.
[0098] Table 2 Primer sequences
[0099] Gene name GenBank accession no. Forward primer(5′to 3′) Reverse primer(5′to 3′) β-actin JN006052.1 TGGGACAGAAGGACAGCTATG AGCTCGTTGTAGAAGGTGTGA tnf-α XM_026282152.1 TGTTCTCAGGGCATTCGCTT GGAGTTGTAGTGCCCTTGGT il-1β XM_026220359.1 GAATGGAAACGACAGCCTCC GGATTCGTTCAGTTGGCCTC il-6α XM_026252884.1 GAGATACCGACCACAGCTCA TGCCCAACTGACTGCATAGA il-8 KC184490.1 CACAAGTGTCGAGCAACCAG TCAGTTTCAATGCAGCGACA il-10 HQ259106 TGAAAAGGAACGATGGGCAG TGGAATGATGACGTGCAAGC tgf-β EU086521.1 GGTTCTTGCGCTGTATAGGC CCGGCCCACATAGTAAAGGA zo-2 XM_026269460.1 ATGCGTCTGGGAATTACGGG CATTCCTGAGCCCTTTCCCT occludin-a HQ110086.1 GGACCAGATCAACAAGCGTC TTGATGTGGCTGAGTTTGGC claudin-b HQ656008.1 ACCGGACAGATGCAGTGTAA ATGATGCCCAGGATCCCAAT claudin-c HQ656009.1 AGAGTACTGGACAGACGCAG GATCATCACACGGGCTTTGG claudin-d HQ656010.1 ACTGCCACAAGATCTCCAGG GTCCCGTTCTTCAATGCAGT claudin-e HQ656011.1 AGAAAGCAAGGCAAAGGTGG TCCCTGACGATGGTGTTAGT claudin-h HQ656012.1 ACGGCACAAGTAATCTGGGA CCAAGATGACGGCAATGACC <![CDATA[y + lat2]]> XM_026266738.1 ATCATCACTGGCCTGGTCAA CTGTGACAATGGGCATGGAG snat2 XM_026209285.1 TCACGATCAACACCGAGTCA ACAGCCCAAATGTGCGAAAT pept1 XM_026265622.1 CCGTACTCATCCTCCCCATC TCTCGGTCTCTCCTTCCTCA casr AB713518.1 AACTCCTGGTCTAACGGCAA AACACCCAACACGAAAGCTG gprc6a XM_026283875.1 ACGCTGTGTGTTTCATGCAT GCAAACGATCACATACGGCT t1r3 XM_026275959.1 TTCTGAGCAGCTGGAGAACA CTCCACTGGACAACGCAAAA t1r1 XM_026268818.1 TGAATGGTCTGATGAGGGCA GTAAACACATGCTGCCACCA mglur4 EU147495.1 CCAGTATCAGCACGACCTCT AATCGGCGTGTCATTGTAGC
[0100] Table 3 Growth performance
[0101]
[0102] Table 4 Body shape indexes and whole fish components
[0103]
[0104] Table 5 Apparent digestibility (%)
[0105]
[0106]
[0107] Table 5 (Continued) Apparent digestibility (%)
[0108] feed B67 B100 C33 C67 C100 dry matter <![CDATA[55.10±0.72 bcd ]]> <![CDATA[58.88±0.75 e ]]> <![CDATA[58.80±0.78 e ]]> <![CDATA[55.87±0.58 cd ]]> <![CDATA[54.05±1.06 bc ]]> crude protein <![CDATA[79.38±0.53 d ]]> <![CDATA[82.25±0.37 e ]]> <![CDATA[79.45±0.32 d ]]> <![CDATA[78.4±0.02 cd ]]> <![CDATA[79.19±0.35 cd ]]> Total essential amino acids <![CDATA[86.79±0.12 cd ]]> <![CDATA[87.60±0.10 d ]]> <![CDATA[85.31±0.07 b ]]> <![CDATA[86.37±0.28 c ]]> <![CDATA[85.44±0.55 b ]]> Total non-essential amino acids <![CDATA[84.86±0.16 de ]]> <![CDATA[87.69±0.11 f ]]> <![CDATA[83.22±0.40 c ]]> <![CDATA[85.62±0.23 e ]]> <![CDATA[84.63±0.10 d ]]> essential amino acids Lysine <![CDATA[85.58±0.38 cd ]]> <![CDATA[86.70±0.28 d ]]> <![CDATA[84.39±0.37 abc ]]> <![CDATA[85.12±0.36 bc ]]> <![CDATA[83.96±0.28 ab ]]> Methionine <![CDATA[97.75±0.08 ab ]]> <![CDATA[98.24±0.10 b ]]> <![CDATA[97.54±0.57 ab ]]> <![CDATA[97.7±0.06 ab ]]> <![CDATA[97.79±0.08 ab ]]> Threonine <![CDATA[77.44±0.29 de ]]> <![CDATA[78.92±0.41 f ]]> <![CDATA[76.11±0.52 bcd ]]> <![CDATA[76.53±0.35 bcde ]]> <![CDATA[76.62±0.54 bcde ]]> Arginine <![CDATA[80.88±0.50 f ]]> <![CDATA[78.84±1.45 ef ]]> <![CDATA[76.26±1.29 de ]]> <![CDATA[79.05±0.80 ef ]]> <![CDATA[75.10±1.22 bcd ]]> Leucine <![CDATA[85.27±0.32 de ]]> <![CDATA[86.97±0.37 f ]]> <![CDATA[84.38±0.14 cd ]]> <![CDATA[85.26±0.26 de ]]> <![CDATA[84.52±0.22 de ]]> Isoleucine <![CDATA[84.66±0.65 bc ]]> <![CDATA[85.77±0.05 c ]]> <![CDATA[85.24±0.22 bc ]]> <![CDATA[84.46±0.19 b ]]> <![CDATA[85.62±0.23 c ]]> Valine <![CDATA[82.53±0.49 de ]]> <![CDATA[83.30±0.39 e ]]> <![CDATA[78.87±0.63 bc ]]> <![CDATA[82.02±0.31 de ]]> <![CDATA[82.31±0.28 de ]]> Phenylalanine <![CDATA[84.65±0.37 ef ]]> <![CDATA[87.65±0.35 f ]]> <![CDATA[81.17±1.36 bc ]]> <![CDATA[84.34±0.91 cd ]]> <![CDATA[83.51±1.18 cd ]]> Histidine <![CDATA[87.72±0.84 b ]]> <![CDATA[88.18±0.82 b ]]> <![CDATA[89.20±1.29 b ]]> <![CDATA[87.60±0.52 b ]]> <![CDATA[88.24±0.16 b ]]> Nonessential amino acids Aspartic acid <![CDATA[84.37±0.33 cd ]]> <![CDATA[87.38±0.45 e ]]> <![CDATA[83.78±0.47 c ]]> <![CDATA[84.33±0.30 cd ]]> <![CDATA[85.03±0.22 d ]]> Serine <![CDATA[82.68±0.38 b ]]> <![CDATA[84.33±0.31 c ]]> <![CDATA[83.22±0.55 bc ]]> <![CDATA[82.58±0.35 b ]]> <![CDATA[83.76±0.40 bc ]]> glutamate <![CDATA[89.52±0.42 c ]]> <![CDATA[91.45±0.42 d ]]> <![CDATA[88.67±0.68 bc ]]> <![CDATA[89.88±0.64 c ]]> <![CDATA[89.33±0.64 c <!-- 9 -->]]> Glycine <![CDATA[79.08±0.39 d ]]> <![CDATA[84.62±0.45 e ]]> <![CDATA[76.64±0.75 c ]]> <![CDATA[80.83±0.48 d ]]> <![CDATA[79.02±0.45 d ]]> Alanine <![CDATA[81.73±1.03 b ]]> <![CDATA[85.84±0.72 c ]]> <![CDATA[81.97±1.75 b ]]> <![CDATA[82.56±0.50 bc ]]> <![CDATA[82.93±1.97 bc ]]> Tyrosine <![CDATA[86.51±0.74 d ]]> <![CDATA[86.83±0.19 d ]]> <![CDATA[84.10±0.25 bc ]]> <![CDATA[85.69±0.64 cd ]]> <![CDATA[85.51±0.29 bcd ]]> Proline <![CDATA[82.35±0.76 d ]]> <![CDATA[88.02±0.62 e ]]> <![CDATA[79.00±0.75 bc ]]> <![CDATA[82.26±0.95 d ]]> <![CDATA[80.24±0.35 bcd ]]> Cysteine <![CDATA[81.62±1.16 cd ]]> <![CDATA[82.73±0.79 de ]]> <![CDATA[74.79±1.13 a ]]> <![CDATA[86.23±0.47 f ]]> <![CDATA[79.86±0.23 bc ]]>
[0109] Table 6 Plasma biochemistry
[0110]
[0111]
[0112] The above results show that:
[0113] ① As shown in Table 3, there was no significant difference in feeding rate among the different treatments (P>0.05). As shown in Table 4, there was no significant difference in body shape and whole fish components among the different treatments (P>0.05).
[0114] However, compared with the control group, fish growth and feed utilization were lower in the A100 group (P<0.05), while specific growth rate was higher in the B100 group (P<0.05). Groups A33 and B100 had higher feed efficiency and protein efficiency (P<0.05), while those in the A100 group were lower (P<0.05). Protein deposition was higher in the B100 group (P<0.05), while that in the A100 group was lower (P<0.05).
[0115] Replacing 33% of fish meal with mealworm meal, chlorella meal, ethanolic clostridial protein, and cottonseed protein concentrate at a ratio of 1:1:8:2 in the feed was beneficial to the feed utilization of allogynogenetic crucian carp, but replacing 100% of fish meal was detrimental to the growth and feed utilization of allogynogenetic crucian carp. Replacing 100% of fish meal with mealworm meal, chlorella meal, ethanolic clostridial protein, and cottonseed protein concentrate at a ratio of 1:1:6:4 in the feed was beneficial to the growth and feed utilization of allogynogenetic crucian carp.
[0116] ② As shown in Table 5, compared with the control group, the apparent digestibility of crude protein and total non-essential amino acids in the A100 group, as well as the total essential amino acids in the A67 and A100 groups, was significantly lower (P < 0.05). The apparent digestibility of crude protein, total essential amino acids, and total non-essential amino acids in the A33 and B100 groups was significantly higher than that in the control group (P < 0.05). The apparent digestibility of essential amino acids (leucine, valine, threonine, arginine) and non-essential amino acids (aspartic acid, glutamic acid, glycine, alanine, tyrosine, proline, and cysteine) was significantly lower in the A100 group (P < 0.05), but the apparent digestibility of essential amino acids (lysine, methionine, threonine, leucine, isoleucine, valine, phenylalanine, and histidine) and all non-essential amino acids in the B100 group was significantly higher than that in the control group (P < 0.05).
[0117] It can be seen that replacing fish meal with mealworm powder, chlorella powder, ethanol clostridium protein and cottonseed protein concentrate in the ratio of 1:1:6:4 in the feed can increase the apparent digestibility of protein in the allogynogenetic crucian carp, while replacing 67% and 100% of fish meal with a ratio of 1:1:8:2 can reduce the apparent digestibility of protein in the allogynogenetic crucian carp.
[0118] ③. Combination Figure 1 , Figure 1 Middle (A) shows that the feed formulas had different effects on intestinal trypsin and chymotrypsin activities. Compared with the control group, intestinal trypsin activity was significantly increased in the A67, B67, and B100 groups, and intestinal chymotrypsin activity was significantly increased in the A67 and B67 groups (P < 0.05). In addition, intestinal trypsin activity was significantly decreased in the C67 group compared with the control group (P < 0.05).
[0119] That is, replacing 67% and 100% of fish meal in the feed with mealworm powder, chlorella powder, ethanol clostridium protein and cottonseed protein concentrate in the ratio of 1:1:6:4, and replacing 67% of fish meal in the ratio of 1:1:8:2 is beneficial to the digestion of protein by albiculture crucian carp.
[0120] Figure 1 Middle (B) shows that the expression of amino acid or peptide transporter-related genes in the intestine of allogynogenetic crucian carp showed an up-regulation trend after the addition of mealworm powder, chlorella powder, ethanolic clostridium protein and cottonseed protein concentrate to the feed. + The mRNA expression levels of snat2 in groups A33, B, and C, and pept1 in groups A33, A67, B, and C33 were significantly upregulated (P<0.05). This suggests that replacing fish meal in the diet with a mixture of mealworm powder, chlorella powder, ethanolic clostridial protein, and cottonseed protein concentrate can improve protein absorption in the intestine of allogynogenetic crucian carp.
[0121] Figure 1 Middle (C) shows that replacing fish meal with a combination of mealworm meal, Chlorella meal, Clostridium ethanolate protein, and cottonseed protein concentrate in the diet affected the intestinal tissue structure of algyr crucian carp. For example, the villus height and the ratio of villus height to crypt depth in the A100 group were significantly lower than those in the control group (P < 0.05). The crypt depth in the B100 group was significantly lower than that in the control group, while the microvilli length and the ratio of villus height to crypt depth were significantly higher than those in the control group (P < 0.05). The different diets had no significant effect on the muscularis thickness of the intestinal tissue structure of algyr crucian carp (P > 0.05). This suggests that 100% replacement of fish meal with a combination of mealworm meal, Chlorella meal, Clostridium ethanolate protein, and cottonseed protein concentrate in the diet at a ratio of 1:1:8:2 reduces the intestinal tissue surface area exposed to nutrients, hindering protein absorption. Replacing 100% fish meal with a mixture of mealworm powder, chlorella powder, ethanol clostridium protein and cottonseed protein concentrate in a ratio of 1:1:6:4 in the feed is beneficial to the absorption of protein by albiculture crucian carp.
[0122] ④. Combination Figure 2 It can be seen that different diets have different effects on the mRNA expression of pro-inflammatory and anti-inflammatory genes in the intestine of allogynogenetic gibel carp. Compared with the control group, the mRNA expression of multiple pro-inflammatory genes was significantly upregulated in the other groups (P < 0.05), including TNF-α and IL-6α in groups A100, B100, and C, IL-1β in group C, and IL-8 in groups A, B100, and C. Compared with the control group, the mRNA expression of the anti-inflammatory gene IL-10 was significantly upregulated in group B100 and tgf-β in groups B67 and C100 (P < 0.05), but IL-10 mRNA expression was significantly downregulated in group A100 (P < 0.05). In addition, HE staining images of the intestinal tract of allogynogenetic gibel carp showed that a large number of lymphocytes infiltrated the epithelial cells in the intestinal tissue structure of the A100 group. This indicates that replacing 100% fish meal with a mixture of mealworm meal, chlorella meal, ethanolic clostridial protein and cottonseed protein concentrate in the diet at a ratio of 1:1:8:2 can cause intestinal inflammation in allogynogenetic crucian carp.
[0123] ⑤. Combination Figure 3It can be seen that the replacement of fish meal with a combination of mealworm meal, chlorella meal, ethanolic clostridial protein, and cottonseed protein concentrate in the diet increased the mRNA expression of tight junction-related genes in the intestine of allogynogenetic gibel carp. In group A, compared with the control group, the mRNA expression of zo-2 in groups A33 and A67 and claudin-c in group A33 were significantly increased (P < 0.05). In group B, the mRNA expression of claudin-b, claudin-d, and claudin-e in group B33, zo-2, claudin-b, claudin-d, claudin-e, and claudin-h in group B67, and zo-2, claudin-a, claudin-b, claudin-c, claudin-e, and claudin-hmRNA in group B100 were significantly increased compared with the control group (P < 0.05). In the C group, the mRNA expression levels of zo-2, claudin-c, claudin-d, claudin-e, and claudin-h in the C33 group, zo-2, claudin-d, and claudin-h in the C67 group, and zo-2, claudin-b, claudin-c, claudin-d, claudin-e, and claudin-h in the C100 group were significantly upregulated compared with those in the control group (P<0.05). In addition, we found through intestinal electron microscopy images that the intestinal tight junctions of the control group were hollow and severely curved, while this phenomenon did not occur in the A100, B100, and C100 groups. This shows that adding the four protein sources provided in this application to the feed instead of fish meal can improve the intestinal tight junctions of allogynogenetic crucian carp and is beneficial to intestinal health.
[0124] ⑥. Combination Figure 4 It can be seen that when mealworm powder, chlorella powder, ethanolic clostridium protein and cottonseed protein concentrate were added to the feed, the mRNA expression of intestinal amino acid sensory receptor-related genes of the allogynogenetic crucian carp tended to be upregulated. Compared with the control group, the mRNA expression of some genes in other groups was significantly upregulated (P<0.05), including casr, gprc6a, t1r3 and mglur4 in groups B and C, t1r1 in groups A33, B67, B100 and C100, and t1r3 and mglur4 in groups A33 and A100. This shows that adding the four protein source mixed feeds provided in this application to replace fish meal in the feed can enhance the perception of amino acids in the intestine of the allogynogenetic crucian carp.
[0125] ⑥. Combined with Table 6, it can be seen that the different feeds had no significant effect on the plasma triglyceride content (P>0.05). Compared with the control group, the plasma glucose content of the C33 group was significantly increased, and the plasma cholesterol content of the A100 group was significantly decreased (P<0.05). The plasma glucose content of the A67 group was significantly higher than that of the B33, C33, C67, and C100 groups (P<0.05). The plasma free amino acid content of the A100 group was significantly decreased, and the plasma free amino acid content of the B67 group was significantly increased (P<0.05). Replacing fish meal with 100% of the mixture of mealworm powder, chlorella powder, ethanolic clostridial protein, and cottonseed protein concentrate in the feed at a ratio of 1:1:8:2 will reduce the plasma free amino acid content, which is not conducive to the growth of allogynogenetic crucian carp.
[0126] Combine Figure 5 Results showed that malondialdehyde levels in the livers of groups A67, A100, and C100 were significantly higher than those in the control group (P < 0.05). Compared with the control group, reduced glutathione, catalase, and superoxide dismutase levels in the livers of group B67 were significantly increased (P < 0.05). Compared with the control group, the total antioxidant capacity of the livers of group B was significantly increased (P < 0.05). Replacing 67% and 100% of fish meal in the diet with a mixture of mealworm meal, chlorella meal, ethanolic Clostridium protein, and cottonseed protein concentrate at a ratio of 1:1:8:2 and 1:1:4:6, respectively, caused oxidative stress in the livers of allogynogenetic carp, whereas replacing fish meal with a mixture of mealworm meal at a ratio of 1:1:6:4 improved the antioxidant capacity of the livers of allogynogenetic carp.
[0127] ⑦. Combination Figure 6 It can be seen that compared with the control group, the liver alanine aminotransferase content of group C and the aspartate aminotransferase content of group C100 were significantly increased (P<0.05). This suggests that the replacement of fish meal in the diet with a mixture of mealworm meal, chlorella meal, ethanolic clostridial protein, and cottonseed protein concentrate in a ratio of 1:1:4:6 may result in a higher content of amino acids as an energy source.
[0128] ⑧. Combination Figures 7 and 8 It can be seen that compared with the control group, the main enriched pathways in the B100 group were organic acid metabolism, pancreatic secretion, and protein digestion and absorption. In addition, the expression of multiple digestive enzyme genes involved in the protein digestion and absorption pathway was enhanced in the B100 group, including serine protease, chymotrypsin, cellulase, carboxypeptidase A, and carboxypeptidase B. This suggests that replacing 100% fish meal with a 1:1:6:4 ratio of mealworm meal, chlorella meal, ethanolic Clostridium protein, and cottonseed protein concentrate in the diet is beneficial for protein digestion and absorption in allogynogenetic crucian carp, consistent with the results found in intestinal tissue.
[0129] In summary, the present application provides a method for replacing fish meal by mixing mealworm powder, chlorella powder, ethanolic clostridial protein and cottonseed protein concentrate in a specific ratio, which will affect the intestinal and liver health and protein utilization of the allogynogenetic silver crucian carp, thereby affecting the growth of the allogynogenetic silver crucian carp. Adding an appropriate proportion of mealworm powder, chlorella powder, ethanolic clostridial protein and cottonseed protein concentrate to the feed can increase the activity of intestinal proteases, increase the expression of intestinal amino acid or peptide transporters, amino acid sensing receptors, pro-inflammatory cytokines, and anti-inflammatory cytokine mRNA, improve intestinal tissue morphology, thereby promoting health, improving protein digestibility, and ultimately promoting the growth of the allogynogenetic silver crucian carp.
[0130] The above are merely preferred embodiments of the present invention and are not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.
Claims
1. Application of a composite protein source in preparing fish feed, characterized in that: The composite protein source comprises mealworm powder, chlorella powder, ethanol clostridium protein and cottonseed protein concentrate in a mass ratio of 1:1:6:
4.
2. A fish feed, characterized in that: The fish feed contains 5-15 wt% of a composite protein source and does not contain fish meal; The composite protein source comprises mealworm powder, chlorella powder, ethanol clostridium protein and cottonseed protein concentrate in a mass ratio of 1:1:6:
4.
3. The fish feed according to claim 2, characterized in that The fish feed contains rapeseed meal, soybean meal, corn starch, cellulose, fish oil, soybean oil, mineral premix, vitamin premix, sodium benzoate, sodium carboxymethyl cellulose and choline chloride.
4. The fish feed according to claim 3, characterized in that Calculated by mass percentage, the fish feed contains 23-27% of rapeseed meal, 24-28% of soybean meal, 13-17% of corn starch, 3.2-4.8% of cellulose, 3-3.5% of fish oil, 3-3.5% of soybean oil, 3-7% of mineral premix, 0.35-0.45% of vitamin premix, 0.015-0.025% of sodium benzoate, 2-4% of sodium carboxymethyl cellulose, and 0.1-0.12% of choline chloride.
5. The fish feed according to claim 4, characterized in that Calculated by mass percentage, the fish feed contains 1.2% of yellow mealworm powder, 1.2% of chlorella powder, 7.2% of ethanolic clostridium protein, 4.8% of cottonseed protein concentrate, 25% of rapeseed meal, 26% of soybean meal, 15% of corn starch, 4.08% of cellulose, 3.5% of fish oil, 3.5% of soybean oil, 5% of mineral premix, 0.39% of vitamin premix, 0.02% of sodium benzoate, 3% of sodium carboxymethyl cellulose, and 0.11% of choline chloride.
6. The fish feed according to claim 4, characterized in that The fish feed is freshwater fish feed.
7. The fish feed according to claim 6, characterized in that The fish feed is allogynogenetic silver crucian carp feed.
8. The fish feed according to any one of claims 2 to 6, characterized in that: The fish feed has a crude protein content of 34-34.5 wt%, a crude fat content of 6.8-7.8 wt%, and an ash content of 8.4-8.8 wt%.