Nested PCR primer set, kit and detection method for specific detection of phytoplasma of Hainan betel nut yellow disease

Abstract

The present invention relates to the field of biotechnology, and in particular to a nested PCR primer set, a kit and a detection method for specifically detecting Hainan betel nut yellowing phytoplasma. The nested PCR primer set of the present invention consists of a first round amplification upstream primer, a first round amplification downstream primer, a nested amplification upstream primer and a nested amplification downstream primer. The primer set is used to detect betel nut yellowing phytoplasma by a nested PCR molecular detection method, which has strong specificity, high sensitivity, easy operation and reliable results.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a nested PCR primer set, a kit and a detection method for specifically detecting Hainan betel nut yellowing phytoplasma. Background Art

[0002] Betel nut ( Areca catechu L .) is native to Malaysia and widely distributed in South Asia and Southeast Asia. In my country, betel nut is mainly grown in Hainan and Taiwan. Betel nut ranks first among the "Four Major Southern Medicines" (betel nut, oxyphylla, amomum, and Morinda officinalis), and has high food and medicinal value. Betel nut also has certain ornamental value, and its peel is also an important raw material for the textile industry. Betel nut likes to grow in high temperature, humidity, humus-rich, and well-drained deep sandy loam. It is planted on a large scale in Hainan, and the planting area and total output account for more than 95% of the country. As of the end of 2020, the planting area in Hainan Province exceeded 110,000 hm 2 , with an output value of 54.3 billion yuan. It has now become the largest pillar industry in Hainan Province and an important source of economic income for 41.37% of the agricultural population in Hainan Province.

[0003] Areca nut yellowing disease is a fatal disease that seriously threatens the production of areca nuts. The disease was first discovered in central Kerala, India in 1914, and was first discovered in Tunchang County, Hainan Province in 1981. At present, the disease has been found in 18 cities and counties in Hainan Province, and has become a devastating disease that harms areca nuts, posing a serious threat to Hainan's betel nut industry and the increase in income of farmers.

[0004] The pathogen of betel nut yellowing disease is betel nut yellowing phytoplasma. Studies have found that there are three groups or subgroups of phytoplasmas in Indian betel nut yellowing phytoplasma, namely 16SrXI-B subgroup, 16SrI-B group and 16SrXIV group. In China, previous studies have shown that the pathogen of Hainan betel nut yellowing disease is 16SrI group. Recently, we have also found a new group of phytoplasmas in Hainan betel nut yellowing disease samples - 16SrII group yellowing phytoplasma. Phytoplasma is a prokaryotic microorganism that parasitizes the phloem of plants and is difficult to culture artificially. Studies have found that betel nut yellowing phytoplasma is unevenly distributed in the host plant and the content is very low, which makes it difficult to detect. At present, predecessors have established nested PCR, Real-time PCR and LAMP detection methods for betel nut yellowing phytoplasma. However, only nested PCR products can be sequenced for further division of phytoplasma groups and subgroups. When using universal phytoplasma primers to detect betel nut yellowing disease samples, non-specific bands are often amplified, and sequencing and comparison show that the amplified bands are false positive sequences of non-phytoplasmas such as betel nut chloroplasts or other bacteria. In short, a specific detection and identification method for Hainan betel nut yellowing phytoplasma is urgently needed.

[0005] In view of this, the present invention is proposed. Summary of the invention

[0006] In order to achieve the object of the present invention, the technical solution of the present invention is as follows:

[0007] The invention provides a nested PCR primer set for specifically detecting Hainan betel nut yellowing phytoplasma, which consists of a first-round amplification upstream primer, a first-round amplification downstream primer, a nested amplification upstream primer and a nested amplification downstream primer; the nucleotide sequence of the first-round amplification upstream primer is shown in SEQ ID NO: 1, the nucleotide sequence of the first-round amplification downstream primer is shown in SEQ ID NO: 2, the nucleotide sequence of the nested amplification upstream primer is shown in SEQ ID NO: 3, and the nucleotide sequence of the nested amplification downstream primer is shown in SEQ ID NO: 4.

[0008] The invention provides a kit for specifically detecting Hainan betel nut yellowing phytoplasma, comprising the nested PCR primer set.

[0009] Preferably, the kit also includes PCR reaction reagents.

[0010] The present invention provides the nested PCR primer set or the application of the kit in detecting Hainan betel nut yellowing phytoplasma.

[0011] The present invention also provides a method for detecting Hainan betel nut yellowing phytoplasma, comprising the following steps:

[0012] S1, extracting DNA of the sample to be tested;

[0013] S2, using the sample DNA to be tested as a template, and performing PCR amplification using the nested PCR primer set;

[0014] S3. Observe the PCR amplification results under a gel imaging system. If the size of the band is consistent with the target band, it means that the sample to be tested contains the Hainan Areca Yellows Phytoplasma; otherwise, it means that the sample to be tested does not contain the Hainan Areca Yellows Phytoplasma.

[0015] Preferably, the sample to be tested in step S1 is derived from tissue of a plant infected with betel nut yellowing disease.

[0016] Preferably, the PCR amplification method in step S2 is: firstly perform a first round of PCR amplification, then dilute the first round of PCR amplification products by 20 times, and then use the diluted liquid material as a sample to be tested for nested amplification to perform nested amplification.

[0017] Further preferably, the reaction system of the first round of PCR amplification is 25 μL, including 8.5 μL of ddH2O; 12.5 μL of 2×Taq PCR Master Mix; 1 μL each of 10 μM first-round amplification upstream primer and first-round amplification downstream primer; and 2 μL of 20-100 ng / μL test sample DNA template.

[0018] Further preferably, the nested amplification reaction system, in 25 μL, includes 8.5 μL of ddH2O; 12.5 μL of 2×TaqPCR Master Mix; 1 μL each of 10 μM nested amplification upstream primer and nested amplification downstream primer; and 2 μL of the sample to be tested.

[0019] Further preferably, the reaction procedure for the first round of amplification is: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 42.5°C for 30 s, extension at 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for another 5 min.

[0020] Further preferably, the reaction procedure of nested amplification is: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 47°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles; and extension at 72°C for another 5 min.

[0021] Preferably, the DNA size of the target band in step S3 is 429 bp.

[0022] Beneficial effects:

[0023] The present invention provides a nested PCR primer set, a kit and a detection method for specifically detecting the yellowing phytoplasma of betel nut in Hainan. The nested PCR primer set for specifically detecting the yellowing phytoplasma of betel nut in Hainan consists of a first-round amplification upstream primer, a first-round amplification downstream primer, a nested amplification upstream primer and a nested amplification downstream primer; the nucleotide sequence of the first-round amplification upstream primer is shown in SEQ ID NO: 1, the nucleotide sequence of the first-round amplification downstream primer is shown in SEQ ID NO: 2, the nucleotide sequence of the nested amplification upstream primer is shown in SEQ ID NO: 3, and the nucleotide sequence of the nested amplification downstream primer is shown in SEQ ID NO: 4. The primer set is used to detect the yellowing phytoplasma of betel nut by a nested PCR molecular detection method, which has strong specificity, high sensitivity, easy operation and reliable results. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be described below.

[0025] Figure 1The specific detection results of the Hainan Areca Yellows Phytoplasma primer set provided by the present invention. Among them, lane 1: DL2000 standard molecular weight; lane 2: ddH2O; lane 3: ddH2O; lane 4: Catharanthus roseus positive control; lane 5: healthy Areca plants; lane 6: Areca bacterial leaf spot pathogen; lane 7: Pantoea ananas; lane 8: Areca cryptovirus 1; lane 9: Areca yellows diseased plants infected with 16SrI group phytoplasmas; lane 10: Areca yellows diseased plants infected with 16SrII group phytoplasmas; lane 11: 16SrV group phytoplasmas; lane 12: 16SrXXXII group phytoplasmas.

[0026] Figure 2 The primer pair provided by the present invention is used to detect the sensitivity of the 16SrI group phytoplasma of Hainan betel nut yellowing disease. Lane 1: DL2000 standard molecular weight; Lane 2: ddH2O; Lane 3: ddH2O; Lane 4: 7.5ng / μL; Lane 5: 750pg / μL; Lane 6: 75pg / μL; Lane 7: 7.5pg / μL; Lane 8: 750fg / μL; Lane 9: 75fg / μL; Lane 10: 7.5fg / μL; Lane 11: 750ag / μL; Lane 12: 75ag / μL; Lane 13: 7.5ag / μL; Lane 14: 750zg / μL; Lane 15: 75zg / μL; Lane 16: 7.5zg / μL.

[0027] Figure 3 The primer pair provided by the present invention is used to detect the sensitivity of the 16SrII group phytoplasma of Hainan betel nut yellowing disease. Lane 1: DL2000 standard molecular weight; Lane 2: ddH2O; Lane 3: 4.8ng / μL; Lane 4: 480pg / μL; Lane 5: 48pg / μL; Lane 6: 4.8pg / μL; Lane 7: 480fg / μL; Lane 8: 48fg / μL; Lane 9: 4.8fg / μL; Lane 10: 480ag / μL; Lane 11: 48ag / μL; Lane 12: 4.8ag / μL; Lane 13: 480zg / μL.

[0028] Figure 4 The results of nested detection of the Hainan Areca catechu yellowing phytoplasma specific primers on the DNA of the field Areca catechu plants. Lane 1: DL2000 standard molecular weight; Lane 2: ddH2O; Lane 3: ddH2O; Lane 4: DNA of healthy Areca catechu plants; Lane 5: phytoplasma plasmid; Lanes 6-24: DNA of field Areca catechu plants; Lanes 25-26: DL2000 standard molecular weight; Lanes 27-37: DNA of field Areca catechu plants.

[0029] Figure 5The results of nested detection of DNA from field betel nut plants using universal phytoplasma primers (P1 / P7 and R16mF2 / R16mR1). Lane 1: DL2000 standard molecular weight; Lane 2: ddH2O; Lane 3: ddH2O; Lane 4: DNA from healthy betel nut plants; Lane 5: phytoplasma plasmid; Lanes 6-25: DNA from field betel nut plants; Lane 26: DL2000 standard molecular weight; Lanes 27-36: DNA from field betel nut plants. DETAILED DESCRIPTION

[0030] The purpose of the present invention is to overcome the technical defects of the existing universal phytoplasma primers in detecting the Hainan betel nut yellowing phytoplasma, such as a large number of non-specific bands and a large number of false positive sequences. In order to quickly and accurately detect and identify the betel nut yellowing disease, the present invention provides a set of efficient Hainan betel nut yellowing phytoplasma molecular detection primers and a nested PCR molecular detection method for Hainan betel nut yellowing phytoplasma with strong specificity, high sensitivity, easy operation and reliable results.

[0031] The first aspect of the present invention is a nested PCR primer set for specifically detecting Hainan betel nut yellowing phytoplasma, which is designed by comparing the 16S rDNA of betel nut yellowing phytoplasma at home and abroad with non-specific and false positive sequences such as betel nut chloroplast 16S rDNA. The nested primer set consists of an upstream primer for the first round of amplification (the sequence is shown in SEQ ID NO: 1), a downstream primer for the first round of amplification (the sequence is shown in SEQ ID NO: 2), a nested amplification upstream primer (the sequence is shown in SEQ ID NO: 3), and a nested amplification downstream primer (the sequence is shown in SEQ ID NO: 4).

[0032] Specifically, the sequences of the primer pairs are as follows:

[0033] First round amplification upstream primer:

[0034] TTCTTGTTTTTAAAAGACCT (SEQ ID NO: 1);

[0035] First round amplification downstream primers:

[0036] AAACTTGCGCTTCAGCT (SEQ ID NO: 2);

[0037] Nested amplification upstream primer:

[0038] TGTGGTSTAAKKGCAAY (SEQ ID NO: 3);

[0039] Nested amplification downstream primers:

[0040] CTGATAACCTCCACKRTRTT (SEQ ID NO: 4).

[0041] The second aspect of the present invention is to provide a kit for rapid and efficient detection of Hainan Areca yellowing phytoplasma, which comprises the nested PCR primer set described in the first aspect of the present invention. That is, the kit of the second aspect of the present invention comprises a nested PCR primer set having nucleotides shown in SEQ ID NO: 1 and SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. The kit also includes a PCR reaction reagent.

[0042] The third aspect of the present invention is to provide the use of the primer pair described in the first aspect or the kit described in the second aspect of the present invention in the efficient detection of Hainan betel nut yellowing phytoplasma.

[0043] The fourth aspect of the present invention is to provide a method for efficiently detecting Hainan betel nut yellowing phytoplasma, which method includes the step of performing nested PCR amplification using the nested PCR primer set described in the first aspect of the present invention or the primer pair in the kit described in the second aspect of the present invention.

[0044] Furthermore, the method comprises the following steps:

[0045] Step 1, total DNA extraction from samples;

[0046] Step 2, performing nested PCR amplification using the nested PCR primer set described in the first aspect or the primer pair in the kit described in the second aspect of the present invention to obtain an amplified product;

[0047] Step 3, observe the results of electrophoresis of the amplified products and make a judgment.

[0048] In the present invention, the method for extracting total genomic DNA of the sample to be tested is not particularly limited, and any known genomic DNA extraction method or kit may be used.

[0049] In the present invention, the conditions for performing nested PCR amplification on the genomic DNA of the sample to be tested are not particularly limited.

[0050] According to some specific examples of the present invention, the reaction system of the nested PCR amplification is: ddH2O 8.5μL; 2×Taq PCR Master Mix 12.5μL; 10μM upstream and downstream primers 1μL each; 2μL of 20-100ng / μL DNA template of the sample to be tested. The reaction conditions of the first round of PCR amplification are: 94℃ pre-denaturation for 3min, 94℃ denaturation for 30s, 42.5℃ annealing for 30s, 72℃ extension for 1min, a total of 35 cycles, and 72℃ extension for 5min. The nested amplification conditions are 94℃ pre-denaturation for 3min, 94℃ denaturation for 30s, 47℃ annealing for 30s, 72℃ extension for 30s, a total of 35 cycles, and 72℃ extension for 5min. As a result, amplification can be achieved quickly, efficiently and accurately, which is convenient for the subsequent steps.

[0051] In the present invention, the method for detecting the nested PCR amplification product is not particularly limited, as long as the approximate number of base pairs of the PCR amplification product can be effectively obtained. According to some specific examples of the present invention, the approximate number of base pairs is obtained by gel electrophoresis. Thus, the detection result can be obtained with high throughput, high efficiency and accuracy.

[0052] In the present invention, if a specific band of about 429 bp is detected in step 3, it is determined that Hainan Areca catechu yellowing phytoplasma is detected.

[0053] The primer set of the present invention utilizes the universal phytoplasma primers P1 / P7 and R16mF2 / R16mR1 to perform nested amplification of betel nut yellowing disease plants, clones and sequences the obtained bands, obtains phytoplasma sequences and homologous sequences of non-phytoplasmas in betel nut plants, such as betel nut chloroplast 16S rDNA, and then compares and analyzes the two types of sequences to obtain the difference site region between the Hainan betel nut yellowing phytoplasma sequence and the non-phytoplasma sequence in the betel nut plant, and finally designs the result according to the difference site region.

[0054] P1: AAGAATTTGATCCTGGCTCAGGATT (SEQ ID NO: 5);

[0055] P7: CGTCCTTCATCGGCTCTT (SEQ ID NO: 6).

[0056] R16mF2: CATGCAAGTCGAACGGA (SEQ ID NO: 7);

[0057] R16mR1: CTTAACCCCAATCATCGA (SEQ ID NO: 8).

[0058] The primer pair of the present invention can accurately detect the Hainan betel nut yellowing phytoplasma when the concentration of the 16SrI group phytoplasma reaches 750ag / μL or the concentration of the 16SrII group phytoplasma reaches 4pg / μL in the sample to be tested, and has high sensitivity and specificity, meeting the requirements of conventional detection. At the same time, the detection primers of the present invention can greatly shorten the time for identifying the Hainan betel nut yellowing phytoplasma, and quickly identify the phytoplasma, thereby overcoming the problems of cumbersome steps and long identification cycle of traditional identification methods. The detection using the primer pair of the present invention has the characteristics of high sensitivity and strong specificity, and the detection method of the present invention has the advantages of high efficiency, rapidity, high sensitivity, etc., and can detect the 16SrII group phytoplasma newly discovered in the betel nut yellowing disease sample.

[0059] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and essence of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention are within the scope of protection of the present invention. Unless otherwise specified, the experimental materials, reagents, instruments, etc. used in the examples of the present invention are all commercially available; unless otherwise specified, all technical means in the examples of the present invention are conventional means well known to those skilled in the art.

[0060] 1. Universal primer nested PCR amplification and product cloning

[0061] The universal phytoplasma primers P1 / P7 were used to perform PCR amplification on the DNA of betel nut yellowing disease plants infected with 16SrI and 16SSrII phytoplasmas, respectively.

[0062] P1:AAGAGTTTGATCCTGGCTCAGGATT;

[0063] P7: CGTCCTTCATCGGCTCTT.

[0064] The reaction system for the first round of PCR amplification was: 2×Taq PCR Master Mix 2.5μL, P1 (10μM) 1μL, P7 (10μM) 1μL, ddH2O 8.5μL, and DNA template 2μL.

[0065] The reaction conditions for the first round of PCR amplification were: 94°C for 5 min; 94°C for 30 s, 50°C for 40 s, 72°C for 2 min, 35 cycles; 72°C for 10 min; and stored at 4°C.

[0066] After the first round of amplification, the product was diluted 20 times and nested amplification was performed using R16mF2 / R16mR1.

[0067] R16mF2: CATGCAAGTCGAACGGA;

[0068] R16mR1: CTTAACCCCAATCATCGA.

[0069] The reaction system for nested amplification was: 2×Taq PCR Master Mix 12.5μL, R16mF2 (10μM) 1μL, R16mR1 (10μM) 1μL, ddH2O 8.5μL, and DNA template 2μL.

[0070] The reaction program of nested amplification was: 94°C for 5 min; 94°C for 30 s, 50°C for 40 s, 72°C for 90 s, 35 cycles; 72°C for 10 min.

[0071] All bands obtained by amplification that were consistent with the expected size or not much different were cut and recovered. The recovered products were connected to the PUCm-T vector and cloned in competent cells. Single colonies were picked for molecular identification, and 3 positive clones were selected for sequencing by Sangon Biotech (Shanghai) Co., Ltd.

[0072] 2. Primer design and synthesis

[0073] The phytoplasma sequences obtained after cloning the nested amplification products of universal primers P1 / P7 and R16mF2 / R16mR1 were compared with the 16S rDNA sequences of six species of betel nut yellowing phytoplasmas uploaded to NCBI (National Center for Biotechnology Information) at home and abroad, as well as the 16S rDNA sequences of betel nut chloroplasts and betel nut bacterial leaf spot, etc., and 15 similar sequences with phytoplasma homology of 71.2-76.5% were compared and analyzed by multiple sequence alignment. Six difference regions were found, and primers were designed in the above regions. After a series of primer screening, the primer set was finally determined as follows:

[0074] Forward primer for the first round of amplification: HNP-1F: TTCTTGTTTTTAAAAGACCT;

[0075] The first round of amplification had a reverse primer pair HNP-1R: AAACTTGCGCTTCAGCT;

[0076] Nested forward primer HNP-2F: TGTGGTSTAAKKGCAAY;

[0077] Nested reverse primer HNP-2R: CTGATAACCTCCACKRTRTT.

[0078] The above primers were commissioned to be synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0079] DNA of areca nut plants infected with 16SrI and 16SrII areca nut yellowing phytoplasmas and the same host pathogen, Areca nut bacterial leaf spot pathogen ( Robbsia andropogonis ), non-host pathogen Pantoea ananas ( Pantoea ananatis ), Jujube witches'-Broom Phytoplasma, Mountain Jute Witches'-Broom Phytoplasma Trematomentosa Witches'-Broom Phytoplasma) and other genomic DNA and betel nut virus 1 cDNA were used as templates.

[0080] The total DNA of samples of betel nut yellowing disease, jujube madness disease, and mountain jute samples was extracted using the plant genomic DNA extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd.; the DNA of betel nut bacterial leaf spot pathogen was extracted using a bacterial genomic DNA extraction kit; the total RNA of betel nut yellow leaf virus disease samples was extracted using a plant total RNA extraction kit; and the viral cDNA was obtained by reverse transcription using the Tiangen reverse transcription kit.

[0081] The first round of PCR amplification experiments were performed using primer pair HNP-1F / HNP-1R, with ddH2O as a control.

[0082] The reaction system for PCR amplification was: 2×Taq PCR Master Mix 12.5 μL, HNP-1F (10 μM) 1 μL, HNP-1R (10 μM) 1 μL, ddH2O 8.5 μL, and DNA template 2 μL.

[0083] The reaction conditions for the first round of PCR amplification were: 94°C for 3 min; 94°C for 30 s, 42.5°C for 30 s, 72°C for 1 min, 35 cycles; 72°C for 5 min; and stored at 4°C.

[0084] After the first round of amplification, the product was diluted 20-fold and used as a template for nested PCR amplification with HNP-2F / HNP-2R primers;

[0085] The reaction system for nested PCR amplification was: 2×Taq PCR Master Mix 12.5 μL, HNP-2F (10 μM) 1 μL, HNP-2R (10 μM) 1 μL, ddH2O 8.5 μL, and DNA template 2 μL.

[0086] The reaction program of nested amplification was: 94°C for 3 min; 94°C for 30 s, 47°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 5 min.

[0087] The PCR amplification products were analyzed by 1.0% agarose gel electrophoresis at 120V for 40min. Figure 1 As shown in the figure, the experimental results were consistent with the designed analysis. The primer pair (primers HNP-1F / HNP-1R for the first round of PCR amplification; primers HNP-2F / HNP-2R for nested amplification) could only amplify a 429 bp specific band from the DNA of the areca catechu yellowing disease plants, while the DNA from the ddH2O control, healthy areca catechu plants, and the same host pathogen, Areca catechu bacterial leaf spot pathogen ( Robbsia andropogonis ), non-host pathogen Pantoea ananas ( Pantoea ananatis ), Jujube witches'-Broom Phytoplasma, Mountain Jute Witches'-Broom Phytoplasma Trematomentosa Witches'-Broom Phytoplasma) and betel nut virus 1 cDNA were used as templates, no bands were detected ( Figure 1 ). This indicates that the primers designed by the present invention can specifically detect the Hainan betel nut yellowing phytoplasma.

[0088] The construction and extraction methods of the 16S rDNA recombinant plasmid of the yellowing phytoplasma of Areca nut are as follows:

[0089] The PCR products of universal primers (P1 / P7 and R16mF2 / R16mR1) were cloned as follows:

[0090] (1) Add 2 μL of PCR recovered fragments and mix with 1 μL LT vector, 5 μL 2× Ligation Buffer, 1 μL 50% PEG4000, and 1 μL T4 DNA Ligase. Mix by flicking gently. Centrifuge briefly and connect at 22°C for 10 min. Place on ice after completion.

[0091] (2) Thaw 100 μL of competent cells on ice, add 10 μL of the above ligation solution, mix gently, and place on ice for 30 min.

[0092] (3) Heat shock the centrifuge tube in a 42°C metal bath for 90 seconds, then place on ice for 5 minutes. Add 900 μL of SOC medium and shake culture at 37°C for 1 hour.

[0093] (4) Centrifuge the bacterial culture for 1 hour at 4000 r / min for 3 minutes, remove 800 μL of the supernatant with a pipette, and suspend the cells with the remaining culture medium. Spread the bacterial suspension evenly on an LB plate containing 100 mg / mL ampicillin (AMP).

[0094] (5) Incubate the plate at 37°C for 1 h and then invert and incubate overnight.

[0095] (6) Pick 9 single colonies from each sample-coated plate, perform PCR amplification using M13 universal primers, and send the samples that have amplified the target fragment for sequencing.

[0096] (7) The positive transformants verified by sequencing were picked and placed in LB liquid culture medium supplemented with AMP. The culture was incubated at 37°C and 180 rpm for 12-16 h.

[0097] (8) Use a plasmid extraction kit to extract the recombinant plasmid in the bacterial culture, which is the 16S rDNA plasmid DNA of the Areca catechu yellowing phytoplasma.

[0098] In order to further verify the sensitivity of the primers for detecting the yellowing phytoplasma of Areca nut in Hainan, the 16S rDNA plasmid DNA of the yellowing phytoplasma of Areca nut was diluted step by step from 10 to 1×10 -12 ng / μL was used as a template and a nested PCR test was performed using the method of Example 2. The PCR system and reaction procedure were the same as those of Example 2, and the PCR product was detected by 1.0% agarose gel electrophoresis. Figure 2 and Figure 3 As shown, when the concentration of phytoplasma of the 16SrI group in the sample to be tested is greater than or equal to 750 ag / μL or the concentration of phytoplasma of the 16SrII group is greater than or equal to 4.8 pg / μL, the primer set designed by the present invention can be specifically amplified by nested PCR to obtain a DNA band of 429 bp, but when the concentration of phytoplasma of the 16SrI group in the sample to be tested is less than 750 ag / μL or the concentration of phytoplasma of the 16SrII group is less than 4.8 pg / μL, no band can be amplified. This shows that the nested primer pair of the present invention can detect the concentration of phytoplasma DNA of the 16SrI group betel nut yellowing phytoplasma ≥ 750 ag / μL or the concentration of phytoplasma DNA of the 16SrII group betel nut yellowing phytoplasma ≥ 4.8 pg / μL.

[0099] Using the specific primers for the yellowing phytoplasma of Areca nut in Hainan designed by the present invention, the method of Example 2 was used to perform nested PCR molecular detection on 30 total DNA samples of Areca nut plants collected from the field. Results: The specific primer set of the present invention detected a clear band of the expected size in 10 of the 30 DNA samples ( Figure 4 ), the specific band detection rate was 33.3%. In comparison, using universal primers (P1 / P7 and R16mF2 / R16mR1) to perform nested PCR molecular detection on the 30 samples of areca nut plant DNA, 1 to 6 bands were detected in the 30 samples tested; no specific bands were detected in any sample ( Figure 5 ). This shows that the primer pair of the present invention can be applied to the detection of the pathogen of Hainan betel nut yellowing disease.

Claims

1. A nested PCR primer set for specific detection of Hainan Areca catechu yellowing phytoplasma, characterized in that: It consists of a first-round amplification upstream primer, a first-round amplification downstream primer, a nested amplification upstream primer and a nested amplification downstream primer; the nucleotide sequence of the first-round amplification upstream primer is shown in SEQ ID NO: 1, the nucleotide sequence of the first-round amplification downstream primer is shown in SEQ ID NO: 2, the nucleotide sequence of the nested amplification upstream primer is shown in SEQ ID NO: 3, and the nucleotide sequence of the nested amplification downstream primer is shown in SEQ ID NO:

4.

2. A kit for specifically detecting Hainan betel nut yellowing phytoplasma, comprising the nested PCR primer set described in claim 1.

3. The kit according to claim 2, characterized in that The kit also includes PCR reaction reagents.

4. Use of the nested PCR primer set according to claim 1, or the kit according to claim 2 or 3 in detecting Hainan betel nut yellowing phytoplasma.

5. A method for detecting Hainan Areca catechu yellowing phytoplasma, characterized in that: The following steps are involved: S1, extracting DNA of the sample to be tested; S2, using the sample DNA to be tested as a template, and performing PCR amplification using the nested PCR primer set described in claim 1; S3. Observe the PCR amplification results under a gel imaging system. If the size of the observed band is consistent with the target band, it means that the sample to be tested contains the Hainan Areca Yellows Phytoplasma; otherwise, it means that the sample to be tested does not contain the Hainan Areca Yellows Phytoplasma; The sample to be tested in step S1 is derived from tissues of plants infected with betel nut yellowing disease; The PCR amplification method in step S2 is: firstly carry out the first round of PCR amplification, then take the first round of PCR amplification product and dilute it 20 times, and then use the diluted liquid material as the sample to be tested for nested amplification, and carry out nested amplification; the reaction system of the first round of PCR amplification is calculated as 25 μL, including 8.5 μL of ddH2O; 12.5 μL of 2×Taq PCR Master Mix; 1 μL of each of 10 μM first round amplification upstream primer and first round amplification downstream primer; 2 μL of 20-100 ng / μL DNA template of the sample to be tested; the reaction system of the nested amplification is calculated as 25 μL, including 8.5 μL of ddH2O; 12.5 μL of 2×Taq PCR Master Mix; 1 μL of each of 10 μM nested amplification upstream primer and nested amplification downstream primer; 2 μL of the sample to be tested; The reaction program of the first round of amplification was as follows: 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, 42.5°C annealing for 30 s, 72°C extension for 1 min, for a total of 35 cycles; 72°C extension for 5 min; the reaction program of nested amplification was as follows: 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, 47°C annealing for 30 s, 72°C extension for 30 s, for a total of 35 cycles; 72°C extension for 5 min; The DNA size of the target band in step S3 is 429 bp.

Images