Specific sequence of transgenic soybean medium yellow 6106 and application thereof

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a specific sequence of transgenic soybean medium yellow 6106 and application of the specific sequence, the specific sequence comprises an exogenous insertion element complete sequence and a flanking sequence of the exogenous insertion element complete sequence, and the nucleotide sequence of the specific sequence is shown as SEQ ID NO.1. The specific detection method is established through the specific sequence of the transgenic soybean yellow 6106, whether a sample to be detected contains the component of the transgenic soybean yellow 6106 or not can be effectively detected, and the detection method is rapid, simple, convenient, accurate and reliable.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and specifically relates to the specific sequence of transgenic soybean Zhonghuang 6106 and its application. Background Art

[0002] Serious weed damage is the main problem affecting soybean production. Conventional soybean weed control has many management links and poor weeding effects. To improve the weeding effect, herbicides are often overused, which not only affects the normal growth of soybeans and reduces yields, but also the application of high-residue herbicides affects crop rotation and the adjustment of planting structures. Cultivating herbicide-tolerant transgenic soybean varieties and supporting the use of highly efficient and low-residue herbicides such as glyphosate can effectively solve the weeding problem and achieve reasonable crop rotation and green agricultural development.

[0003] Zhonghuang 6106 is a transgenic soybean transformant with high glyphosate tolerance obtained by the Chinese Academy of Agricultural Sciences, Institute of Crop Science, through the Agrobacterium tumefaciens-mediated cotyledon node method, which superimposed and transformed the g2-epsps and gat genes with different glyphosate tolerance mechanisms into the soybean variety Zhonghuang 10 and screened with glyphosate. Utilizing Zhonghuang 6106 to cultivate and promote new soybean varieties tolerant to glyphosate herbicides is of great significance for improving the control efficiency of field weeds in soybean production, reducing production costs, increasing benefits and farmers' enthusiasm for growing soybeans, and enhancing the competitiveness of domestic soybeans.

[0004] When foreign genes are transferred into the plant genome by genetic engineering technology, the insertion sites have a certain degree of randomness. However, for a specific transformant, the position of the foreign gene fragment inserted into the soybean genome is unique and will not change during the process of variety breeding such as hybridization. The resulting inserted fragment and its flanking sequences are the identity characteristics of the transformant. Traditional methods usually use TAIL-PCR or thermal asymmetric PCR, etc., to gradually narrow the target region through multiple nested amplifications and finally obtain the sequences on both sides of the insertion site. The development of high-throughput sequencing technology has made it more convenient and efficient to quickly identify the insertion site through the whole-genome resequencing method.

[0005] During the process of transgenic variety breeding and supervision and management, it is necessary to determine whether specific foreign fragments are contained in transgenic plants or their products. Therefore, establishing a specific detection method for transgenic soybean Zhonghuang 6106 and / or its related materials based on the inserted fragment and its flanking sequences is of great significance for accelerating variety breeding and effective supervision. Summary of the Invention

[0006] One of the objectives of the present invention is to provide the specific sequence of transgenic soybean Zhonghuang 6106 and its application, and the specific sequence includes the full sequence of the foreign inserted fragment and its flanking sequences.

[0007] The second object of the present invention is to establish a specific PCR detection method and kit for transgenic soybean Zhonghuang 6106, which can specifically detect whether the tested sample contains the components of transgenic soybean Zhonghuang 6106. The detection method is rapid, simple, accurate and reliable.

[0008] The present invention provides a specific sequence of transgenic soybean Zhonghuang 6106, including the full sequence of the exogenous insertion fragment and the flanking sequence. The nucleotide sequence of the specific sequence is shown in SEQ ID NO.1.

[0009] As a preferred embodiment, the specific sequence is located on chromosome 17 of the soybean reference genome (Glycine max Wm82.a2.v1).

[0010] The present invention also provides a DNA sequence for detecting transgenic soybean Zhonghuang 6106, which contains at least part of the full sequence of the exogenous insertion fragment described in claim 1 and the flanking sequence, and the flanking sequence part is sequentially connected with the exogenous insertion fragment part.

[0011] The present invention also provides a specific primer pair for specifically amplifying the specific sequence or the DNA sequence described in the present invention, including at least one of the following: specific primer pair 1, specific primer pair 2, specific primer pair 3 and specific primer pair 4;

[0012] The forward primer of the specific primer pair 1 is shown in SEQ ID NO.2, and the reverse primer of the specific primer pair 1 is shown in SEQ ID NO.3;

[0013] The forward primer of the specific primer pair 2 is shown in SEQ ID NO.4, and the reverse primer of the specific primer pair 2 is shown in SEQ ID NO.5;

[0014] The forward primer of the specific primer pair 3 is shown in SEQ ID NO.6, and the reverse primer of the specific primer pair 3 is shown in SEQ ID NO.7;

[0015] The forward primer of the specific primer pair 4 is shown in SEQ ID NO.8, and the reverse primer of the specific primer pair 4 is shown in SEQ ID NO.9.

[0016] The present invention also provides a kit for detecting the specific sequence or the DNA sequence described in the present invention, and the kit contains the specific primer pair described in the present invention.

[0017] The present invention also provides the application of the specific sequence or the DNA sequence or the specific primer pair or the kit described in the present invention, and the application includes at least one of the following:

[0018] Specifically detect Huang 6106 in genetically modified soybean and / or materials related to Huang 6106 in genetically modified soybean; the materials related to Huang 6106 in genetically modified soybean include parents and / or offspring; the detection objects include one or more of plants, tissues, seeds and soybean products;

[0019] Auxiliary breeding of glyphosate - tolerant soybean;

[0020] Prepare products for auxiliary breeding of glyphosate - tolerant soybean;

[0021] Identify or assist in identifying the glyphosate - tolerance characteristics of soybean;

[0022] Prepare products for identifying or assisting in identifying the glyphosate - tolerance of soybean;

[0023] Select or assist in selecting glyphosate - tolerant soybean;

[0024] Prepare products for selecting or assisting in selecting glyphosate - tolerant soybean.

[0025] The present invention also provides a method for specifically detecting Huang 6106 in genetically modified soybean and / or materials related to Huang 6106 in genetically modified soybean, comprising the following steps:

[0026] Using the DNA of the sample to be tested as a template, perform PCR amplification with the specific primer pair of the present invention to obtain an amplified fragment, and judge whether the sample to be tested contains the components of Huang 6106 in genetically modified soybean according to the amplified fragment.

[0027] As a preferred scheme, the PCR amplification system is calculated as 25.0 μL: 10×PCR buffer 2.5 μL, dNTPs mixed solution 2.0 μL, 10 μmol / L forward primer 1.0 μL, 10 μmol / L reverse primer 1.0 μL, Taq DNA polymerase 0.5 μL, 25 mg / L DNA template 2.0 μL, and ddH2O is added to make up to 25.0 μL.

[0028] As a preferred scheme, the PCR amplification program is: denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, a total of 40 cycles; extension at 72°C for 5 min.

[0029] The present invention also provides an amplified fragment obtained by using the method for specifically detecting Huang 6106 in genetically modified soybean and / or materials related to Huang 6106 in genetically modified soybean of the present invention.

[0030] The present invention also provides the application of the amplified fragment of the present invention, and the application includes at least one of the following:

[0031] Specifically detect Zhonghuang 6106 in genetically modified soybeans and / or materials related to Zhonghuang 6106 in genetically modified soybeans; the materials related to Zhonghuang 6106 in genetically modified soybeans include parents and / or offspring; the detection objects include one or more of plants, tissues, seeds and soy products;

[0032] Auxiliary breeding of glyphosate-tolerant soybeans;

[0033] Prepare products for auxiliary breeding of glyphosate-tolerant soybeans;

[0034] Prepare products for identifying or assisting in identifying glyphosate tolerance in soybeans;

[0035] Prepare products for selecting or assisting in selecting glyphosate-tolerant soybeans.

[0036] Advantageous effects: The present invention provides a specific sequence of Zhonghuang 6106 in soybeans, including the full sequence of the exogenous insertion fragment and the flanking sequence, and the nucleotide sequence of the specific sequence is as shown in SEQ ID NO.1. The primers designed by the specific sequence of Zhonghuang 6106 in soybeans of the present invention can effectively detect whether the component of transgenic soybean Zhonghuang 6106 is contained in the sample to be tested, and the detection method is rapid, simple, accurate and reliable.

[0037] The detection method of the present invention is the PCR method. Compared with other methods, the operation is relatively simple, without complex processing steps. At the same time, the method of the present invention has low cost and does not require expensive instruments and reagents. This makes the method for specifically detecting Zhonghuang 6106 in genetically modified soybeans and / or materials related to Zhonghuang 6106 in genetically modified soybeans of the present invention easy to be popularized and applied in laboratories at all levels. Brief description of the drawings

[0038] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments.

[0039] Figure 1 For the insertion position and detailed structure of the exogenous fragment in transgenic soybean Zhonghuang 6106 in Example 1;

[0040] Figure 2 For the relative positions of the transformant-specific PCR primers in the Zhonghuang 6106 genome in Example 2;

[0041] Figure 3For the detection of the boundary sequences A, B, C, and D of the insertion site by the specific primer pairs in Example 2, where A is the amplification result of the boundary A sequence by specific primer pair 1; B is the amplification result of the boundary B sequence by specific primer pair 2; C is the amplification result of the boundary C sequence by specific primer pair 3; D is the amplification result of the boundary D sequence by specific primer pair 4; M is Trans 2Kplus II DNA marker; 1 is the sterile water control; 2 is the non-transgenic negative control; 3 is Zhonghuang 6106; 4 - 7 are related materials of Zhonghuang 6106. Detailed implementation manners

[0042] The present invention provides the specific sequences of soybean Zhonghuang 6106, including the full sequence of the exogenous insertion fragment and the flanking sequences, and the nucleotide sequence of the specific sequence is shown in SEQ ID NO.1. As a specific implementation manner, the specific sequence is located on chromosome 17 of the soybean reference genome (Glycine max Wm82.a2.v1). As a specific implementation manner, the specific sequence of soybean Zhonghuang 6106 includes five parts: ① the 5'-flanking sequence of the insertion site; ② an incomplete T-DNA fragment including the g2-epsps gene expression cassette and part of the CaMV 35S promoter; ③ a 3472-bp soybean genomic sequence recombined into the insertion fragment, which is identical to the receptor Zhonghuang 10 soybean genomic sequence, corresponding to the physical position Chr17: 7977069 - 7980527 of the soybean reference genome (Glycine max Wm82.a2.v1); ④ a T-DNA fragment containing the complete g2-epsps and gat gene expression cassettes; ⑤ the 3'-flanking sequence of the insertion site.

[0043] The present invention also provides a DNA sequence for detecting transgenic soybean Zhonghuang 6106, which contains at least part of the full sequence of the exogenous insertion fragment and the flanking sequences described in claim 1, and the flanking sequence part is sequentially connected to the exogenous insertion fragment part.

[0044] The present invention also provides specific primer pairs for specifically amplifying the specific sequences or the DNA sequences described in the present invention, including at least one of the following pairs: specific primer pair 1, specific primer pair 2, specific primer pair 3, and specific primer pair 4;

[0045] The forward primer of the specific primer pair 1 is shown in SEQ ID NO.2, and the reverse primer of the specific primer pair 1 is shown in SEQ ID NO.3;

[0046] The forward primer of the specific primer pair 2 is shown in SEQ ID NO.4, and the reverse primer of the specific primer pair 2 is shown in SEQ ID NO.5;

[0047] The forward primer of the specific primer pair 3 is as shown in SEQ ID NO.6, and the reverse primer of the specific primer pair 3 is as shown in SEQ ID NO.7;

[0048] The forward primer of the specific primer pair 4 is as shown in SEQ ID NO.8, and the reverse primer of the specific primer pair 4 is as shown in SEQ ID NO.9.

[0049] As a specific embodiment, the sequences of the specific primer pairs of the present invention are as follows:

[0050] Forward primer of specific primer pair 1 (SEQ ID NO.2): 5’-CTCTATCTCTCTCGATTTGGACACA-3’;

[0051] Reverse primer of specific primer pair 1 (SEQ ID NO.3): 5’-TCGCTCATGTGTTGAGCATATAA-3’;

[0052] Forward primer of specific primer pair 2 (SEQ ID NO.4): 5’-GTCGTGACTGGGAAAACCCT-3’;

[0053] Reverse primer of specific primer pair 2 (SEQ ID NO.5): 5’-TATTCTAAAACGCTTTCTTCTTGCT A-3’;

[0054] Forward primer of specific primer pair 3 (SEQ ID NO.6): 5’-ACTAAACCTCTTAATGATACGGCTT-3’;

[0055] Reverse primer of specific primer pair 3 (SEQ ID NO.7): 5’-GTCGTGACTGGGAAAACCCT-3’;

[0056] Forward primer of specific primer pair 4 (SEQ ID NO.8): 5’-GGAGCATCGTGGAAAAAGAAG-3’;

[0057] Reverse primer of specific primer pair 4 (SEQ ID NO.9): 5’-CAGAAGAGTATTCGGGAAGCTAA-3’.

[0058] As a specific embodiment, the full sequence of the exogenous insertion fragment and the flanking sequence of the transgenic soybean Zhonghuang 6106 of the present invention include the exogenous insertion sequence and the soybean genomic sequence. Primers are designed at the boundary between the exogenous insertion sequence and the soybean genomic sequence of the present invention to make the primers more specific. The forward primer of specific primer pair 1 is derived from the soybean genome, and the reverse primer of specific primer pair 1 is derived from the exogenous gene; the forward primer of specific primer pair 2 is derived from the exogenous gene, and the reverse primer of specific primer pair 2 is derived from the soybean genome; the forward primer of specific primer pair 3 is derived from the soybean genome, and the reverse primer of specific primer pair 3 is derived from the exogenous gene; the forward primer of specific primer pair 4 is derived from the exogenous gene, and the reverse primer of specific primer pair 4 is derived from the soybean genome. As a specific embodiment, at least one pair of specific primer pairs of the present invention can be used to specifically identify transgenic soybean Zhonghuang 6106 and / or materials related to transgenic soybean Zhonghuang 6106. Among them, when 4 pairs of specific primer pairs are used for co-detection, the detection result is more accurate.

[0059] The present invention also provides a kit for detecting the specific sequence or the DNA sequence of the present invention, and the kit contains the specific primer pair of the present invention.

[0060] The present invention also provides the application of the specific sequence or the DNA sequence or the specific primer pair or the kit of the present invention, and the application includes at least one of the following:

[0061] Specifically detecting transgenic soybean Zhonghuang 6106 and / or materials related to transgenic soybean Zhonghuang 6106; the materials related to transgenic soybean Zhonghuang 6106 include parents and / or offspring; the detection objects include one or more of plants, tissues, seeds and soybean products;

[0062] Auxiliary breeding of glyphosate-tolerant soybeans;

[0063] Preparing products for auxiliary breeding of glyphosate-tolerant soybeans;

[0064] Identifying or assisting in identifying the glyphosate tolerance characteristics of soybeans;

[0065] Preparing products for identifying or assisting in identifying the glyphosate tolerance of soybeans;

[0066] Selecting or assisting in selecting glyphosate-tolerant soybeans;

[0067] Preparing products for selecting or assisting in selecting glyphosate-tolerant soybeans.

[0068] The present invention also provides a method for specifically detecting transgenic soybean Zhonghuang 6106 and / or materials related to transgenic soybean Zhonghuang 6106, including the following steps:

[0069] Using the DNA of the sample to be tested as a template, PCR amplification is carried out using the specific primer pair of the present invention to obtain an amplified fragment, and it is judged whether the sample to be tested contains the components of transgenic soybean Zhonghuang 6106 according to the amplified fragment.

[0070] As a specific embodiment, the system of the PCR amplification is 25.0 μL in total: 2.5 μL of 10×PCR buffer, 2.0 μL of dNTPs mixed solution, 1.0 μL of 10 μmol / L forward primer, 1.0 μL of 10 μmol / L reverse primer, 0.5 μL of Taq DNA polymerase, 2.0 μL of 25 mg / L DNA template, and supplemented with ddH2O to 25.0 μL.

[0071] As a specific embodiment, the procedure of the PCR amplification is: denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, for a total of 40 cycles; extension at 72°C for 5 min.

[0072] The present invention can judge whether the sample to be tested contains the components of transgenic soybean Zhonghuang 6106 according to the amplified fragment. When a specific band is amplified using the specific primer pair, it proves that the sample to be tested contains the components of transgenic soybean Zhonghuang 6106; when no specific band is amplified using the specific primer pair, it proves that the sample to be tested does not contain the components of transgenic soybean Zhonghuang 6106.

[0073] In the examples of the present invention, by detecting known soybean samples, as expected, no PCR products were produced in the no-template control and the receptor Zhonghuang 10 (non-transgenic negative control). Transgenic soybean Zhonghuang 6106 and 4 Zhonghuang 6106-related materials all amplified bands of the expected target size. It shows that the specific primer pair and detection method designed by the present invention can effectively detect whether the sample to be tested contains the components of transgenic soybean Zhonghuang 6106, and the detection method is rapid, simple, accurate and reliable.

[0074] The detection method of the present invention is the PCR method. Compared with other methods, the operation is relatively simple, without complex processing steps. At the same time, the method of the present invention has low cost and does not require expensive instruments and reagents. This makes the method for specifically detecting transgenic soybean Zhonghuang 6106 and / or transgenic soybean Zhonghuang 6106-related materials of the present invention easy to be popularized and applied in laboratories at all levels.

[0075] The present invention also provides an amplified fragment obtained by using the method for specifically detecting transgenic soybean Zhonghuang 6106 and / or transgenic soybean Zhonghuang 6106-related materials of the present invention. As a specific embodiment, the amplified fragment of the present invention is amplified by the specific primer pair of the present invention, and the amplified fragment includes amplified fragment boundary A, amplified fragment boundary B, amplified fragment boundary C and amplified fragment boundary D.

[0076] As a specific implementation manner, amplification fragment boundary A is obtained by amplifying with specific primer pair 1, and the nucleotide sequence of the amplification fragment boundary A is as shown in SEQ ID NO.10: 5’-CTCTATCTCTCTCGATTTGGACACACGTGC ACGCGCATACTTTGACATAGACAAATGTTAACAAACTTATCTGCATTTACCTACTCCAAAGCTAACTGTACAAATCATGACTCTCAACTCTGAACTTCTCTCCCCTTTCTCTTTCTGTTTACGTGCGTGTGTAGTATGATTCATTGTGGTGTAAACAAATTGACGCTTAGACAACTTAATAACACATTGCGGACGTTTTTAATGTACTGAATTAACGCCGAATTAATTCGGGGGATCTGGATTTTAGTACTGGATTTTGGTTTTAGGAATTAGAAATTTTATTGATAGAAGTATTTTACAAATACAAATACATACTAAGGGTTTCTTATATGCTCAACACATGAGCGA-3’; As another specific implementation manner, amplification fragment boundary B is obtained by amplifying with specific primer pair 2, and the nucleotide sequence of the amplification fragment boundary B is as shown in SEQ ID NO.As shown in Figure 11: 5’-GTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCT TGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGCTAGAGCAGCTTGAGCTTGGATCAGATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTGTTTGAGACTGTAAATCACCCACTCGTTCTGCCGCAATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACATCAAAGGCTTTTACCTAAAACATCTCAGCACATCGCTCTAGCCTCTAGTGGCGGCGTTCACATTTCACACCTTTCTCTGATTTAGCTCTTTCAAAGTGTTTTGCATTATTAATAACAAGGGTGAGAGCAACTGATATTTTATCCTAAAGCAATTTCTCGAAATTAATTTTCTTTAGCAAGAAGAAAGCGTTTTAGAATA-3’; As another specific embodiment, amplification fragment boundary C is obtained by amplifying with specific primer pair 3, and the nucleotide sequence of the amplification fragment boundary C is as shown in SEQ ID NO. 12: 5’-ACTAAACCTCTTAATGATACG GCTTACGTGCCCTGCTTCTCCAATCCAATTGATGTTCAAAGAAACCAAGAAGGTGTCTTTGATTCCTTCACCAACTCTATCTATGCGGTTTCTTCAAATCCTATGGGCATTCTTCCCAGAATGCCACCTTCTGGCTCCTTCAAACACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCCAAGCTCAAGCTGCTCTAGCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGAC-3’; As another specific embodiment, amplification fragment boundary D is obtained by amplifying with specific primer pair 4, and the nucleotide sequence of the amplification fragment boundary D is as shown in SEQ ID NO.As shown in Figure 13: 5’-GGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAA GCAAGTGGATTGATGTGAACATGGTGGAGCACGACACTCTCGTCTACTCCAAGAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCTATTGACTAAGCGTCAATGTTTCTGGGACCAACAACACCTTCGGTTCCACCCTTGTTGAACGAGTGGTTTTGTTAAGCTTAACTGATGTGTCTGCCTCGGAAACTATTTCAAGGGGCAGTTATTTACTTATTTGTCTTATTATTTTTTGTTTCCTTTTGTTCCTAATAAATCTTGAAGACCATATTTGTAATTTCAATTACAATAAAGTGACATAACTGATTTTGAAAAGGAAGATCTATTATTGATTGCATTCATACAGCTGGGATAAGTTTCAGAAAAAAAGAATATTAGCTTCCCGAATACTCTTCTG-3’.

[0077] The present invention also provides the use of the amplified fragment of the present invention, and the use includes at least one of the following:

[0078] Specifically detecting Huang 6106 in genetically modified soybean and / or materials related to Huang 6106 in genetically modified soybean; the materials related to Huang 6106 in genetically modified soybean include parents and / or offspring; the detection objects include one or more of plants, tissues, seeds and soybean products;

[0079] Auxiliary breeding of glyphosate-tolerant soybean;

[0080] Preparing products for auxiliary breeding of glyphosate-tolerant soybean;

[0081] Preparing products for identifying or assisting in identifying glyphosate tolerance of soybean;

[0082] Preparing products for selecting or assisting in selecting glyphosate-tolerant soybean.

[0083] In order to further illustrate the present invention, the specific sequence and its application of the genetically modified soybean Huang 6106 provided by the present invention will be described in detail below in conjunction with embodiments, but they cannot be construed as limiting the protection scope of the present invention.

[0084] Unless otherwise specified, the present invention has no special requirements for the preparation raw materials, and commercially available products well-known to those skilled in the art can be used.

[0085] Example 1 Size and Structure of Insertion Sequences, Analytical Methods for Determining Their Characteristics

[0086] Beijing Biomarker Biotechnology Co., Ltd. conducted second-generation genome sequencing on Zhonghuang 6106 soybeans. The sequencing analysis methods are as follows:

[0087] DNA Sample Detection: Agarose gel electrophoresis was used to analyze the DNA degradation degree of Zhonghuang 6106 and whether there was RNA or protein contamination; Qubit was used to accurately quantify the DNA concentration of Zhonghuang 6106. DNA samples with a content of more than 0.5 μg were used for library construction.

[0088] Library Construction: Genomic DNA was randomly fragmented into fragments of about 350 bp in length by a Covaris crusher. After end repair and adding an A tail, adapters were ligated to both ends of the fragments to prepare a DNA library.

[0089] Library Inspection: After the library construction was completed, Qubit 2.0 was first used for preliminary quantification, and then Agilent 2100 was used to detect the inserted fragment size of the library. After the inserted fragment size met the expectations, the qPCR method was used to accurately quantify the effective concentration (3 nM) of the library to ensure the library quality.

[0090] Sequencing Run: When the library inspection was qualified, sequencing was performed using the Illumina platform according to the effective concentration of the library and the data output requirements.

[0091] Filtering of Sequencing Data: The original sequencing sequences obtained by sequencing contained reads with adapters and low-quality reads. To ensure the quality of information analysis, the raw reads needed to be carefully filtered to obtain clean reads, and subsequent analyses were based on the clean reads. The specific processing steps are as follows: 1) Remove pairs of reads with adapters; 2) When the proportion of N (where N represents undetermined base information) in a single-end sequencing read is greater than 10%, this pair of reads needs to be removed; 3) When the number of low-quality (less than 5) bases in a single-end sequencing read exceeds 50% of the length of the read, this pair of reads needs to be removed.

[0092] Analysis of Insertion Sites: The reads obtained by sequencing were aligned with the complete sequences of the soybean genome and the vector to identify the reads that could be aligned to the vector, and the position where the inserted gene was inserted into the reference genome was screened according to the alignment results.

[0093] Combined with the results of Sanger sequencing after PCR amplification and bioinformatics analysis, the results showed that the exogenous DNA fragment in Zhonghuang 6106 was inserted between the physical positions 7,979,555 and 7,980,541 on chromosome 17 of the soybean reference genome ( Figure 1 ), and the inserted fragment included five parts:

[0094] ① The flanking sequence at the 5' end of the insertion site;

[0095] ② An incomplete T-DNA fragment including the g2-epsps gene expression cassette and part of the CaMV 35S promoter;

[0096] ③ A 3,472-bp soybean genomic sequence recombined into the inserted fragment, which was identical to the genomic sequence of the receptor Zhonghuang 10 soybean, corresponding to the physical position Chr07:7977069-7980527 of the soybean reference genome;

[0097] ④ A T-DNA fragment containing the complete g2-epsps and gat gene expression cassettes;

[0098] ⑤ The flanking sequence at the 3' end of the insertion site.

[0099] The annotation of the full-length sequence of the insertion site and the flanking sequences is shown in Table 1.

[0100] Table 1 Annotation of the full-length sequence of the insertion site and the flanking sequences

[0101]

[0102]

[0103] Example 2 Transformant-specific PCR detection method

[0104] Using primers derived from the soybean genome on both sides of the insertion site of Zhonghuang 6106 and primers derived from the exogenous inserted fragment, primer pairs that can specifically detect the boundary sequences of the insertion position in Zhonghuang 6106 soybeans were respectively formed. The sequence of each primer and the size of the amplified fragment are shown in Table 2, and the positions of the primers are as Figure 2 shown.

[0105] Table 2 Information on PCR primers and products for specific identification of Zhonghuang 6106 soybeans

[0106]

[0107]

[0108] Using the primer pairs in Table 2, perform PCR amplification on the DNA of the test substances (including Zhonghuang 6106, 4 Zhonghuang 6106-related materials, and the non-transgenic negative control receptor Zhonghuang 10, with sterile water as the blank control). Add the reaction reagents to the PCR tubes in sequence according to Table 3, mix well, centrifuge, and then place them in a PCR instrument for PCR amplification. The PCR detection reaction procedure is as follows: Denature at 94°C for 5 min; denature at 94°C for 30 s, anneal at 58°C for 30 s, extend at 72°C for 30 s, and perform 40 cycles in total; extend at 72°C for 5 min.

[0109] Table 3 PCR Detection Reaction System

[0110] Reagent Final concentration Volume 10×PCR buffer 1× 2.5 μL dNTPs mixed solution (each 2.5 mmol / L) 0.2 mmol / L 2.0 μL 10 μmol / L forward primer 0.4 μmol / L 1.0 μL 10 μmol / L reverse primer 0.4 μmol / L 1.0 μL Taq DNA polymerase 0.025 U / μL 0.5 μL 25 mg / L DNA template 2.0 mg / L 2.0 μL <![CDATA[ddH2O]]> 16.0 μL Total volume 25.0 μL

[0111] Results: The results are as Figure 3 shown. By detecting known soybean samples, as expected, no PCR products are generated in the no-template control (lane 1) and the receptor Zhonghuang 10 (lane 2). Bands of the expected size are amplified in Zhonghuang 6106 (lane 3) and Zhonghuang 6106-related materials (lanes 4-7) ( Figure 3 ). The results indicate that the specific primer pairs and detection method designed in the present invention can effectively detect whether the test samples contain the components of transgenic soybean Zhonghuang 6106, and the detection method is rapid, simple, accurate, and reliable.

[0112] Thus, the present invention provides the specific sequence of transgenic soybean Zhonghuang 6106 and its application. The nucleotide sequence of the specific sequence is as shown in SEQ ID NO.1. The primers designed based on the specific sequence of transgenic soybean Zhonghuang 6106 in the present invention can effectively detect whether the test samples contain the components of transgenic soybean Zhonghuang 6106, and the detection method is rapid, simple, accurate, and reliable.

[0113] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all embodiments. People can also obtain other embodiments without creative efforts based on this embodiment, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The specific sequence of Huang 6106 in transgenic soybean, characterized in that: The specific sequence includes the entire sequence of the exogenous inserted fragment and its flanking sequences, and the nucleotide sequence of the specific sequence is shown in SEQ ID NO.

1.

2. The specific sequence according to claim 1, characterized in that The specific sequence is located on chromosome 17 of the soybean reference genome.

3. A DNA sequence for detecting Huang 6106 in transgenic soybeans, characterized in that: It comprises at least part of the complete sequence of the exogenous insertion fragment and the flanking sequence as described in claim 1, and the flanking sequence part is sequentially connected to the exogenous insertion fragment part.

4. A specific primer pair for specifically amplifying the specific sequence described in claim 1 or 2 or the DNA sequence described in claim 3, characterized in that: comprising at least one pair of the following: specific primer pair 1, specific primer pair 2, specific primer pair 3 and specific primer pair 4; The forward primer of the specific primer pair 1 is shown as SEQ ID NO.2, and the reverse primer of the specific primer pair 1 is shown as SEQ ID NO.3; The forward primer of the specific primer pair 2 is shown as SEQ ID NO.4, and the reverse primer of the specific primer pair 2 is shown as SEQ ID NO.5; The forward primer of the specific primer pair 3 is shown as SEQ ID NO.6, and the reverse primer of the specific primer pair 3 is shown as SEQ ID NO.7; The forward primer of the specific primer pair 4 is shown as SEQ ID NO.8, and the reverse primer of the specific primer pair 4 is shown as SEQ ID NO.

9.

5. A kit for detecting the specific sequence according to claim 1 or 2 or the DNA sequence according to claim 3, characterized in that: The kit comprises the specific primer pair according to claim 4.

6. Use of the specific sequence according to claim 1 or 2, or the DNA sequence according to claim 3, or the specific primer pair according to claim 4, or the kit according to claim 5, characterized in that: The application includes at least one of the following: Specific detection of transgenic soybean Zhonghuang 6106 and / or transgenic soybean Zhonghuang 6106 related materials; the transgenic soybean Zhonghuang 6106 related materials include parents and / or offspring; the detection objects include one or more of plants, tissues, seeds and soybean products; Assisted breeding of glyphosate-tolerant soybeans; Preparation of products to assist breeding of glyphosate-tolerant soybeans; Identify or assist in identifying soybean glyphosate tolerance characteristics; Prepare products for identifying or assisting in identifying soybean glyphosate resistance; Breeding or assisting in breeding glyphosate-tolerant soybeans; Prepare products for breeding or assisting in breeding glyphosate-tolerant soybeans.

7. A method for specifically detecting transgenic soybean Huang 6106 and / or transgenic soybean Huang 6106-related materials, characterized in that: The following steps are involved: The DNA of the sample to be tested is used as a template, and PCR amplification is performed using the specific primer pair described in claim 4 to obtain an amplified fragment, and whether the sample to be tested contains the component of Huang 6106 in the genetically modified soybean is determined based on the amplified fragment.

8. The method according to claim 7, characterized in that The PCR amplification system is calculated as follows: 25.0 μL: 2.5 μL of 10×PCR buffer, 2.0 μL of dNTPs mixed solution, 1.0 μL of 10 μmol / L forward primer, 1.0 μL of 10 μmol / L reverse primer, 0.5 μL of Taq DNA polymerase, 2.0 μL of 25 mg / L DNA template, and ddH2O is added to 25.0 μL; The PCR amplification program was as follows: denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s, for a total of 40 cycles; and extension at 72°C for 5 min.

9. The amplified fragment obtained by the method according to claim 7 or 8.

10. The use of the amplified fragment according to claim 9, characterized in that: The application includes at least one of the following: Specific detection of transgenic soybean Zhonghuang 6106 and / or transgenic soybean Zhonghuang 6106 related materials; the transgenic soybean Zhonghuang 6106 related materials include parents and / or offspring; the detection objects include one or more of plants, tissues, seeds and soybean products; Assisted breeding of glyphosate-tolerant soybeans; Preparation of products to assist breeding of glyphosate-tolerant soybeans; Prepare products for identifying or assisting in identifying soybean glyphosate resistance; Prepare products for breeding or assisting in breeding glyphosate-tolerant soybeans.

Images