Two hybridoma cell lines, anti-human ck-hmw cocktail antibodies and uses thereof

Abstract

The application provides two hybridoma cell strains, an anti-human CK-HMW cocktail antibody and application thereof, the two hybridoma cell strains are named as OTI6A3 and OTI2C2 respectively, are preserved in the China General Microbiological Culture Collection Center, and the preservation numbers are CGMCC No.45715 and CGMCC No.45712.The anti-human CK-HMW cocktail antibody is prepared by mixing two monoclonal antibodies OTI6A3 and OTI2C2 secreted by the two hybridoma cell strains OTI6A3 and OTI2C2 respectively.The two hybridoma cell strains can stably secrete monoclonal antibodies, specifically bind with CK-HMW protein and do not cross with low molecular weight keratin CK19, significantly improve the specificity, accuracy and reliability of CK-HMW protein immune detection, and can be applied to the labeling of CK-HMW protein in tissues.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to two hybridoma cell lines, an anti-human CK-HMW cocktail antibody, and their applications. Background Technology

[0002] Cytokeratin (CK) is a class of cytoskeletal proteins, an important component of intermediate filaments, and is found in epithelial cells and some non-epithelial cells. Members have a molecular weight of 40-68 kDa and are classified into acidic cytokeratin (type I) and basic cytokeratin (type II) based on their isoelectric point. Each type I keratin forms a pair with a type II keratin; type I keratin usually pairs with a type II keratin that is 9 kDa larger. Keratin 19 is an exception, existing in an unpaired form. All epithelial cells contain at least two types of keratin. Clinically, CK is often classified according to molecular weight into high molecular weight (CK-HMW: usually CK1, CK5, CK10, and CK14) and low molecular weight (CK-LMW: usually CK8, CK18, and CK19).

[0003] 34βE12 is a typical representative of high molecular weight keratin antibodies. Introduced into the IHC of FFPE samples in 1982, it is primarily used to label CK-HMW subtypes 1, 5, 10, and 14. This antibody remains the most widely used CK-HMW protein marker, and its diagnostic value has been documented in numerous publications. It has now been confirmed that CK-HMW is expressed in prostatic basal cells but not in glandular epithelium, thus it can be used for the differential diagnosis of non-invasive and invasive prostatic lesions. CK-HMW is also currently used in breast pathology to identify basal cell-like breast cancer and differentiate it from other subtypes. However, this clone suffers from non-specific staining problems (rounds 16 and 38, www.nordiqc.org), caused by cross-reactivity with low molecular weight cytokeratins, and therefore its use is currently not recommended for breast cancer diagnosis. Therefore, developing an antibody that recognizes high molecular weight keratin and does not cross-react with low molecular weight cytokeratins would have high pathological diagnostic value. Summary of the Invention

[0004] This invention aims to provide two hybridoma cell lines, anti-human CK-HMW cocktail antibodies, and their applications, to provide cocktail antibodies that can specifically bind to CK-HMW protein and do not cross-react with CK19, thereby improving the specificity, accuracy, and reliability of CK-HMW protein immunoassay, and can be applied to the labeling of CK-HMW protein in tissues.

[0005] To achieve the above objectives, the technical solution of the present invention is implemented as follows:

[0006] This invention provides two hybridoma cell lines, named OTI6A3 and OTI2C2, respectively, which are deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession numbers CGMCC No. 45715 and CGMCC No. 45712, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, on September 6, 2023.

[0007] Type I and Type II keratin exist in pairs. CK-HMW typically includes CK1, CK5, CK10, and CK14, with CK1 and CK10 existing in pairs, and CK5 and CK14 existing in pairs. Therefore, this invention analyzes the sequence characteristics of CK1 and CK14, and develops corresponding monoclonal antibodies using these two keratin as research objects. Then, the antibodies secreted by various specific hybridoma cell lines are mixed to prepare the anti-human CK-HMW cocktail antibody.

[0008] The screening method for the two hybridoma cell lines and the method for preparing monoclonal antibodies described in this invention are as follows:

[0009] (1) Construction of recombinant expression vector: Based on the amino acid sequence characteristics of CK1 and by comparing the amino acid sequences of CK1 with those of other keratins, regions with low homology were selected as immunogens. The amino acid fragments of CK1 from position 170 to 500 were designed as immunogens (the corresponding nucleotide sequences are shown in SEQ ID NO.1 and the amino acid sequences are shown in SEQ ID NO.2). Primers were designed, and restriction endonuclease sites SgfI and MluI were introduced on both sides of the gene, respectively. The gene was inserted into the expression vector pET23a-N-His to construct the recombinant expression plasmid pET23a-rCK1.

[0010] (2) Expression and purification of recombinant CK1 protein: The constructed recombinant CK1 expression plasmid was transformed into E. coli cells, and the supernatant was obtained by lysis and centrifugation. The supernatant was purified by nickel affinity chromatography to obtain purified recombinant CK1 protein.

[0011] (3) Synthesis of CK14 polypeptide fragment: Based on the amino acid sequence characteristics of CK14, the amino acid sequences of CK14 and other cytokeratins were compared, and regions with low homology were selected as immunogens. The amino acid sequences at positions 150-174 and 429-453 were designed to be coupled to KLH protein as immunogens, and their sequences are shown in SEQ ID NO.3-4.

[0012] (4) Screening of hybridoma cells for CK1 and CK14 monoclonal antibodies and preparation of their secreted monoclonal antibodies: BALB / c mice were immunized with the above-mentioned recombinant CK1 protein and CK14 peptides, respectively. Mouse spleen cells were fused with sp2 / 0 cells, and monoclonal antibodies were obtained by limiting dilution. Positive hybridoma cells were screened by ELISA to obtain hybridoma cell lines that could secrete specific antibodies against CK1 and CK14 proteins, respectively, and subtype identification was performed. Antibodies were prepared by serum-free culture medium and purified by affinity chromatography to obtain monoclonal antibodies against CK1 and CK14 proteins, namely OTI6A3 and OTI2C2.

[0013] Furthermore, the monoclonal antibody OTI6A3 has a light chain variable region containing 110 amino acids, and its amino acid sequence is shown in SEQ ID NO.5; its heavy chain variable region contains 113 amino acids, and its amino acid sequence is shown in SEQ ID NO.9.

[0014] Furthermore, the monoclonal antibody OTI6A3, wherein the light chain variable region includes CDR1, CDR2 and CDR3, which are 27aa-37aa, 55aa-57aa and 94aa-99aa respectively, and their amino acid sequences are shown in SEQ ID NO.6-8 respectively.

[0015] Furthermore, the monoclonal antibody OTI6A3, wherein the heavy chain variable region includes CDR1, CDR2 and CDR3, which are 26aa-33aa, 51aa-58aa and 97aa-102aa respectively, and their amino acid sequences are shown in SEQ ID NO.10-12 respectively.

[0016] Furthermore, the monoclonal antibody OTI2C2 contains 109 amino acids in its light chain variable region, the amino acid sequence of which is shown in SEQ ID NO.13; and 113 amino acids in its heavy chain variable region, the amino acid sequence of which is shown in SEQ ID NO.17.

[0017] Furthermore, the monoclonal antibody OTI2C2, wherein the light chain variable region includes CDR1, CDR2 and CDR3, which are 27aa-37aa, 55aa-57aa and 94aa-98aa respectively, and their amino acid sequences are shown in SEQ ID NO.14-16 respectively.

[0018] Furthermore, the monoclonal antibody OTI2C2, wherein the heavy chain variable region includes CDR1, CDR2 and CDR3, which are 26aa-33aa, 51aa-58aa and 97aa-102aa respectively, and their amino acid sequences are shown in SEQ ID NO.18-20 respectively.

[0019] Furthermore, the two monoclonal antibodies OTI6A3 and OTI2C2 are mixed to form the CK-HMW cocktail antibody, which binds to the CK-HMW protein with high specificity. The sensitivity and specificity of the cocktail antibody are verified by immunoassay methods, such as immunohistochemistry (IHC).

[0020] Furthermore, the CK-HMW cocktail antibody is used in the preparation of an immunoassay tool; preferably, the immunoassay tool is used to detect CK-HMW protein; more preferably, the immunoassay tool is a reagent kit, chip, or test strip.

[0021] Furthermore, the CK-HMW cocktail antibody is used in the preparation of a kit for labeling normal or tumor tissues; preferably, the normal or tumor tissues include liver, prostate, esophageal, and breast ductal carcinoma.

[0022] An immunohistochemical detection kit, comprising the CK-HMW cocktail antibody as described above, is used to detect the expression status of CK-HMW protein in tissues.

[0023] Compared with existing technologies, the two hybridoma cell lines, the anti-human CK-HMW cocktail antibody, and their applications described in this invention have the following advantages:

[0024] In the development of the two hybridoma cell lines and the anti-human CK-HMW cocktail antibody of this invention, antigen design involved comparative analysis of various keratin amino acid sequences. Amino acid fragments with low homology were selected as immunogens. The screening process removed clones that crossed with other keratins. Therefore, the two hybridoma cell lines can stably secrete monoclonal antibodies that specifically bind to CK-HMW protein and do not cross with low molecular weight keratin CK19. This significantly improves the specificity, accuracy, and reliability of CK-HMW protein immunoassay and is applicable to the labeling of CK-HMW protein in tissues. Attached Figure Description

[0025] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings:

[0026] Figure 1 The image shows the Western blot results of the recombinant CK1 protein described in Example 2 of this invention. The expression of the recombinant CK1 protein in E. coli cells was detected using anti-HIS antibody. Lane L represents the detection results of E. coli cell lysate transfected with the empty vector as the antigen, and lane R represents the detection results of E. coli cell lysate transfected with pET23a-rCK1 plasmid as the antigen.

[0027] Figure 2 The image shows the SDS-PAGE results of the CK1 protein described in Example 2 of this invention. The recombinant CK1 protein was purified using a nickel affinity chromatography column, and the purified protein was subjected to SDS-PAGE electrophoresis and Coomassie brilliant blue staining.

[0028] Figure 3 This is a schematic diagram showing the comparison results of liver detection by IHC method between the commercially available anti-CK-HMW monoclonal antibody 34βE12 described in Example 5 of this invention and the cocktail antibody described in this invention.

[0029] Figure 4 This is a schematic diagram showing the comparison results of the widely used anti-CK-HMW monoclonal antibody 34βE12 described in Example 5 of the present invention and the cocktail antibody described in the present invention when detecting prostate cancer using the IHC method.

[0030] Figure 5 This is a schematic diagram showing the comparison results of the widely used anti-CK-HMW monoclonal antibody 34βE12 described in Example 5 of this invention and the cocktail antibody described in this invention when detecting esophagus using the IHC method.

[0031] Figure 6 This is a schematic diagram showing the comparison results of the widely used anti-CK-HMW monoclonal antibody 34βE12 described in Example 5 of the present invention and the cocktail antibody described in the present invention in detecting breast ductal carcinoma by IHC method; Detailed Implementation

[0032] Unless otherwise defined, the technical terms used in the following embodiments have the same meanings as commonly understood by those skilled in the art. Unless otherwise specified, the experimental reagents used in the following embodiments are conventional biochemical reagents; and the experimental methods described are conventional methods.

[0033] The present invention will now be described in detail with reference to the embodiments and accompanying drawings.

[0034] Example 1: Construction of recombinant expression plasmid for CK1 protein

[0035] The CK1 gene NM_006121 was selected from Genebank. Based on the amino acid sequence characteristics of CK1, the 170-500 amino acid fragment of CK1 was designed as an immunogen (its corresponding nucleotide sequence is shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.2). Primers were designed, and restriction endonuclease sites SgfI and MluI were introduced on both sides of the gene, respectively. The gene was inserted into the expression vector pET23a-N-His to construct the recombinant expression plasmid pET23a-rCK1.

[0036] Example 2: Expression and purification of recombinant CK1 protein

[0037] 1. Experimental Methods

[0038] (1) Transformation of E. coli cells: After thawing 100 μl of competent cells on ice, add recombinant plasmid DNA and mix gently. Incubate on ice for 30 min, then heat shock at 42°C for 90 sec, and then continue to incubate on ice for 1-2 min. Add 500 μl of fresh antibiotic-free LB medium in a clean bench and incubate at 37°C on a shaker for 45 min. Then, take an appropriate amount of bacterial culture and spread it evenly on an antibiotic-containing plate. Invert the culture dish and incubate overnight in a 37°C incubator.

[0039] (2) Cell lysis: Single clones were picked and cultured in fresh culture medium at 37°C and 200 rpm until the OD value reached 0.4–0.6. IPTG (final concentration 1 mM) was then added for induction culture for 7 hours. The cells were collected by centrifugation, resuspended in lysis buffer, sonicated for 20 min, and then centrifuged at 12000 rpm for 20 min at 4°C. The supernatant was collected. A small amount of supernatant protein was used for Western blotting with anti-His antibody. (See...) Figure 1 .

[0040] (3) Nickel affinity chromatography purification: The nickel column was equilibrated with buffer. The supernatant was filtered through a 0.45 μm filter membrane, loaded onto the column, and collected. Unbound proteins were washed with buffer to remove them. Finally, the column was eluted with elution buffer containing different concentrations of imidazole. The collected proteins were combined, and 10% glycerol was added. The purified recombinant CK1 protein was identified by SDS-PAGE electrophoresis. See [link to SDS-PAGE]. Figure 2 .

[0041] 2. Experimental Results

[0042] (1) By Figure 1 The results showed that the lysates of E. coli cells transfected with the pET23a-rCK1 plasmid were divided into lane R with a distinct specific band at 40 kDa, while the control lysates transfected with the empty vector did not show a band of the corresponding size in lane 1. This indicates that the cells specifically expressed the recombinant CK1 protein.

[0043] (2) By Figure 2 The results showed that the purified protein had a distinct specific band at 40kD on the SDS-PAGE gel image, indicating that the recombinant CK1 protein with good purity had been obtained.

[0044] Example 3: Preparation and screening of monoclonal antibodies OTI6A3 and OTI2C2

[0045] The recombinant CK1 protein obtained in Example 2 and the synthesized CK14 polypeptide were used to immunize BALB / c mice (Beijing Vital River Laboratory Animal Technology Co., Ltd.). The specific method is as follows:

[0046] (1) Animal immunization: The purified CK1 and CK14 antigens were emulsified with complete Freund's adjuvant and immunized 6-8 week old BALB / c mice by subcutaneous or intraperitoneal injection. The immunization dose of CK1 protein was 60 μg / mouse and the dose of CK14 peptide was 300 μg / mouse. Two weeks later, a second immunization was performed with incomplete Freund's adjuvant emulsification. The immunization dose of CK1 was 30 μg / mouse and the dose of CK14 was 150 μg / mouse. After three immunizations, tail blood was collected and serum titers were determined by serial dilution using ELISA. Based on the results, it was determined whether to perform booster immunization. Mice with the highest antibody titers were selected for cell fusion.

[0047] (2) Cell fusion: Myeloma cells were sp2 / 0 derived from BALB / c and were in the logarithmic growth phase at the time of fusion. Spleens of immunized mice were taken and lymphocyte single-cell suspensions were prepared. Mouse spleen lymphocytes and myeloma cells were mixed at a ratio of 1:5 to 1:10. 1 mL of 50% PEG (pH 8.0) preheated at 37°C was added, along with incomplete culture medium and the remaining stop solution. After centrifugation and discarding the supernatant, HAT culture medium was added to suspend and mix well. The volume was adjusted to 50 mL by MC, dispensed into 3.5 cm culture dishes, placed in a humidified box, and cultured in a 37°C, 5% CO2 incubator.

[0048] (3) Screening and Cloning: Hybridoma cell clones were selected within 7-10 days of fusion and tested using purified recombinant CK1 protein and CK14 peptides via ELISA. Cell line numbers were labeled. Positive wells were subjected to limiting dilutions, with ELISA values ​​measured 5-6 days after each dilution. Wells with high OD280 positive values ​​were selected for further limiting dilutions until the entire 96-well plate showed a positive ELISA result. High-positive-value clones were then selected for further identification. The CK1-corresponding fusion plate cell line was OTI6A3, and the CK14-corresponding fusion plate cell line was OTI2C2.

[0049] (4) Preparation and purification of monoclonal antibodies on cells: Hybridoma cell lines OTI6A3 and OTI2C2 were cultured in 10cm culture dishes in DMEM medium containing 15% serum and expanded to approximately 4×10⁻⁶ cells / year. 7 Centrifuge at 800 rpm for 5 min, discard the supernatant and transfer the cells to a 2 L roller flask. Add serum-free culture medium to bring the cell density to approximately 3 × 10⁶ cells / min. 5 Cells / ml. Continue culturing for 1-2 weeks, until the cell death rate reaches 60%-70% (at which point the cell density is approximately 1-2 × 10⁶ cells / ml). 6Cell suspension was collected (cells / ml), centrifuged at 6000 rpm for 20 min, and the supernatant was collected and purified by affinity chromatography. The appropriate column material was selected according to the antibody subtype (all subtypes were IgG1, purified using Protein G column material). The concentration of the purified monoclonal antibody was determined, lyophilized, and aliquoted (100 μg / tube), and finally stored at -20℃.

[0050] Example 4: Gene and amino acid sequence analysis of the variable region of monoclonal antibodies OTI6A3 and OTI2C2 (purchased from TakaraBio USA) The RACE 5' / 3' kit uses 5'RACE (Rapid Amplification of cDNA Ends) technology to amplify the variable region light and heavy chain gene sequences of hybridoma cell functional antibodies. For detailed experimental procedures, please refer to Takara Bio USA. RACE 5' / 3' Kit User Manual.

[0051] Based on the fact that antibodies OTI6A3 and OTI2C2 are IgG1 subtypes, specific gene primers pRace-H-GSP and pRace-K-GSP targeting the 3' end of their Ig and Kappa constant regions were designed. The primer sequences are as follows:

[0052] pRace-H-GSP:CATCDGTCTATCCACTGGCCCCTG

[0053] pRace-K-GSP:CTTCCCACCATCCAGTGAGCAGTT

[0054] mRNA was extracted from hybridoma cells OTI6A3 and OTI2C2, and reverse transcribed into cDNA. DNA fragments of the antibody heavy and light chains were amplified using RACE. The amplified light and heavy chains were ligated into the cloning vector PUC119 by enzyme digestion. Positive clones were selected using blue-white screening, and the positive plasmids were purified and sequenced using an ABI 3730 sequencer with universal primers M13f and M13r.

[0055] Using the internet and the IMGT / V-QUEST analysis software at http: / / www.imgt.org, the nucleotide sequences of the light and heavy chains were sequenced and analyzed. The amino acid sequence of the light chain of the monoclonal antibody OTI6A3 is shown in SEQ ID NO.5, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.9. The total length of the variable region of the light chain is 110 amino acids. The number of amino acids in the four domains of the FR are 26, 17, 36, and 11, respectively, and the number of amino acids in the three domains of the CDR are 11, 3, and 6, respectively. The regions of CDR1, CDR2, and CDR3 are 27aa-37aa, 55aa-57aa, and 94aa-99aa, respectively, and their amino acid sequences are KSLLHSNGNTY, GMS, and MQHLEY, respectively. Analysis revealed that the full-length variable region of the heavy chain of the monoclonal antibody OTI6A3 is 113 amino acids. The four domains of its FR (freezing chain) have amino acid numbers of 25, 17, 38, and 11, respectively; the three domains of its CDR (crystal retrieval chain) have amino acid numbers of 8, 8, and 6, respectively; and CDR1, CDR2, and CDR3 have amino acid sequences of 26-33 aa, 51-58 aa, and 97-102 aa, respectively. Their amino acid sequences are GYTFTSYW, IDPYDSVS, and ARGDYD, respectively. The OTI2C2 sequence was analyzed using the same method; its light chain amino acid sequence is shown in SEQ ID NO. 13, and its heavy chain amino acid sequence is shown in SEQ ID NO. 17. The light chain variable region is 109 amino acids long. Its four FR domains have 26, 17, 36, and 11 amino acids respectively, and its three CDR domains have 11, 3, and 5 amino acids respectively. The regions of CDR1, CDR2, and CDR3 are 27aa-37aa, 55aa-57aa, and 94aa-98aa respectively, with amino acid sequences of QSLVHSNGNTY, MVS, and SQNTH respectively. The heavy chain variable region is 113 amino acids long. Its four FR domains have 25, 17, 38, and 11 amino acids respectively, and its three CDR domains have 8, 8, and 6 amino acids respectively. CDR1, CDR2, and CDR3 are 26aa-33aa, 51aa-58aa, and 97aa-102aa respectively, with amino acid sequences of GFTFSDYG, ISNLGYFT, and AREGEG respectively.

[0056] Example 5: Immunohistochemical detection using cocktail antibodies OTI6A3 & OTI2C2 as primary antibodies

[0057] 1. Experimental Methods:

[0058] (1) Formalin-fixed liver, prostate, esophageal and breast ductal carcinoma tissue blocks were embedded in paraffin and sectioned using a Leica tissue slicer with a tissue thickness of 4 μm.

[0059] (2) Dewaxing and hydration: analytical grade xylene for 10 min × 3 times, anhydrous ethanol for 1 min × 3 times, 95% ethanol for 1 min, 85% ethanol for 1 min, 75% ethanol for 1 min, and deionized water for 2 min × 3 times.

[0060] (3) Antigen retrieval: Add antigen retrieval solution [1mM EDTA, 10mM Tris buffer (pH 8.0)] and pressure cook for 3 minutes. When the pressure cooker temperature drops to about 90℃, open the pressure cooker, remove the slices, and then allow them to cool naturally to room temperature. Soak in deionized water for 2 minutes × 3 times.

[0061] (4) Inactivation: Use 3% hydrogen peroxide to inactivate endogenous peroxidase in tissues, let stand at room temperature for 15 min, and soak in deionized water for 2 min × 3 times.

[0062] (5) Draw a border around the tissue with an immunohistochemical pen, and wash with 0.1% PBST for 2 min × 1 time.

[0063] (6) Incubation with primary antibody: Monoclonal 34βE12 (0.55ug / ml) was used as the control group, and the cocktail antibody OTI6A3 & OTI2C2 (0.72ug / ml) prepared in this invention with two clone ratios was used as the experimental group. 200μl of the control group antibody and 200μl of the experimental group antibody were added to two sections of each test tissue and placed in a humidified chamber for incubation at 37℃ for 60min. Washed with 0.1% PBST for 2min × 3 times.

[0064] (7) Incubation with secondary antibody: Add 100 μl of secondary antibody PV-8000 and incubate at 37℃ for 30 min. Wash with 0.1% PBST for 2 min × 3 times.

[0065] (8) DAB color development: Add 120 μl of DAB color development solution, let stand at room temperature for 5 min, rinse with tap water to stop the color development, and rinse 3 times with tap water.

[0066] (9) Hematoxylin counterstaining, differentiation, and blueing: Let the stain stand in the hematoxylin solution for 10-120 seconds, rinse three times with tap water to stop the color development, differentiate in 1% hydrochloric acid-ethanol solution, rinse three times with tap water to stop the differentiation, then place in freshly boiled pH 8.0 Tris-EDTA disodium solution for blueing, and then place in room temperature pH 9.0 Tris-EDTA disodium solution for a few seconds, rinsing three times with tap water. Observe the staining under a microscope. If normal, the process is complete and the hematoxylin staining solution is recovered; if differentiation is excessive, the above steps must be repeated until the staining is satisfactory.

[0067] (10) Dehydration and clearing: 75% ethanol for 1 min, 85% ethanol for 1 min, 95% ethanol for 1 min, 100% ethanol for 1 min × 3 times, xylene for 1 min × 3 times, and neutral resin for mounting.

[0068] (11) Microscopic examination, such as Figure 3 As shown.

[0069] 2. Experimental Results:

[0070] The widely used monoclonal 34βE12 and the cocktail antibodies OTI6A3 & OTI2C2 described in this invention were used to detect the location and expression of CK-HMW in liver, prostate, and esophagus tissues by IHC method. The results are as follows:

[0071] (1) Figure 3 The images show the staining results of two groups of antibodies on liver tissue. The left image shows the results of the control group 34βE12, which shows that hepatocytes did not show brownish-yellow staining and were negatively expressed, but the bile ducts showed a brownish-yellow positive signal, consistent with the results of NordiQC. This indicates that the clone showed non-specific staining on liver bile duct cells and had a cross-reaction with CK19. The right image shows the staining results of the cocktail antibodies OTI6A3 & OTI2C2 described in this invention. Both hepatocytes and bile duct cells were negative, with no non-specific staining and no cross-reaction with CK19.

[0072] (2) Figure 4 The images show the staining results of the two antibody groups in prostate tissue. The left image shows the results of the control group 34βE12, and the right image shows the staining results of the cocktail antibodies OTI6A3 & OTI2C2 described in this invention. The expression patterns of the two antibody groups are consistent, both showing positive expression in the basal cells of the prostate and negative expression in the glandular epithelium of the prostate, which is consistent with the CK-HMW staining pattern. However, in terms of staining intensity, the cocktail antibody described in this invention is significantly stronger than the control group.

[0073] (3) Figure 5 The images show the staining results of the two antibody groups in esophageal tissue. The left image shows the results of the control group 34βE12, and the right image shows the staining results of the cocktail antibodies OTI6A3 & OTI2C2 described in this invention. The results show that both antibody groups stained well in the squamous epithelium of the esophagus, while other stromal cells were not stained, which is consistent with the CK-HMW staining pattern.

[0074] (4) Figure 6The images show the staining results of two antibody groups in breast ductal carcinoma tissue. The left image shows the results of the control group 34βE12. The staining results show that myoepithelial cells and tumor cells are positive, while other stromal cells are negative, consistent with the NordiQC (38 rounds, www.nordiqc.org) test results. The analysis suggests this is due to cross-linking with low molecular weight keratin. The right image shows the staining results of the cocktail antibodies OTI6A3 & OTI2C2 described in this invention. The staining results show that only myoepithelial cells are brownish-yellow, indicating positive expression. Tumor cells and other stromal cells are not stained, showing negative expression, consistent with the theoretical staining pattern of CK-HMW. This indicates that the cocktail antibodies OTI6A3 & OTI2C2 described in this invention have better specificity than 34βE12.

[0075] The above results indicate that the cocktail antibodies OTI6A3 & OTI2C2 described in this invention have higher specificity than 34βE12: they exhibit excellent staining in basal cells of the prostate and squamous epithelium of the esophagus, and show no non-specific staining in bile duct epithelium of the liver and tumor cells of breast ductal carcinoma. This is mainly because, during antigen design, sequence alignment analysis of different keratin sequences was performed, regions with high homology to keratin sequences such as CK19 were avoided when selecting antigens for immunization animals, and clones with cross-linking with CK19 protein were removed during clone selection. Furthermore, the cocktail antibodies OTI6A3 & OTI2C2 of this invention show superior staining performance compared to 34βE12 at a total concentration of 0.72 μg / ml, and their sensitivity meets the requirements for pathological diagnosis. This cocktail antibody can completely replace the 34βE12 clone for the diagnosis of CK-HMW-related diseases.

[0076] The above specific embodiments are used to explain and illustrate the present invention, and are only preferred embodiments of the present invention, and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made to the present invention within the spirit and principles of the present invention shall fall within the protection scope of the present invention.

[0077]

[0078]

Claims

1. Two hybridoma cell lines, characterized in that, The two hybridoma cell lines were named OTI6A3 and OTI2C2, respectively, and were deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession numbers CGMCC No. 45715 and CGMCC No. 45712.

2. An anti-human CK-HMW cocktail antibody, characterized in that, It is prepared by mixing two monoclonal antibodies, OTI6A3 and OTI2C2, secreted by the two hybridoma cell lines OTI6A3 and OTI2C2 as described in claim 1.

3. The use of the anti-human CK-HMW cocktail antibody according to claim 2 in the preparation of an immunoassay tool for detecting CK-HMW protein.

4. The application according to claim 3, characterized in that, The immunoassay tool is a reagent kit, chip, or test strip.

5. The use of the anti-human CK-HMW cocktail antibody according to claim 2 in the preparation of a kit for labeling CK-HMW protein in normal or tumor tissues.

6. The application according to claim 5, characterized in that, The normal or tumor tissues include liver, prostate, esophageal, and breast ductal carcinoma tissues.

7. An immunohistochemical detection kit for detecting CK-HMW protein, characterized in that, Including the anti-human CK-HMW cocktail antibody as described in claim 2.

Images