Olefin reductase mutant and its application

Abstract

The present invention provides an alkene reductase mutant and its application, belonging to the technical field of extraction and preparation of biologically active ingredients. The mutant is obtained by performing site-directed mutation on at least one of G77, Y99 and A285 of the wild-type alkene reductase with an amino acid sequence as shown in SEQ ID No. 1; preferably, the mutations are G77I, Y99L and A285F. The mutant enzyme is overexpressed and used for catalytic reaction, and compound II is used as a substrate to obtain compound I, and the product purity is greater than 99%, which has good industrial application prospects.

Description

Technical Field

[0001] The invention relates to the technical field of extraction and preparation of biologically active ingredients, in particular to an ene reductase mutant and application thereof. Background Art

[0002] Compound I is an active ingredient from pepper, which has the effects of promoting cell membrane fluidity, anticonvulsant, analgesia, etc. Compound I promotes the absorption and utilization of some effective active ingredients by skin tissue by increasing the fluidity of lipid bilayer and increasing the affinity of drug molecules or nutrients with cell membranes, and is a safe penetration enhancer. However, its yield in pepper is low and its extraction is difficult.

[0003] At present, the preparation of compound I mainly relies on the chemical method to hydrogenate compound II, but the chemical method mainly uses transition metals as catalysts to achieve the selective hydrogenation reaction of the carbon-carbon double bond of α,β-unsaturated carbonyl groups, which has the problems of high cost, unsatisfactory reaction yield and selectivity, the need to use hydrogen gas with potential safety hazards as a hydrogen source, harsh reaction conditions and environmental pollution.

[0004] The molecular formulas of compound I and compound II are as follows:

[0005]

[0006] In the prior art, a variety of ene reductases that can specifically reduce the carbon-carbon double bonds of α,β-unsaturated carbonyls have been reported. Such enzymes can use NAD(P)H as a cofactor to provide reducing power. Such as medium-chain dehydrogenases / reductases and old yellow enzymes. However, there are currently few reports on ene reductases that can reduce compound II, and more ene reductases need to be developed for the biosynthesis of compound II. Summary of the invention

[0007] In view of the above problems existing in the prior art, the present invention provides an alkene reductase mutant and its application. The mutant can efficiently catalyze the reduction of compound II to generate compound I. The present invention also provides a biosynthetic method of compound I, which has good industrial application prospects.

[0008] The technical solution of the present invention is as follows:

[0009] An olefin reductase mutant is obtained by performing site-directed mutagenesis on at least one of G77, Y99 and A285 of the wild-type olefin reductase with the amino acid sequence shown in SEQ ID No. 1.

[0010] Preferably, the mutations are G77I, Y99L and A285F.

[0011] Furthermore, the encoding gene of the mutant is a DNA sequence as shown in SEQ ID No.2.

[0012] The present invention also provides the use of the olefin reductase mutant, that is, the olefin reductase mutant can catalyze compound II to generate compound I; wherein the molecular formulas of compound I and compound II are as follows:

[0013]

[0014]

[0015] Furthermore, the catalytic process comprises the following steps:

[0016] S1. constructing a recombinant engineering bacterium expressing the olefin reductase mutant;

[0017] S2, cultivation of recombinant engineering bacteria containing olefin reductase mutants;

[0018] S3. Using compound II as a substrate, the olefin reductase mutant catalyzes compound II to obtain compound I.

[0019] Preferably, the olefin reductase mutant added in step S3 includes a purified enzyme, a crude enzyme solution containing the olefin reductase mutant, or a recombinant engineered bacterium expressing the olefin reductase mutant.

[0020] Preferably, in the catalytic reaction described in step S3, the amount of the olefin reductase mutant is 5-50 g / L wet bacteria, the amount of compound II is 1-40 g / L, the amount of Tween 80 is 1-35 g / L, and the amount of glucose is 5-30 g / L.

[0021] Preferably, the catalytic reaction in step S3 uses phosphate buffer as the system solution, the pH is 6.0-8.0, the reaction temperature is 25-40° C., and the reaction time is 1-72 h.

[0022] Preferably, the host cell of the recombinant genetically engineered bacteria is Escherichia coli.

[0023] The beneficial technical effects of the present invention are:

[0024] The invention discloses a mutant of olefin reductase and its application, wherein the mutant can catalyze compound II to generate compound I, and the product purity is greater than 99%. The problem of high cost and low yield of chemical catalysis is solved, and the foundation for the industrial production of compound I is laid. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 is the HPLC chromatogram of compound 1;

[0026] Figure 2 is the HPLC chromatogram of compound II;

[0027] Figure 3 It is the HPLC chromatogram of the reaction sample of compound II catalyzed by wild-type CurA;

[0028] Figure 4 The molecular docking simulation results of olefin reductase CurA and compound II;

[0029] Figure 5 Schematic diagram for the construction of CurA mutant library;

[0030] Figure 6 This is the HPLC chromatogram of the reaction sample of compound II catalyzed by CurA mutant. DETAILED DESCRIPTION

[0031] The present invention is described in detail below in conjunction with the accompanying drawings and embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] The formulas of the culture medium and buffer used in the examples are as follows:

[0033] LB medium: yeast powder 5.0 g / L, peptone 10.0 g / L, NaCl 10.0 g / L.

[0034] Fermentation medium: yeast powder 12.0 g / L, peptone 15.0 g / L, Na2HPO4·12H2O 8.9 g / L, KH2PO4 3.4 g / L, (NH4)2SO4 3.3 g / L, MgSO4·7H2O 0.49 g / L, use ammonia water to adjust the pH to 7.0.

[0035] pH 7.0 phosphate buffer solution (200 mM): Na2HPO4·12H2O 67.8 g / L, NaH2PO4·2H2O 0.82 g / L.

[0036] Example 1: Mining of olefin reductase and construction of expression vector

[0037] Five different ene reductases were screened from the NCBI database, and their NCBI accession numbers were NP_415966.6 (CurA), NP_416921.4 (UcpA), NP_388626.1 (YfmJ), NP_390301.1 (YqiG), and NP_012049.1 (OYE2). According to the amino acid sequence of ene reductase, the coding gene was synthesized by Sangon Biotech (Shanghai) Co., Ltd. after codon optimization and cloned into the BamHI and Hind III sites of the expression vector pET28a to obtain the recombinant plasmid. They were named pETcurA, pETucpA, pETyfmJ, pETyqiG, and pETOYE2, respectively.

[0038] The above recombinant plasmids were transformed into Escherichia coli BL21 (DE3) competent cells, and the obtained recombinant genetically engineered bacteria were named ECcurA, ECucpA, ECymfJ, ECyqiG, and ECOYE2, respectively.

[0039] Example 2: Cultivation of genetically engineered bacteria producing olefin reductase

[0040] The recombinant genetically engineered bacteria obtained in Example 1 were activated by streaking on a plate, and a single colony was picked into an LB medium containing 50 μg / mL kanamycin, and cultured to the logarithmic growth phase at 37°C and 200rpm. Then, the inoculum was transferred to the fermentation medium at a 3% inoculation amount. Cultured at 37°C and 200rpm for 3h, and IPTG (isopropyl-β-D-thiogalactoside) was added at a final concentration of 0.4mM. Culture was continued at 28°C and 200rpm for 14h. After the culture was completed, the bacteria were collected by centrifugation at 4°C and 8000rpm, and the precipitate was resuspended in a phosphate buffer solution.

[0041] Example 3: Comparison of the catalytic activity of different olefin reductases on compound II

[0042] The reaction solution was prepared according to the following reaction system: 5 g / L wet cells of genetically engineered bacteria expressing olefin reductase, 1 g / L compound II, 15 g / L Tween 80, 50 mM phosphate buffer (pH 7.0), and 5 g / L glucose. The above 20 mL of the reaction solution was placed in a 50 mL round-bottom flask, stirred magnetically, and reacted in a 30°C water bath for 24 hours. The negative control was E. coli BL21 (DE3) without a plasmid.

[0043] Take 1 mL of catalyzed bacterial solution, add 9 mL of ethyl acetate, vortex extract 3 times, centrifuge at 8000g for 10 min, and combine the organic phases. After the ethyl acetate evaporates completely, add 1 mL of methanol to dissolve all the precipitates, dilute appropriately and perform high performance liquid chromatography (HPLC) analysis.

[0044] Agilent 1200 series high performance liquid chromatography, diode array detector, and Ultimate XB-C18 column, 4.6mm x 250mm were used. The analysis conditions were: phase A was water containing 0.1% phosphoric acid, phase B was acetonitrile, isocratic gradient elution, the ratio of phase A to phase B was 20:80; flow rate was 0.6mL / min, column temperature was maintained at 30°C, and detection wavelength was 286nm.

[0045] Qualitative and quantitative methods: Qualitative analysis is performed based on the retention time and UV absorption spectrum of the standard product; quantitative analysis is performed based on the standard curve of the standard product.

[0046] The HPLC chromatograms of compound I and compound II are as follows: Figure 1 and Figure 2 As shown. After HPLC chromatogram comparison, only the genetically engineered bacteria ECcurA has catalytic activity towards compound II ( Figure 3 ). However, only a small amount of compound I was generated, and in addition, an unknown compound was also generated.

[0047] Example 4: Functional verification and molecular docking simulation of olefin reductase

[0048] The protein structure of E. coli CurA was predicted using the SWISS-MODEL online software (https: / / swissmodel.expasy.org / ) (the amino acid sequence is shown in SEQ ID No. 1 in the sequence table), and the template selected was CurA from Vibriovulnificus (PDB ID: 5ZXU). Molecular docking simulation analysis was performed on E. coli CurA and compound II using the molecular docking simulation software AutoDock. The docking results are shown in Figure 4 As shown. The double bond conjugated to the benzene ring is easy to enter the active center of CurA, while the double bond conjugated to the carbonyl group is difficult to enter the active center of CurA. The unknown compound may be the product with only one double bond reduced, which is consistent with the result that the unknown compound is more than compound I in the HPLC chromatogram. According to the analysis of the structure, it was found that the sites of G77, Y99 and A285 may affect the binding of compound II and CurA.

[0049] Example 5: Construction of a mutant library of olefin reductase CurA

[0050] The construction process of the olefin reductase CurA mutant library is as follows Figure 5As shown, firstly, plasmid pETcurA was amplified with primer pairs F0 / R0, F1 / R1, F2 / R2, and F3 / R3 to obtain different fragments to be fused. The PCR system was: plasmid 10 ng, 10 μM upstream primer 2 μL, 10 μM downstream primer 2 μL, 2×Phanta Flash Master Mix 25 μL, and ddH2O was added to make the total volume 50 μL.

[0051] The PCR program was as follows: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s; annealing at 55°C for 5 s; extension at 72°C for 5 s; and complete extension at 72°C for 1 min. 30 cycles.

[0052] The primer sequences are as follows:

[0053] F0:ACAGCAAATGGGTCGCGGAATGGGGCAACAAAAGCAGCGT

[0054] R0:GCCGACCATCACGCCGCCA

[0055] F1: GGCGGCGTGATGGTCGGCNNKACGGTGAGCCGTGTCGTGGA

[0056] R1: GCCCAGCACCCAGTCGCCAG

[0057] F2: TGGCGACTGGGTGCTGGGCNNKAGTGGATGGCAAGACTATGAC

[0058] R2:GATAATAAAACCTTGCAAGCGA

[0059] F3: CGCTTGCAAGGTTTTATTATCNNKCAGGATTATGGTCACCGCAT

[0060] R3: CTCGAGTGCGGCCGCATTAATCATCACCCGCCACGCG

[0061] After gel recovery and purification, the PCR product was subjected to overlap extension PCR to obtain a curA mutant sequence containing three mutation sites at the same time. After recovery, the PCR product was homologously recombined with the pET28a vector linearized by double restriction digestion with BamH I and Hind III, and the recombinant vector was constructed using the ClonExpress Ultra One Step Cloning Kit of Novozymes. The recombination reaction system was: 150 ng of linearized vector, 100 ng of purified target gene, 5 μL of 2×ClonExpressMix, and ddH2O was added to a total volume of 10 μL.

[0062] The reaction procedure is: keep warm at 50℃ for 15min. The recombinant product was transformed into E.coli BL21(DE3) competent cells by heat shock method, and the transformed bacterial solution was cultured overnight on a solid LB plate containing 50μg / mL kanamycin to obtain a site saturation mutation library.

[0063] Transformants from the site saturation mutation library were selected and inoculated into 96-well culture dishes containing 500 μL LB medium. Kanamycin with a final concentration of 50 ng / mL was added to the medium. After culturing at 37°C for 3 hours, the temperature was lowered to 28°C, and IPTG with a final concentration of 0.4 mM was added. After culturing for 5 hours, compound II with a final concentration of 0.1 g / L was added, and the culture was continued overnight. The absorption peak of the culture solution was detected at 286 nm using an ELISA reader. The positive clones were those with a significant decrease in the absorption peak.

[0064] Example 6: Rescreening of olefin reductase mutants

[0065] The positive clones were screened again according to the methods of Examples 2 and 3, and finally a transformant that can efficiently catalyze compound II to generate compound I was obtained. Figure 6 As shown, HPLC showed a relatively single peak of compound I, with a content of more than 99%. The transformant was selected and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. After sequence comparison, it was found that the mutant contained three mutation sites, namely G77I, Y99L and A285F. The corresponding olefin reductase CurA mutant DNA coding sequence is shown in the sequence table SEQ ID NO.2.

[0066] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and implementation modes, and can be fully applicable to various fields suitable for the present invention. For those familiar with the art, for those of ordinary skill in the art, various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principle and spirit of the present invention. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to specific details.

Claims

1. An alkene reductase mutant, characterized in that The mutant is obtained by performing site-directed mutagenesis on G77, Y99 and A285 of the wild-type olefin reductase whose amino acid sequence is shown in SEQ ID No. 1; the mutations are G77I, Y99L and A285F.

2. The olefin reductase mutant according to claim 1, characterized in that The coding gene of the mutant is a DNA sequence as shown in SEQ ID No.

2.

3. The use of the olefin reductase mutant according to claim 1, characterized in that: The alkene reductase mutant is used to catalyze compound II to generate compound I; wherein the molecular formulas of compound I and compound II are as follows:

4. The use according to claim 3, characterized in that: The catalytic process comprises the following steps: S1. constructing a recombinant engineering bacterium expressing the olefin reductase mutant; S2, cultivation of recombinant engineering bacteria containing olefin reductase mutants; S3. Using compound II as a substrate, the olefin reductase mutant catalyzes compound II to obtain compound I.

5. The use according to claim 4, characterized in that: The olefin reductase mutants in step S3 may be added in the form of purified enzymes, crude enzyme solutions containing olefin reductase mutants, or recombinant engineered bacteria expressing olefin reductase mutants.

6. The use according to claim 4, characterized in that: In the catalytic reaction described in step S3, the amount of the olefin reductase mutant is 5-50 g / L wet bacteria, the amount of compound II is 1-40 g / L, the amount of Tween 80 is 1-35 g / L, and the amount of glucose is 5-30 g / L.

7. The use according to claim 4, characterized in that: The catalytic reaction described in step S3 uses phosphate buffer as the system solution, the pH is 6.0-8.0, the reaction temperature is 25-40° C., and the reaction time is 1-72 h.

Images