Wheat voltage-dependent anion channel protein gene TaVDAC1 and its application

Abstract

The invention belongs to the field of genetic engineering technology and relates to a wheat mitochondrial outer membrane voltage-dependent anion channel protein gene TaVDAC1 The wheat voltage-dependent anion channel protein gene TaVDAC1 , negatively regulating wheat resistance to Fusarium head blight. Wheat voltage-dependent anion channel protein gene TaVDAC1 After overexpression, wheat resistance to Fusarium fusarium is reduced; Silencing or editing wheat voltage-dependent anion channel protein genes TaVDAC1 After the addition of 100 μg / mL of 1 ... TaVDAC1 It can be used for the selection and creation of germplasm resources resistant to wheat fusarium ergot, improve the disease resistance of wheat to fusarium ergot, and solve the technical problems of wheat susceptibility to fusarium ergot and the reliance of wheat fusarium ergot control on chemical control.

Description

Technical Field

[0001] The invention belongs to the field of bioengineering technology and relates to a wheat voltage-dependent anion channel protein gene TaVDAC1 and its applications. Background Art

[0002] Wheat yield and quality are of great significance to food security. Fusarium Graminearum ) and other fungi are one of the three major wheat diseases. With the continuous rise in global temperatures and changes in farming systems, the frequency and severity of fusarium head blight have increased significantly in recent years. On the one hand, fusarium head blight can directly harm wheat ears, causing grains to shrivel and seriously affecting wheat yields; on the other hand, the fungal toxin deoxynivalenol (DON) remaining in the grains can cause excessive mycotoxins in wheat grains.

[0003] At present, chemical control is still the main means of preventing and controlling fusarium head blight and reducing toxin pollution. However, with the frequent use of chemical agents, the resistance of field strains has increased, making the prevention and control of fusarium head blight more and more severe. Disease-resistant breeding is one of the most economical and effective measures to prevent and control wheat fusarium head blight. However, the lack of disease-resistant resources for wheat fusarium head blight, the complex disease resistance mechanism, the long cycle of mining disease-resistant genes and the lack of major disease-resistant genes have slowed the progress of conventional molecular breeding and made it difficult to cultivate disease-resistant varieties. Therefore, how to create broad-spectrum and long-lasting disease-resistant materials is the fundamental way and key technology to prevent and control wheat fusarium head blight. Summary of the invention

[0004] Cultivating resistant varieties is the most direct, effective and economical method for preventing and controlling wheat scab. The purpose of the present invention is to further explore functional genes that regulate wheat scab resistance, take effective measures to expand the application of functional genes in improving wheat scab resistance, and provide new technical ideas for enriching disease-resistant gene resources and molecular-assisted breeding and creating disease-resistant materials.

[0005] Based on the above purpose, the present invention provides a wheat voltage-dependent anion channel protein gene TaVDAC1 The invention and its application are used to meet the need in the art and overcome the technical defects of chemical control and biological control of wheat fusarium head blight.

[0006] On the one hand, the present invention relates to a wheat voltage-dependent anion channel protein gene TaVDAC1 , the wheat voltage-dependent anion channel protein gene TaVDAC1 It plays a negative regulatory role in the defense response of wheat against Fusarium fusarium. The nucleotide sequence is shown in SEQ ID NO: 1.

[0007] Furthermore, the wheat voltage-dependent anion channel protein gene provided by the present invention TaVDAC1 The protein encodes a wheat voltage-dependent anion channel protein, and the amino acid sequence of the wheat voltage-dependent anion channel protein is shown in SEQ ID NO: 2.

[0008] Furthermore, the wheat voltage-dependent anion channel protein gene provided by the present invention TaVDAC1 The nucleotide sequence of the specific silencing fragment is shown in SEQ ID NO:3.

[0009] On the other hand, the present invention relates to a wheat voltage-dependent anion channel protein TaVDAC1. The wheat voltage-dependent anion channel protein is obtained by the wheat voltage-dependent anion channel protein gene TaVDAC1 Encoding, the amino acid sequence is shown in SEQ ID NO:2.

[0010] On the other hand, the present invention relates to a gene silencing or editing vector, wherein the gene silencing or editing vector comprises a gene for silencing or editing the above-mentioned wheat voltage-dependent anion channel protein gene. TaVDAC1 .

[0011] The present invention has been verified by experiments to silence or edit the wheat voltage-dependent anion channel protein gene TaVDAC1 The invention further requests the protection of the wheat voltage-dependent anion channel protein gene. TaVDAC1 , or the above-mentioned wheat voltage-dependent anion channel protein TaVDAC1, or the above-mentioned gene silencing or editing vector, in the breeding of wheat varieties resistant to ergot.

[0012] Furthermore, in the application provided by the present invention, the wheat voltage-dependent anion channel protein gene is silenced. TaVDAC1 , improving wheat's resistance to ergot.

[0013] Furthermore, in the application provided by the present invention, the wheat voltage-dependent anion channel protein gene is modified by gene editing. TaVDAC1 Deficiency, improving wheat's resistance to ergot.

[0014] Compared with the prior art, the technical solution provided by the present invention has the following beneficial effects or advantages:

[0015] The invention provides a wheat voltage-dependent anion channel protein gene having a negative regulatory effect in wheat anti-scab immune response TaVDAC1 The present invention relates to a wheat voltage-dependent anion channel protein gene TaVDAC1 , wheat voltage-dependent anion channel protein gene TaVDAC1Encoded amino acids for silencing wheat voltage-dependent anion channel protein gene TaVDAC1 Sequencing and editing of wheat voltage-dependent anion channel protein genes TaVDAC1 sequence.

[0016] Wheat voltage-dependent anion channel protein gene TaVDAC1 When overexpressed, wheat's resistance to Fusarium spores decreased and obvious susceptibility to disease appeared. RNA interference technology was used to silence the voltage-dependent anion channel protein gene. TaVDAC1 The specific gene fragment (SEQ ID NO: 3) of wheat was reduced, and its expression in wheat was increased to increase wheat resistance to Fusarium. CRISPR-Cas9 gene editing technology was used to edit the wheat voltage-dependent anion channel protein gene. TaVDAC1 Under the premise of increasing the resistance of wheat to Fusarium spores, the wheat voltage-dependent anion channel protein gene TaVDAC1 It can be used for the selection and creation of wheat ergot-resistant germplasm resource materials, solving the technical problems of wheat susceptibility to ergot and wheat ergot control relying on pesticides. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0018] Picture 1 Wheat voltage-dependent anion channel gene TaVDAC1 Gel electrophoresis results. Picture 1 The left side in the middle is the marker band, and the right side is the target gene band.

[0019] Picture 2 Wheat voltage-dependent anion channel gene TaVDAC1 The results of expression level determination of overexpression and silenced strains. Picture 2 Fielder indicates wild-type wheat material; RNAi indicates wheat voltage-dependent anion channel protein gene TaVDAC1 Gene silenced transgenic lines; OE indicates wheat voltage-dependent anion channel protein gene TaVDAC1 Overexpression transgenic lines.

[0020] Picture 3 Wheat voltage-dependent anion channel gene TaVDAC1 Ear inoculation phenotypes of silenced and overexpressing lines. Picture 3Fielder indicates wild-type wheat material; RNAi indicates wheat voltage-dependent anion channel protein gene TaVDAC1 Gene silenced transgenic lines; OE indicates wheat voltage-dependent anion channel protein gene TaVDAC1 Overexpression transgenic lines.

[0021] Picture 4 Wheat voltage-dependent anion channel gene TaVDAC1 Phenotype of the gene-edited strain after ear inoculation. Picture 4 Fielder indicates wild-type wheat material; CR indicates wheat voltage-dependent anion channel protein gene TaVDAC1 Gene-edited strains. DETAILED DESCRIPTION

[0022] The technical solution of the present invention is described below in conjunction with embodiments; however, the present invention is not limited to the following embodiments.

[0023] The experimental methods and detection methods described in the following embodiments are conventional methods unless otherwise specified; the reagents and materials are commercially available unless otherwise specified.

[0024] Example 1

[0025] This example describes the wheat voltage-dependent anion channel protein gene TaVDAC1 Effectors often promote infection by targeting key regulatory factors of host defense. When screening the targets of key effectors in the process of Fusarium infection of wheat, a wheat voltage-dependent anion channel protein gene was found. TaVADC1.

[0026] Obtaining wheat mitochondrial outer membrane voltage-dependent anion channel protein genes based on wheat variety (Fielder) TaVDAC1 . Wheat voltage-dependent anion channel protein gene TaVDAC1 The nucleotide sequence is shown in SEQ ID NO: 1. Wheat voltage-dependent anion channel protein gene TaVDAC1 The amino acid sequence of the encoded protein is shown in SEQ ID NO:2.

[0027] The wheat variety Fielder grown in normal soil was used as the material. The ears were inoculated with Fusarium spores during the flowering period of wheat. Lemma samples were taken 3 days later, total RNA was extracted, and then reversed into cDNA.

[0028] Voltage-dependent anion channel gene in wheat TaVDAC1Specific primers F1 (5'ATGGGCGGCCCAGGCCTC 3') and R1 (5'TCAAGGCTTGAGAGCAA 3') were used for PCR amplification to amplify the gene containing the wheat voltage-dependent anion channel protein. TaVDAC1 Full-length coding sequence.

[0029] The PCR reaction program is: 95℃ pre-denaturation for 5min; 95℃ 30sec, 58.5℃ 40sec, 72℃ 1min, 35 cycles; 72℃ extension for 10min. Store at 4℃. Gel electrophoresis results are as follows Picture 1 As shown, the electrophoresis results were consistent with expectations.

[0030] Wheat voltage-dependent anion channel protein gene obtained by PCR and gel electrophoresis TaVDAC1 cDNA sequence of wheat voltage-dependent anion channel protein gene TaVDAC1 The coding sequence is consistent with that of (as shown in SEQ ID NO: 1), with a total length of 828 bp, encoding 275 amino acids (as shown in SEQ ID NO: 2).

[0031] Example 2

[0032] This example describes the wheat voltage-dependent anion channel protein gene TaVDAC1 Breeding of overexpression transgenic wheat and identification of its disease resistance.

[0033] The target gene was amplified by PCR and the wheat voltage-dependent anion channel protein gene was inserted into the TaVDAC1T The full-length gene was constructed into an overexpression vector to form a TaVDAC1-OE recombinant plasmid. The TaVDAC1-OE recombinant plasmid with correct sequencing was transformed into Agrobacterium, and the wheat voltage-dependent anion channel protein gene was expressed by Agrobacterium infection. TaVDAC1 The overexpression vector was introduced into Fielder callus tissue, and T0 generation transgenic plants were produced after resistance screening.

[0034] The T0 transgenic plants were self-fertilized to produce offspring, and the wheat voltage-dependent anion channel protein gene was selected. TaVDAC1 Overexpression transgenic lines were identified for resistance to Fusarium fusarium. OE plants were cultured in a greenhouse with a 16h / 8h light / dark cycle, and wild-type material Fielder was sown as a control. qRT-PCR test results showed that compared with the wild-type, OE plants had TaVDAC1 The expression level increased significantly (e.g. Picture 2 When the plants grow to the flowering stage, use 2×10 5The spikelets were inoculated with a suspension of Fusarium graminearum spores at a concentration of 100 conidia / mL. After inoculation, the spikelets were kept moisturized in a fresh-keeping bag for 3 days. After 11 days, the disease status of the spikelets was observed. Picture 3 It can be seen that wheat voltage-dependent anion channel protein gene TaVDAC1 When overexpressed, the diseased grains in the inoculated spikelets were significantly more than those in the control group Fielder, and the plants showed more severe fusarium wilt.

[0035] Example 3

[0036] This example describes the wheat voltage-dependent anion channel protein gene TaVDAC1 Breeding of silent transgenic wheat and identification of its disease resistance.

[0037] Through sequence alignment and specificity analysis, target TaVDAC1 The fragment of the conservative region of the gene (the nucleotide sequence is shown in SEQ ID NO:3) was used to construct the wheat voltage-dependent anion channel protein gene TaVDAC1 -RNAi vector. The correctly sequenced recombinant plasmid was transferred into Agrobacterium, and the wheat voltage-dependent anion channel protein gene was transformed into the gene through Agrobacterium-mediated transformation. TaVDAC1 -RNAi vector was introduced into the wheat variety Fielder receptor material to obtain transgenic plants. Select wheat voltage-dependent anion channel protein gene TaVDAC1 The T1 generation of the silenced strain was used to identify the resistance to Fusarium fusarium. The results of qRT-PCR showed that compared with the control group Fielder, the transgenic plants TaVDAC1 The expression level was significantly reduced, indicating that the gene was effectively silenced (e.g. Picture 2 A spike inoculation experiment was performed using a spore suspension of Fusarium graminearum. The phenotype was observed 11 days after inoculation and it was found that the number of diseased grains in the RNAi strain was significantly reduced compared with the wild type (as shown in Figure 2A). Picture 3 The results showed that silencing the wheat voltage-dependent anion channel protein gene TaVDAC1 The wheat scab resistance was significantly increased. This example confirmed that the wheat voltage-dependent anion channel protein gene TaVDAC1 Negative regulation of wheat resistance to Fusarium fusarium.

[0038] Example 4

[0039] This example describes the wheat voltage-dependent anion channel protein gene TaVDAC1 Breeding of gene-edited wheat and identification of its disease resistance.

[0040] Through sequence analysis, we selected and targeted wheat voltage-dependent anion channel protein genes TaVDAC1Two gRNAs in the conserved region (gRNA1 5' GCTGACGATCTTGCAGCACC 3', gRNA2 5' GGAGAGGTTGACTACAGGAT3') were used to construct wheat voltage-dependent anion channel protein using CRISPR-Cas9 gene editing technology. TaVDAC1 Gene editing vector. The correctly sequenced recombinant plasmid was transformed into Agrobacterium, and the wheat voltage-dependent anion channel protein was transformed into TaVDAC1 Gene editing vectors were introduced into the wheat variety Fielder receptor material to obtain T0 generation plants. Wheat voltage-dependent anion channel proteins in wheat chromosomes A, B, and D were selected TaVDAC1 The T1 generation plants that underwent editing were analyzed for resistance to Fusarium graminearum. 14 days after inoculation with Fusarium graminearum, the expression of voltage-dependent anion channel protein in wheat was significantly increased compared with that in wild-type plants. TaVDAC1 The number of diseased grains in the edited mutant plants (CR) was significantly reduced (e.g. Picture 4 These data confirm that wheat voltage-dependent anion channel protein genes TaVDAC1 The absence of can significantly improve wheat resistance to ergot.

[0041] In summary, the present invention successfully cloned the wheat voltage-dependent anion channel protein gene from the cDNA of wheat spike infected by Fusarium spores. TaVDAC1 The full-length open reading frame (nucleotide sequence is shown in SEQ ID NO: 1). The present invention uses RNA interference technology and gene editing technology to prove that the wheat voltage-dependent anion channel protein gene is inhibited or inactivated TaVDAC1 After that, wheat resistance to fusarium head blight increased, that is, wheat voltage-dependent anion channel protein gene TaVDAC1 Negative regulation of wheat fusarium wilt resistance.

[0042] As described above, the basic principle, main features and advantages of the present invention are well described. The above embodiments and descriptions are only descriptions of the preferred embodiments of the present invention, and the present invention is not limited by the above embodiments. Without departing from the spirit and scope of the present invention, various changes and improvements made by ordinary technicians in this field to the technical solution of the present invention should fall within the protection scope determined by the present invention.

Claims

1. Wheat voltage-dependent anion channel protein gene TaVDAC1 The application in breeding wheat varieties resistant to scab is characterized by: The wheat voltage-dependent anion channel protein gene TaVDAC1 Encoding a wheat voltage-dependent anion channel protein TaVDAC1, the amino acid sequence of the wheat voltage-dependent anion channel protein TaVDAC1 is shown in SEQ ID NO: 2; Inhibit or inactivate the wheat voltage-dependent anion channel protein gene TaVDAC1 After that, wheat's resistance to ergot disease increased.

2. The use according to claim 1, characterized in that: The wheat voltage-dependent anion channel protein gene TaVDAC1 The nucleotide sequence is shown in SEQ ID NO:

1.

3. The use according to claim 1, characterized in that: Constructing a gene for silencing or editing the wheat voltage-dependent anion channel protein gene TaVDAC1 Gene silencing or editing vector, inhibiting or inactivating the wheat voltage-dependent anion channel protein gene TaVDAC1 .

4. The use according to claim 3, characterized in that: The gene silencing vector comprises a target gene for the wheat voltage-dependent anion channel protein gene TaVDAC1 A specific fragment of a conserved region, wherein the nucleotide sequence of the conserved region is shown in SEQ ID NO: 3.

Images