An engineered Escherichia coli with improved acid stress resistance and its application

Abstract

The invention discloses a method for directed evolution of bolA and its promoter by error-prone PCR, and belongs to the field of biochemistry and molecular biology. The invention provides four mutant gene sequences of bolA and its promoter obtained by error-prone PCR and their amino acid sequences; through gene knockout and overexpression technology, it is verified that the transcription factor bolA gene can play a role in the acid tolerance of Escherichia coli, and the mutant strain obtained by subsequent screening can improve the acid stress resistance of Escherichia coli. The invention lays a foundation for improving the acid tolerance of engineering strains by means of directed evolution of transcription factors, thereby improving the robustness of industrial microorganisms.

Description

Technical Field

[0001] The invention relates to an Escherichia coli engineering bacterium with improved acid stress resistance and application thereof, and belongs to the field of biochemistry and molecular biology. Background Art

[0002] As an industrial microorganism commonly used in the bio-fermentation industry, Escherichia coli faces challenges such as high temperature, acid / base, and osmotic pressure during the production of metabolites. The acid stress faced during the production of organic acids will seriously affect the growth of microorganisms and reduce production efficiency. Although the acidic environment of the fermentation broth can be improved by adding neutralizers to the fermentation process, this may lead to changes in the osmotic pressure inside and outside the Escherichia coli cells, increase downstream process costs, and generate a large amount of wastewater. Therefore, it is more economical and practical to use acid-resistant strains in the bio-fermentation process.

[0003] At present, there are several methods for improving the acid resistance of E. coli, including metabolic pathway modification, artificial mutagenesis, global transcription factor engineering, and directed evolution. As a regulatory factor that changes the metabolic pathways of complex microorganisms, transcription factors have the unique advantage of multi-site regulation in gene regulation at the transcriptional level, making up for the defects of the role of a single key gene. Compared with natural evolution, directed evolution has the advantage of being able to screen and obtain the target phenotype in a short time.

[0004] Common methods of directed evolution include gene shuffling, error-prone PCR (ep-PCR), site-directed mutagenesis or site-directed saturation mutagenesis, etc. Among them, the directed evolution of ep-PCR for transcription factors is widely used in the study of Escherichia coli acid resistance, osmotic stress, high temperature, etc. As a representative chassis microorganism, the gene cloning and expression system of Escherichia coli has the advantages of short growth cycle, stable genetic performance, simple operation method, and perfect expression system. The transformation of its excellent traits can better meet the needs of industrial production.

[0005] Prior art CN112442471B discloses that the lactic acid stress resistance of Escherichia coli engineering bacteria is improved by expressing dTDP-glucose pyrophosphorylase 2RffH and / or encoding dTDP-glucose 4,6-dehydratase RffG in Escherichia coli; CN112391330A discloses that the resistance to succinic acid (only 1.4% survived at pH 4.3 for 2h) and itaconic acid is improved by expressing trehalose 6-phosphohydrolase TreC in Escherichia coli. The prior art methods for improving acid tolerance all require the use of exogenous genes expressing other enzymes, and the tolerance to acid is still poor.

[0006] Therefore, screening out Escherichia coli with strong acid resistance is an urgent problem that needs to be solved, and it has extremely high economic and practical value. Summary of the invention

[0007] In view of the above problems, the present invention overexpresses the morphological gene bolA of Escherichia coli itself to construct an Escherichia coli engineered bacterium, thereby improving the acid stress resistance. On this basis, the present invention performs error-prone PCR random mutation on the morphological gene bolA, thereby further improving the acid stress resistance of the Escherichia coli engineered bacterium, and having a strong tolerance to HCl, succinic acid and citric acid.

[0008] The first object of the present invention is to provide an engineered Escherichia coli with improved acid stress resistance, wherein the engineered Escherichia coli overexpresses the morphological gene protein BolA.

[0009] In one embodiment, the amino acid sequence of the morphogen protein BolA is shown in SEQ ID NOs. 1-5.

[0010] In one embodiment, the promoter nucleotide sequence of the morphogen protein BolA is shown as SEQ ID NOs. 6-10.

[0011] In one embodiment, the nucleotide sequence of the morphogen protein BolA is shown in SEQ ID NOs.11-15.

[0012] In one embodiment, the Escherichia coli engineered bacteria uses pUC19, pET-28a(+), or pCDFDuet-1 as overexpression vectors. Optionally, the Escherichia coli engineered bacteria uses pUC19 as an overexpression vector.

[0013] In one embodiment, the host Escherichia coli includes E. coli MG1655, E. coli BL21, E. coli JM109, and optionally the E. coli is E. coli MG1655.

[0014] The second object of the present invention is to provide a method for constructing any of the above-mentioned Escherichia coli engineered bacteria, the method comprising: removing the promoter in the plasmid, connecting the morphological gene bolA to the plasmid, adding the terminator rrnBT1T2, and transferring the plasmid into Escherichia coli; wherein the nucleotide sequence of the terminator rrnBT1T2 is shown in SEQ ID NO.16.

[0015] In one embodiment, the method is: removing the lac promoter in the plasmid pUC19, inserting a promoter with nucleotide sequences as shown in SEQ ID NOs. 6 to 10, and inserting the rrnbT1T2 terminator from the genome of Escherichia coli MG1655, connecting the morphological gene bolA to the plasmid pUCX-Ter, and transferring the plasmid into Escherichia coli.

[0016] In one embodiment, the nucleotide sequence of the morphological gene bolA is shown as SEQ ID NOs.11-15.

[0017] In one embodiment, a plasmid overexpressing the bolA gene on the Escherichia coli genome is directed to evolve by an error-prone PCR method to screen out excellent strains E.coil-5-21-5, E.coil-6-9-10, E.coil-6-9-15, and E.coil-6-15-25.

[0018] In one embodiment, based on conventional PCR, the Mg in the reaction system is changed. 2+ , Mn 2+ The average mutation rate of bases was controlled at 0.3-0.6% under the conditions of 5 and 0.2 mM and through two rounds of PCR reaction and changing the annealing temperature in the PCR program.

[0019] In one embodiment, the ability to resist acid stress includes a maximum increase of 18.87% in biomass under pH 4.5 succinic acid acidification conditions, a maximum increase of 24.89% in biomass under pH 4.5 citric acid acidification conditions, and a maximum increase of 29.01% in biomass under pH 4.5 HCl acidification conditions.

[0020] In one embodiment, the ability to resist acid stress includes observing the cell morphological changes of cells under moderately acidic conditions (pH 5.0) through transmission electron microscopy (TEM), and finding that the mutant strains obtained by screening have a significant reduction in cell length compared with WT and bolA+ strains. The lengths of E.coil-5-21-5, E.coil-6-9-10, and E.coil-6-9-15 strains are reduced by 26.14%, 35.06%, and 28.32%, respectively, compared with WT. The cells tend to transform into shorter rods, thereby enhancing the aggregation ability of the cells in adverse environments.

[0021] The third object of the present invention is to provide the use of morphogen protein BolA in improving the acid stress resistance of Escherichia coli.

[0022] The present invention also provides the use of any of the above-mentioned Escherichia coli engineering bacteria in the preparation of organic acids.

[0023] In one embodiment, the organic acid comprises: succinic acid, citric acid, acetic acid, lactic acid, formic acid.

[0024] Beneficial Effects

[0025] The present invention uses the overexpression of the morphological gene bolA of Escherichia coli itself to construct an Escherichia coli engineered bacterium, which improves the acid stress resistance; and on this basis, the present invention performs error-prone PCR random mutation on the morphological gene bolA, further improving the acid stress resistance of the Escherichia coli engineered bacterium, and having a strong tolerance to HCl, succinic acid and citric acid. Specifically:

[0026] (1) Under different pH conditions, the E. coli-MG1655-bolA+ strain overexpressing the bolA gene has a significant advantage in biofilm formation ability compared to the E. coli MG1655 strain and the bolA-deficient strain E. coli-MG1655-ΔbolA. It is 2.08 times that of E. coli MG1655 at pH 4.5, 2.27 times that of E. coli MG1655 at pH 5.0, and 6.31 times that of E. coli MG1655 at pH 7.0. Under extremely acidic conditions (pH 2.5), the survival ability of the E. coli-MG1655-bolA+ strain is 100 times higher than that of the E. coli MG1655 strain.

[0027] (2) Based on the potential acid resistance of the bolA gene, the bolA gene including the promoter was subjected to error-prone PCR directed evolution screening to obtain the mutant strain E. coli-5-21-5. The biomass was increased by 18.88% compared with the control strain WT under the condition of succinic acid acidification to 5.0. The biomass of the four mutant strains increased by 11.35-16.81% under the condition of succinic acid acidification to 4.5. Under the condition of citric acid acidification, the biomass of the mutant E. coli-5-21-5 with the highest biomass increased by 24.89%. In the medium acidified with HCl, the biomass of the mutant E. coli-6-15-25 with the highest biomass increased by 29.01%.

[0028] (3) The morphological changes of cells under moderately acidic conditions (pH 5.0) were observed by transmission electron microscopy (TEM). It was found that the mutant strains screened had a significant reduction in cell length compared with the WT and bolA+ strains. The lengths of the mutants E. coli-5-21-5, E. coli-6-9-10, and E. coli-6-9-15 were reduced by 26.14%, 35.06%, and 28.32% compared with the WT, respectively. The cells tended to transform into shorter rods, enhancing the aggregation ability of cells in adverse environments.

[0029] (4) The extracellular polymers (EPS) were extracted and the biofilm components were analyzed. It was found that compared with the WT strain, the EPS of the mutant strains E.coil-5-21-5, E.coil-6-9-10, E.coil-6-9-15, and E.coil-6-15-25 contained more protein, which was increased by 19.56%, 24.45%, 20.59%, and 19.30%, respectively, compared with the WT. The protein to polysaccharide content ratios of the EPS produced by the four mutant strains were 1.72, 1.98, 2.02, and 1.33 times that of the control group WT, respectively. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Flow chart for constructing the defective strain of Example 1.

[0031] Figure 2 The nucleic acid electrophoresis diagram of the defective strain colony PCR in Example 1; wherein, M: DNA Marker 5000; 1-9: single colony PCR electrophoresis diagram.

[0032] Figure 3 The vector map for constructing the overexpression strain in Example 1.

[0033] Figure 4 The PCR nucleic acid electrophoresis diagram of the recombinant strain vector transformation fragment and the colony PCR nucleic acid electrophoresis diagram of Example 1; wherein, M: DNA Marker 5000; 1-10: single colony PCR electrophoresis diagram.

[0034] Figure 5 The biofilm forming ability of the three bacterial strains MG1655, ΔbolA, and bolA+ in Example 2 after crystal violet staining; wherein MG: Escherichia coli MG1655.

[0035] Figure 6 The cell viability of the three bacterial strains MG1655, ΔbolA, and bolA+ under extremely acidic conditions (pH 2.5) in Example 2; wherein MG: Escherichia coli MG1655.

[0036] Figure 7 These are the error-prone PCR exploratory conditions of Example 3.

[0037] Figure 8The figures are the growth curves of the four mutant strains of Example 4 and WT and bolA+ under different pH conditions; wherein, (A) is the growth curve when acidified with succinic acid to pH 4.5; (B) is the growth curve when acidified with citric acid to pH 4.5; (C) is the growth curve when acidified with HCl to pH 4.5; (D) is the growth curve when acidified with succinic acid to pH 5.0; (E) is the growth curve when acidified with pH 7.0; WT: MG1655 expresses the blank vector pUCX-Ter without the bolA gene.

[0038] Fig. 9 This is a morphological structure diagram of bacteria observed by TEM under the condition of succinic acid acidified to pH 5.0 in Example 5.

[0039] Fig.10 This is a diagram showing the content and proportion of protein and polysaccharide, the main components of the extracellular polymer (EPS) in Example 6. DETAILED DESCRIPTION

[0040] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0041] The culture medium involved in the following examples is as follows:

[0042] LB medium: yeast extract 5 g L -1 , Peptone 10 g·L -1 、NaCl 10g·L -1 ; Add 2% w / v agar to the culture medium to prepare LB solid medium.

[0043] M9 liquid medium: Na 2 HPO 4 6.78 g·L -1 , KH 2 PO 4 3g·L -1 、NaCl 0.5g·L -1 NH 4 Cl 1g·L -1 , glucose 4g·L -1 MgSO 4 0.24 g L -1 , CaCl 2 0.011g·L -1 .

[0044] Example 1: Construction of bolA-deficient strain ΔbolA and vector-overexpressing Escherichia coli bolA+ based on CRISPR / Cas 9 system

[0045] 1. Construction of defective strain ΔbolA: The construction process is as follows Figure 1 The specific steps are as follows:

[0046] (1) Transfer of pCas plasmid:

[0047] Prepare E.coliMG1655 transfection competent cells according to the instructions of the Super Competent Cell Preparation Kit (Shanghai Bioengineering; B529303-0200). Thaw the competent cells on ice, add 2 μL of pCas plasmid, then heat shock in a metal bath at 42°C for 90s, and immediately place on ice for 2 minutes. After the ice bath, add 900 μL of liquid LB medium for recovery culture, the recovery conditions are 30°C, 200 rpm, and time 1h. After the recovery, plate the plate, pick the single clone grown on the plate for culture and extract the plasmid to verify whether the transformation is successful, and obtain the E. coli strain E.coliMG1655-pCas.

[0048] (2) Construction of plasmid pTargetF-sgRNA for knocking out target gene:

[0049] Design the N20 target sequence corresponding to the target gene sgRNA. The targeting sequence of sgRNA is ATGCAGAGCCAGCGCATGAA. Use primers N20-F and N20-R to perform whole plasmid mutation PCR on pTargetF to integrate the targeting sequence into the plasmid pTargetF, and construct the knockout plasmid pTargetF-sgRNA.

[0050] The primer sequences are as follows:

[0051] N20-F:

[0052] ATGCAGAGCCAGCGCATGAA GTTTAGAGCTAGAAATAGCAAGTT ;

[0053] N20-R:

[0054] TTCATGCGCTGGCTCTGCAT ACTAGTATTATACCTAGGACTGAGC .

[0055] (3) Preparation of homology arms:

[0056] Primers homo-bolA-F1, homo-bolA-R1, homo-bolA-F2, homo-bolA-R2 were used to amplify 500 bp of the upstream and downstream homologous arms of the bolA gene of E. coli MG1655, respectively. After verification by nucleic acid electrophoresis, the fragments were recovered by column purification. Finally, primers homo-bolA-F1 and homo-bolA-R2 were used, and a mixture of the upstream homologous arm and the downstream homologous arm of the gene bolA was used as a template, with a mixing ratio of 1:1 and a concentration of 100 ng; overlap extension PCR was performed to obtain a homologous arm fragment (repair template) of the knockout bolA gene, and its sequence is shown in SEQ ID NO.17.

[0057] The primer sequences involved are as follows:

[0058] homo-bolA-F1:GATTATCGCGGGTGACTTTTGCCAGCGC;

[0059] homo-bolA-R1:CAAATGCGTTTTGAAATATCTCCTCCG;

[0060] homo-bolA-F2:GAGGAGATATTTCAAACGCATTTGCAAC;

[0061] homo-bolA-R2: TATTCATTGGCACTTTGCCTTTGC.

[0062] (4) Construction of defective strains

[0063] Using the electroporation transformation method, the plasmid pTargetF-sgRNA obtained in step (2) and the homology arm fragment (nucleotide sequence such as SEQ ID NO.17) obtained in step (3) are respectively transferred into the strain E. coli MG1655-pCas prepared in step (1); transformants are selected and identified to obtain a bolA-deficient strain;

[0064] (5) Colony PCR verification: The bolA-deficient strain obtained in step (4) was subjected to colony PCR, and the primers used were homo-bolA-F1 and homo-bolA-R2 as described above.

[0065] Positive transformants were obtained by nucleic acid electrophoresis. Figure 2 As shown, except for lanes 7 and 8, all others were in line with the expected size; the positive transformants were selected and sent to a sequencing company for sequencing. The results showed that the strain was successfully constructed and a defective strain was obtained, which was named E. coli-MG1655-ΔbolA.

[0066] 2. Construction of vector for E. coli overexpression strain E. coli-MG1655-bolA+: The recombinant vector map is as follows Figure 3 The specific steps are as follows:

[0067] (1) Construction of pUCX-Ter starting vector:

[0068] The high copy vector pUC19 was selected as the original vector, and the primers pUCX-F and pUCX-R were used to remove the vector's own lac promoter region. Primers BamH-Ter-F and BamH-Ter-R were used to amplify the rrnBT1T2 terminator region from the Escherichia coli MG1655 genome (the sequence is shown in SEQ ID NO.16), and then homologous recombination was performed at the vector BamHⅠ restriction site to construct the vector pUCX-Ter.

[0069] The primer sequences involved are as follows:

[0070] pUCX-F: AAGCGGAAGACAGGAAACAG CTATGACATGA;

[0071] pUCX-R: CTGTTTCCTGTCTTCCGCTT CCTCGCTCA;

[0072] BamH-Ter-F:

[0073] CTGCAGGTCGACTCTAGAGGATC CAAATAAAACGAAAGGCTCAGTC;

[0074] BamH-Ter-R:

[0075] AATTCGAGCTCGGTACCCGGGGATC AAAAGGCCATCCGTCAGGATG.

[0076] (2) Construction of pUCX-bolAP-Ter overexpression vector:

[0077] Primers Hind-bolAP-F and Hind-bolAP-R were used to amplify bolA and its promoter region from the genome of Escherichia coli MG1655. Then, the vector pUCX-Ter obtained in step (1) was used as the starting plasmid, and bolA and its promoter region were recombined into the vector after restriction digestion at the HindⅢ restriction site to construct the vector pUCX-bolAP-Ter.

[0078] The primer sequences involved are as follows:

[0079] Hind-bolAP-F: CTATGACCATGATTACGCCAAGCT GTTCGGGCTCTCAGAGACTC;

[0080] Hind-bol A-R: GTCGACCTGCAGGCATGCAAGCT TTACGCGATGCTTCCTGCTCC.

[0081] (3) Construction of overexpression strains:

[0082] Prepare E. coli JM109 transfection competent cells according to the instructions of the Super Competent Cell Preparation Kit (Shanghai Biotechnology Co., Ltd.; B529303-0200). Thaw the competent cells on ice, add 10 μL of the homologous recombination vector pUCX-bolAP-Ter constructed in step (2), heat shock in a metal bath at 42°C for 90s, and immediately place on ice for 5 minutes. After the ice bath, add 900 μL of liquid LB medium for recovery culture, the recovery conditions are 37°C, 200 rpm, and time 1 hour. After the recovery, plate the plate to obtain the strain (JM109) overexpressing bolA, then pick the single colony grown on the plate for culture and extract the plasmid to verify whether the recombinant vector is obtained.

[0083] (4) The bolA-overexpressing strain (JM109) obtained in step (3) was subjected to colony PCR using primers pUCX-JC and Hind-bolA-R.

[0084] The primer sequences involved are as follows:

[0085] pUCX-JC:TGCTCACATGTTCTTTCCTGCG;

[0086] BamH-Ter-R:

[0087] AATTCGAGCTCGGTACCCGGGGATC AAAAGGCCATCCGTCAGGATG.

[0088] (5) Positive transformants were obtained by nucleic acid electrophoresis. Figure 4 As shown, except for lanes 3, 4, and 5, all others were in line with the expected size; positive transformants were selected and sent to a sequencing company for sequencing, and the results showed that the strain was successfully constructed.

[0089] (6) The successfully verified recombinant plasmid was transferred into the Escherichia coli MG1655 strain to construct a bolA overexpression strain, which was named E. coli-MG1655-bolA+; the vector pUCX-Ter constructed in step (2) was transferred into E. coli-MG1655 to obtain the strain E. coli-MG1655 carrying pUCX-Ter, which was used for subsequent experiments.

[0090] Example 2: Biofilm formation ability of MG, ΔbolA, and bolA+ strains and cell survival ability under extremely acidic conditions (pH 2.5)

[0091] The recombinant E. coli strains E. coli-MG1655-ΔbolA (hereinafter referred to as ΔbolA), E. coli-MG1655-bolA+ (hereinafter referred to as bolA+) and E. coli-MG1655 (hereinafter referred to as MG) prepared in Example 1 were used for subsequent experiments.

[0092] 1. Determination of biofilm formation ability of three strains of bacteria: MG, ΔbolA, and bolA+: The results of the biofilm formation ability test are as follows Figure 5 The specific steps are as follows:

[0093] (1) Streak the three strains of MG, ΔbolA, and bolA+ on LB plates, pick a single colony and culture it in LB medium for 12 h, then inoculate it into a 96-well plate containing M9 acidified to pH 4.5, 5.0, and 7.0 with HCl at a 2% v / v inoculation volume, and culture it for 24 h. The OD 620 biomass under

[0094] (2) The culture medium and floating cells in the well plate were then removed, and the well plate was washed three times with PBS buffer and air-dried;

[0095] (3) Then, 200 μL of 1% w / v crystal violet staining solution was added for staining for 30 min, the corresponding staining solution was rinsed off with running water, and the 96-well plate was inverted on the filter paper and dried in a 37°C incubator;

[0096] (4) After drying, add 33% v / v glacial acetic acid to each well and dissolve at 37°C for more than 30 min. 540 The absorbance value was measured under the following conditions, OD 540 With OD 620 The ratio can reflect the ability to form biofilm, and each group was repeated three times to take the average value.

[0097] The results showed that under different pH conditions, the overexpression strain bolA+ had significant biofilm formation ability. Under pH 4.5, the OD of the three strains MG, ΔbolA, and bolA+ was 540 With OD 620 The ratios of MG, ΔbolA and bolA+ were 2.617, 2.454 and 5.192 respectively. The biofilm formation ability of bolA+ was 2.08 times that of MG. Under the condition of pH 5.0, the OD 540 With OD 620The ratios of MG, ΔbolA and bolA+ were 3.084, 2.726 and 7.027 respectively, and the biofilm formation ability of bolA+ was 2.27 times that of MG. Under the condition of pH 7.0, the OD 540 With OD 620 The ratios were 1.228, 0.870, and 7.251, respectively. The biofilm formation ability of bolA+ was 6.31 times that of MG. The gene deletion strain ΔbolA showed no significant difference with MG.

[0098] 2. Cell viability under extremely acidic conditions (pH 2.5): The results of the viability spot test are as follows: Figure 6 The specific steps are as follows:

[0099] (1) Streak the three strains of MG, ΔbolA, and bolA+ on an LB plate, pick a single colony and culture it in LB medium for 12 h, then inoculate it into M9 minimal medium acidified to pH 2.5 with HCl at a 2% v / v inoculum;

[0100] (2) Starting from the 2nd hour, samples were taken every 1 hour and spotted onto LB solid plates according to the gradient dilution;

[0101] (3) Take photos after overnight incubation at 37°C.

[0102] The results showed that as time went by, the overexpression strain bolA+ 5 There were still strains surviving when the dilution was 10 3 There were basically no surviving strains. It can be seen that the survival rate of the overexpression strain bolA+ was up to 100 times higher than that of MG and ΔbolA.

[0103] Example 3: Determination of error-prone PCR conditions

[0104] In order to control the gene mutation efficiency within a reasonable mutation range, we explored the 2+ , Mn 2+ Adding amount and changing PCR reaction program to determine error-prone PCR conditions include the following steps:

[0105] (1) By increasing Mg 2+ PCR was performed with a concentration of 0 to 10 mM. After the reaction, agarose gel electrophoresis was performed to determine the appropriate Mg 2+ concentration;

[0106] (2) Changing different concentrations of Mn in the conventional PCR reaction system 2+ (0~0.6mM), after the reaction, agarose gel electrophoresis was performed to determine the appropriate Mn 2+ ;

[0107] (3) The mutation efficiency of appropriate bases is controlled by adjusting the number of error-prone PCR reactions, the annealing temperature during the PCR reaction, the extension time, and the number of reaction cycles.

[0108] The results show Figure 7 As shown, they are (A) different Mg 2+ and Mn 2+ PCR electrophoresis under the same conditions; (B) Mg 2+ and Mn 2+ Combined electrophoresis diagram. According to the agarose gel electrophoresis imaging diagram, it can be seen that as Mg 2+ With the addition of Mn 2 + The addition of Mg resulted in a gradual darkening of the gel image, which indicated that by adjusting the 2+ and Mn 2+ The concentration can change the amplification efficiency of PCR. Then follow the PCR reaction program in Table 1 to control the Mg 2+ , Mn 2+ The concentrations were 5 mM and 0.2 mM and two rounds of error-prone PCR reactions were performed. After obtaining the recombinant vector, sequencing was performed and it was found that the average mutation rate could reach about 0.6%, which can be used to construct mutants.

[0109] Table 1: Error-prone PCR reaction procedures

[0110]

[0111] Example 4: Screening of mutant strains and detection of the ability of mutant strains to resist acid stress

[0112] The bolA overexpressing strain E. coli-MG1655-bolA+ prepared in Example 1 was taken, and the plasmid pUCX-bolAP-Ter was used as a template, and mutation and screening were performed according to the error-prone PCR conditions obtained in Example 3; E. coli-MG1655 transformed with the plasmid pUCX-Ter constructed in Example 1 was used as a blank control (WT), and the plasmid transformation method was consistent with that in Example 1.

[0113] The screening process of mutant strains includes the following steps:

[0114] (1) Construction of a mutant library of bolA and its promoter region by error-prone PCR;

[0115] (2) Pick a single colony after the error-prone PCR mutation and culture it in LB medium overnight, then dilute the bacterial solution to OD 600The inoculum was 0.6, and the cells were transferred to a 96-well plate containing M9 medium acidified to pH 5.0 with different organic or inorganic acids according to the inoculum volume of 1% v / v. WT was used as the control, and the OD was measured after 12 h. 600 , select mutants with strong growth ability;

[0116] (3) The mutants with strong growth ability were screened in a second round in a shake flask in M9 medium acidified to pH 4.5 with organic or inorganic acid;

[0117] After multiple screenings, four mutants with excellent growth performance were finally screened out and named E.coil-5-21-5, E.coil-6-9-10, E.coil-6-9-15, and E.coil-6-15-25. The growth curves were then measured in M9 medium acidified to pH 4.5 and 5.0 with succinic acid, pH 4.5 with citric acid, pH 4.5 with hydrochloric acid, and unacidified, specifically including the following steps:

[0118] (1) Streaking the mutant strain obtained by screening on a plate and picking out a single colony for overnight culture;

[0119] (2) Dilute the cells cultured overnight to OD 600 The inoculum was 0.6, and then inoculated into M9 medium with different acidification levels at a 1% v / v inoculum. The OD 600 , measure up to 24h and draw the growth curve and specific growth rate curve.

[0120] The results are as follows Figure 8 As shown in the figure, the biomass of the mutants screened was increased compared with that of the WT strain under organic or inorganic acid conditions. OD values ​​of WT, bolA+, E.coil-5-21-5, E.coil-6-9-10, E.coil-6-9-15, and E.coil-6-15-25 in the medium acidified to pH 4.5 with succinic acid 600 The highest biomass under the following conditions were 0.229, 0.2245, 0.2675, 0.2575, 0.255, and 0.215, respectively. In the medium acidified to pH 5.0 with succinic acid, the OD 600The highest biomass under different conditions were 0.731, 0.733, 0.869, 0.8545, 0.822, and 0.736, respectively. The mutant strains E.coil-5-21-5, E.coil-6-9-10, and E.coil-6-9-15 had growth advantages, and their biomass increased by 11.35-18.88% compared with WT. The OD values ​​of WT, bolA+, E.coil-5-21-5, E.coil-6-9-10, E.coil-6-9-15, and E.coil-6-15-25 in the medium acidified to pH 4.5 with citric acid were 0. 600 The highest biomass of the mutant strain E.coil-5-21-5 was 24.89% higher than that of WT; the OD values ​​of WT, bolA+, E.coil-5-21-5, E.coil-6-9-10, E.coil-6-9-15, and E.coil-6-15-25 in the medium acidified to pH 4.5 by HCl were 0.229, 0.2045, 0.286, 0.2815, 0.2615, and 0.204, respectively. The highest biomass of the mutant strain E.coil-5-21-5 was 24.89% higher than that of WT. 600 The highest biomass were 0.212, 0.222, 0.2655, 0.255, 0.2605 and 0.2735 respectively. The mutant strain E.coil-6-15-25 with the highest biomass was 29.01% higher than that of WT. In M9 medium with pH 7.0, all strains showed no significant differences.

[0121] Example 5: Observation of cell morphology changes by transmission electron microscopy (TEM)

[0122] The mutant strains E.coil-5-21-5, E.coil-6-9-10, E.coil-6-9-15, E.coil-6-15-25 prepared in Example 4 and the control group WT and the unmutated bolA+ strain were used for subsequent experiments.

[0123] In order to further explore the effect of organic acid (taking succinic acid acidified to pH 5.0 as an example) on bacterial cell stress, bacterial cells were observed by transmission electron microscopy. The following steps were included:

[0124] (1) The mutant strain was grown overnight in LB medium and then transferred to M9 medium acidified to pH 5.0 with succinic acid and cultured until the stationary phase.

[0125] (2) Bacterial cells were collected by centrifugation and fixed with 5% glutaraldehyde at 4°C for 12 h. The samples were then rinsed several times with 0.1 M phosphate buffer to remove the glutaraldehyde solution. The samples were dehydrated with 30%, 50%, 70%, 90%, and 100% v / v ethanol solutions in a gradient manner. After critical point drying and ion sputtering, the morphological structure of the bacteria was observed using TEM (H-7650, Hitachi, Ltd., Japan). The results are shown in Table 1. Fig. 9 shown.

[0126] The results showed that the lengths of the mutants E.coil-5-21-5, E.coil-6-9-10 and E.coil-6-9-15 strains were reduced by 26.14%, 35.06% and 28.32% respectively compared with WT, and the cells tended to cluster more.

[0127] Example 6: Analysis of Extracellular Polymeric Substances (EPS)

[0128] The formation of biofilm is generally related to environmental changes, including antibiotics, toxins, acidic environments, etc. The formation of biofilm can help bacterial groups resist adverse environments. Biofilm is usually defined as a group of surface-associated bacteria wrapped in the extracellular matrix (EPS) produced by itself. EPS plays a key role in resisting adverse factors. The composition of EPS includes polysaccharides, proteins, lipids and extracellular DNA. The presence of polysaccharides can determine the electrical properties of EPS, and proteins play the role of extracellular enzymes and structural proteins, helping cell groups resist adverse environments. The EPS was extracted and the content of its main components, proteins and polysaccharides, was tested.

[0129] The following steps are involved:

[0130] EPS was extracted by combining physical ultrasonic crushing and heating extraction. The mutant strains E.coil-5-21-5, E.coil-6-9-10, E.coil-6-9-15, E.coil-6-15-25 obtained by screening in Example 4, as well as the control group WT and the unmutated bolA+ strain were cultured in M9 medium acidified to pH 5.0 with succinic acid for 16 hours, and then the bacteria were collected by centrifugation in 50 mL. The precipitate was washed 3 times with phosphate buffered saline (PBS) buffer, and then 20 mL PBS buffer was added. The mixture was ultrasonically treated at 40 W for 2 minutes using an ultrasonic crusher, and then heated in a water bath at 80°C for 10 minutes. The supernatant obtained by centrifugation was filtered through a 0.22 μm organic membrane, and then vacuum dried to obtain EPS powder. Subsequently, 100 mg of EPS dry matter was weighed and dissolved in 1 mL of water. The protein content was determined by the Coomassie Brilliant Blue method, and the polysaccharide content was determined by the anthrone-sulfuric acid method. The results are as follows. Fig.10 shown.

[0131] The results showed that the ratio of protein to polysaccharide in the EPS of the mutant strain changed significantly, and the increase in protein content was related to the regulation of the starch protein Curli by the bolA gene.

[0132] The protein contents of the four mutant strains E.coil-5-21-5, E.coil-6-9-10, E.coil-6-9-15, and E.coil-6-15-25 screened were increased by 19.56%, 24.45%, 20.59%, and 19.30%, respectively, compared with the wild-type strain WT. The protein to polysaccharide content ratios of the EPS produced by the four mutant strains were 1.72, 1.98, 2.02, and 1.33 times that of the control group WT, respectively, which will help cells resist adverse environments.

[0133] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. An engineered Escherichia coli with improved acid stress resistance, characterized in that: The Escherichia coli engineered bacteria overexpresses the morphogenetic protein BolA; The amino acid sequence of the morphogen protein BolA is shown in SEQ ID NO.2, and the expression is driven by the promoter shown in the nucleotide sequence of SEQ ID NO.

7.

2. The Escherichia coli engineered bacteria according to claim 1, characterized in that The Escherichia coli engineering bacteria use pUC19, pET-28a(+), and pCDFDuet-1 as overexpression vectors.

3. The Escherichia coli engineered bacteria according to claim 1, characterized in that The host of the Escherichia coli is E. coli MG1655, E. coli BL21, E. coli JM109.

4. The method for constructing an engineered Escherichia coli according to any one of claims 1 to 3, characterized in that: The method is: removing the original promoter in the plasmid, replacing the morphological gene BO and its promoter are connected to the plasmid, and the terminator rrnBT1T2 is added, and the plasmid is transformed into Escherichia coli; wherein the amino acid sequence of the morphological gene protein BolA is shown in SEQ ID NO.2, the nucleotide sequence of the promoter is shown in SEQ ID NO.7, and the nucleotide sequence of the terminator rrnBT1T2 is shown in SEQ ID NO.

16.

5. Application of morphogenetic protein BolA in improving the acid stress resistance of Escherichia coli, characterized in that: The amino acid sequence of the morphogen protein BolA is shown in SEQ ID NO.2, and the expression is driven by the promoter with the nucleotide sequence shown in SEQ ID NO.7; the acid stress resistance is resistance to hydrochloric acid, succinic acid or citric acid stress.

Images