A genetically engineered bacterium producing ectoine, its construction method and application

By using growth-dependent promoters in E. coli to regulate the expression of lysA and metL genes and overexpress related gene clusters and enzyme genes, the efficient synthesis and high yield of tetrahydropyrimidines are achieved, solving the problems of low yield and limited bacterial growth in the prior art.

CN117802022BActive Publication Date: 2025-05-30HEFEI MICROHE HEXAGON BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311847747.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-12-29
Publication Date
2025-05-30
Estimated Expiration
2043-12-29

AI Technical Summary

Technical Problem

The prior art may affect bacterial growth when constructing the biological metabolic pathway of tetrahydropyrimidine, resulting in a decrease in tetrahydropyrimidine production.

Method used

The expression of the diaminopimethicone decarboxylase gene lysA and the homoserine dehydrogenase gene metL is regulated by introducing a growth-dependent promoter in E. coli, and overexpressing the gene cluster ectABC, aspartate kinase gene lysC, and aspartate ammonia lysC, and aspartate ammonia lysA gene aspA to achieve heterologous synthesis and high yield of tetrahydropyrimidine.

Benefits of technology

While not affecting bacterial growth, the yield of tetrahydropyrimidine is significantly improved, solving the problems of low yield and limited bacterial growth in the prior art.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004640195410000091
    Figure BDA0004640195410000091
  • Figure BDA0004640195410000101
    Figure BDA0004640195410000101
  • Figure HDA0004640195420000011
    Figure HDA0004640195420000011
Patent Text Reader

Abstract

The present invention belongs to the technical fields of genetic engineering and fermentation engineering, and specifically relates to a genetically engineered bacterium producing ectoine, a construction method thereof, and an application thereof. The present invention uses Escherichia coli BL21(DE3) as a starting strain, overexpresses the gene cluster ectABC, the aspartokinase gene lysC, and the aspartate ammonia-lyase gene aspA, and for the first time uses the growth-dependent promoters fliA, fliC, and flgC to respectively regulate the expression levels of the diaminopimelate decarboxylase gene lysA and the homoserine dehydrogenase gene metL. This combined regulation realizes the heterologous expression of ectoine, and while not affecting the production of key amino acids to meet the growth of the bacterial cells, effectively improves the yield of ectoine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical fields of genetic engineering and fermentation engineering, and particularly relates to a genetically engineered bacterium for producing ectoine, and a construction method and application thereof. Background Art

[0002] There are mainly two methods for the synthesis of ectoine: chemical synthesis method and biosynthesis method. The chemical synthesis method has many problems, including complex production process, low synthesis yield, many by-products and similar chemical properties to the target product, and very high difficulty in downstream separation and purification. The biosynthesis method mainly adopts enzyme catalysis method and fermentation method. In the biological fermentation method, first, a biological metabolic pathway of ectoine needs to be constructed in the bacterial cells. Through the metabolic branch pathway of aspartic acid, the synthesis process of ectoine can be completed in three steps. First, aspartokinase (LysC) catalyzes aspartic acid to generate β-aspartyl phosphate; then, it is catalyzed by aspartate semialdehyde dehydrogenase (AsD) to generate aspartate-β-semialdehyde; finally, the synthesis of ectoine is completed under the catalysis of three enzymes encoded by ectABC.

[0003] In existing research, usually, by strengthening the path intensity of the target product, a metabolic pathway of ectoine in Escherichia coli is constructed, and at the same time, the branch by-product path is knocked out to ensure the carbon flow of the target product. This approach is reasonable at the design level, but it may have a negative impact on the growth of the bacterial cells. It is very likely that the products of the branch pathway are beneficial to the growth of the bacterial cells, and once knocked out, it will affect the growth of the bacterial cells. In the production strains of ectoine, due to the presence of branch by-products lysine and homoserine, the carbon flow to ectoine is reduced. According to past research experience, knocking out the diaminopimelate decarboxylase gene lysA and the homoserine dehydrogenase gene metL is helpful for increasing the yield, but it is not beneficial to the growth of the bacterial cells. The deletion of the key branch pathway leads to amino acid auxotrophy, which will inhibit the growth of the bacterial cells to a certain extent, causing a certain pressure on the bacterial cells, and thus affecting the production of ectoine. Summary of the Invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a genetically engineered bacterium for producing ectoine, so as to achieve a more reasonable growth state of the bacterial cells and effectively increase the yield of ectoine.

[0005] To achieve the above purpose, the technical solutions adopted by the present invention include:

[0006] In the first aspect, the present invention provides an Escherichia coli engineering bacterium for producing ectoine, wherein the expression of the diaminopimelate decarboxylase gene lysA and / or the homoserine dehydrogenase gene metL of the Escherichia coli engineering bacterium is respectively regulated by a growth-dependent promoter; the Escherichia coli engineering bacterium overexpresses a recombinant gene, and the recombinant gene includes the gene cluster ectABC.

[0007] The present invention utilizes synthetic biology techniques and genetic engineering means, using Escherichia coli as the starting strain to express the gene cluster ectABC related to the ectoine synthesis pathway derived from Halomonas elongata, realizing the heterologous synthesis of ectoine; at the same time, replacing the promoters of the competitive pathway metabolic diaminopimelate decarboxylase lysA and homoserine dehydrogenase metL to make the growth state of the bacteria more reasonable, thereby effectively increasing the yield of ectoine.

[0008] Preferably, the growth-dependent promoter includes at least one of the fliA, fliC, and flgC promoters; the nucleotide sequence of the fliA promoter is as shown in SEQ ID NO: 1, the nucleotide sequence of the fliC promoter is as shown in SEQ ID NO: 2, and the nucleotide sequence of the flgC promoter is as shown in SEQ ID NO: 3.

[0009] Preferably, the growth-dependent promoter includes at least one of the fliC and flgC promoters.

[0010] The present invention replaces the original promoters of the diaminopimelate decarboxylase gene lysA and the homoserine dehydrogenase gene metL with growth-dependent promoters, thereby regulating the production of homoserine and lysine in the competitive branch to achieve the purpose of not affecting the production of key amino acids during the bacterial growth stage, meeting the growth of the bacteria, and at the same time reducing the expression level of amino acids during the stationary phase of the bacteria, concentrating the carbon flux on the expression pathway of ectoine, so as to achieve the purpose of high-yield ectoine. Through experimental exploration, it is found that when the fliA, fliC, and flgC promoters regulate the expression of lysA and metL respectively, the ectoine yield of the engineering strain can be effectively improved. When the fliC or flgC promoter is used for regulation, the improvement effect of the ectoine yield is the most significant.

[0011] Preferably, the recombinant gene further includes the aspartokinase gene lysC and the aspartate ammonia-lyase gene aspA.

[0012] On the basis of overexpressing the gene cluster ectABC, the present invention further increases the yield of ectoine by co-expressing the aspartokinase gene lysC derived from Corynebacterium glutamicum and the aspartate ammonia-lyase gene aspA derived from Escherichia coli.

[0013] Preferably, the expression vector of the recombinant gene is pRSFDuet-1.

[0014] Preferably, the specific process of the replacement growth-dependent promoter regulating the expression of the diaminopimelate decarboxylase gene lysA and the homoserine dehydrogenase gene metL is as follows: The diaminopimelate decarboxylase gene lysA derived from Escherichia coli and / or the homoserine dehydrogenase gene metL derived from Escherichia coli are integrated into the MCS I region and / or the MCS II region of the pETDuet-1 expression vector, and the T7 promoter in the gene integration region is replaced by the growth-type promoter through homologous recombination.

[0015] During the experimental exploration process, the inventors found that directly knocking out the diaminopimelate decarboxylase gene lysA and the homoserine dehydrogenase gene metL in Escherichia coli would result in the absence of key branch pathways, leading to the problem of amino acid auxotrophy, which would inhibit the growth of the bacteria to a certain extent and thus affect the production of ectoine. Therefore, by replacing the promoters of the competing pathway metabolic enzymes lysA and metL and regulating lysA and metL through the growth-dependent promoter, the growth state of the bacteria can be made more reasonable, thereby effectively increasing the yield of ectoine.

[0016] Preferably, the starting strain of the Escherichia coli engineering bacteria is Escherichia coli BL21(DE3), and the genotype of the Escherichia coli BL21(DE3) is E.coli BL21(DE3)ΔlysAΔmetL.

[0017] In the present invention, it was found that when producing ectoine with the strain in which the key metabolic enzyme genes lysA and metL of the competing branch were directly knocked out, this approach was reasonable at the design level, but it had a negative impact on the growth of the bacteria. The products of the branch pathway were beneficial to the growth of the bacteria, and once knocked out, it would affect the growth of the bacteria. Therefore, the present invention uses E.coli BL21(DE3)ΔlysAΔmetL as the starting strain, complements the lysA and metL deletion genes, and replaces the original promoters of lysA and metL for regulation to obtain a high-yield ectoine engineering strain.

[0018] In the second aspect, the present invention also provides a method for constructing the above-mentioned Escherichia coli engineering bacteria for producing ectoine, including the following steps:

[0019] (1) Integrate the recombinant gene into the expression vector to construct recombinant expression vector I;

[0020] (2) Integrate the diaminopimelate decarboxylase gene lysA derived from Escherichia coli and / or the homoserine dehydrogenase gene metL derived from Escherichia coli into the MCS I region and / or the MCS II region of the pETDuet-1 expression vector, and replace the T7 promoter in the gene integration region with the growth-type promoter through homologous recombination to construct recombinant expression vector II;

[0021] (3) Transfer the above recombinant expression vectors I and II into the Escherichia coli starting strain in the above step to obtain the Escherichia coli engineering strain.

[0022] Thirdly, the present invention also provides the application of the above Escherichia coli engineering strain in the production of ectoine.

[0023] Preferably, the production includes the following steps:

[0024] (1) Seed culture: Activate the Escherichia coli engineering strain, pick a single colony and inoculate it into a seed culture medium, and culture it at 35-39 °C and 200-240 rpm for 5-7 h;

[0025] (2) Fermentation culture: Inoculate the seed culture into a batch fermentation medium at an inoculation amount of 20%, add 1 mL of trace elements, culture it at 35-39 °C for 5-7 h, add 150 mL of 0.2 mmol / L IPTG and induce culture at 35-39 °C to obtain;

[0026] The components of the batch fermentation medium are: Na 2 HPO 4 ·12H 2 O 17.9 g / L, KH 2 PO 4 3.1 g / L, NH 4 Cl 2.0 g / L, (NH 4 ) 2 HPO 4 1.0 g / L, trisodium citrate dihydrate 2.2 g / L, yeast extract 2.0 g / L, glycerol 30 g / L, tryptone 15 g / L, adjust the pH to 7.0;

[0027] The components of the trace elements are: ferric ammonium citrate 5.6 g / L, zinc sulfate heptahydrate 0.9 g / L, CoCl 2 ·6H 2 O 0.2 g / L, manganese chloride tetrahydrate 1.0 g / L, CuCl 2 ·2H 2 O 0.10 g / L, boric acid 0.2 g / L, Na 2 MoO 4 ·2H 2 O 0.2 g / L.

[0028] Compared with the prior art, the beneficial effects of the present invention are:

[0029] In the present invention, Escherichia coli BL21(DE3) was used as the starting strain, the gene cluster ectABC, the aspartokinase gene lysC, and the aspartate ammonia-lyase gene aspA were overexpressed, and for the first time, the growth-dependent promoters fliA, fliC, and flgC were used to regulate the expression levels of the diaminopimelate decarboxylase gene lysA and the homoserine dehydrogenase gene metL, respectively. This combined regulation achieved the heterologous expression of ectoine, and effectively increased the yield of ectoine while not affecting the production of key amino acids to meet the growth of the cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 It is a diagram of the biosynthetic pathway related to ectoine in the recombinant bacterium and the metabolic engineering strategy involved in the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0031] To make the objectives, technical solutions and effects of the present invention clearer and more definite, the present invention will be further described in detail below with reference to the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0032] Unless otherwise specified, the test methods used in the embodiments are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can all be obtained from commercial channels.

[0033] Example 1. Construction of an Escherichia coli engineering bacterium for biosynthesizing ectoine

[0034] 1. Construction of the pRSF-ectABC-lysC-aspA expression plasmid

[0035] (1) The gene cluster ectABC from Halomonas elongata was integrated into the pRSFDuet-1 plasmid and constructed by a general company. The constructed plasmid was pRSF-ectABC;

[0036] (2) The primer pair lysC-F / lysC-R was designed to clone the aspartokinase gene lysC from Corynebacterium glutamicum, and the cloned lysC fragment was ligated behind the first T7 promoter of the plasmid pRSF-ectABC by homologous recombination technology to construct the plasmid pRSF-ectABC-lysC;

[0037] (3) Design primer pairs pRSF-F / pRSF-R, use plasmid pRSF-ectABC-lysC as a template, perform PCR amplification to obtain a linearized vector; at the same time, design primer pairs aspA-F / aspA-R to clone the aspartate ammonia-lyase gene aspA from Escherichia coli, and connect the cloned aspA fragment with the previous linearized plasmid vector through homologous recombination technology to obtain plasmid pRSF-ectABC-lysC-aspA.

[0038] 2. pET-P GPPs -lysA, pET-P GPPs -metL, pET-P GPPs -lysA-P GPPs Construction of -lysA, -metL, -lysA-P, -metL expression vectors

[0039] (1) Integrate the diaminopimelate decarboxylase gene lysA from Escherichia coli into the MCS I region of the pETDuet-1 plasmid, the homoserine dehydrogenase gene metL into the MCS II region of the pETDuet-1 plasmid, and integrate lysA and metL into the MCS I region and MCS II region of the pETDuet-1 plasmid respectively, constructed by General Company, and obtain constructed plasmids pET-lysA, pET-metL, pET-lysA-metL respectively;

[0040] (2) Growth-dependent promoters (GPPs) include fliA, fliC, flgC; the promoter sequences of fliA, fliC, flgC are synthesized by General Company respectively, and their nucleotide sequences are shown in SEQ ID NO: 1-3 in the sequence listing respectively. Design primer pairs fliA-F1 / fliA-R1, fliA-F2 / fliA-R2, fliC-F1 / fliC-R1, fliC-F2 / fliC-R2, flgC-F1 / flgC-R1, flgC-F2 / flgC-R2 respectively;

[0041] 1. Use primer pair fliA-F1 / fliA-R1 to perform PCR amplification on plasmid pET-lysA to obtain a linearized vector, and connect the fliA promoter sequence to the position of the T7 promoter in the MCS I region of the linearized plasmid through homologous recombination technology to obtain plasmid pET-P fliA -lysA;

[0042] 2. Use primer pair fliC-F1 / fliC-R1 to perform PCR amplification on plasmid pET-lysA to obtain a linearized vector, and connect the fliC promoter sequence to the position of the T7 promoter in the MCS I region of the linearized plasmid through homologous recombination technology to obtain plasmid pET-PfliC -lysA;

[0043] 3. Use the primer pair flgC-F1 / flgC-R1 to perform PCR amplification on the pET-lysA plasmid to obtain a linearized vector, and connect the flgC promoter sequence to the position of the T7 promoter in the MCS I region of the linearized plasmid through homologous recombination technology to obtain plasmid pET-P flgC -lysA;

[0044] 4. Use the primer pair fliA-F2 / fliA-R2 to perform PCR amplification on the pET-metL plasmid to obtain a linearized vector, and connect the fliA promoter sequence to the position of the T7 promoter in the MCS II region of the linearized plasmid through homologous recombination technology to obtain plasmid pET-P fliA -metL;

[0045] 5. Use the primer pair fliC-F2 / fliC-R2 to perform PCR amplification on the pET-metL plasmid to obtain a linearized vector, and connect the fliC promoter sequence to the position of the T7 promoter in the MCS II region of the linearized plasmid through homologous recombination technology to obtain plasmid pET-P fliC -metL;

[0046] 6. Use the primer pair flgC-F2 / flgC-R2 to perform PCR amplification on the pET-metL plasmid to obtain a linearized vector, and connect the flgC promoter sequence to the position of the T7 promoter in the MCS II region of the linearized plasmid through homologous recombination technology to obtain plasmid pET-P flgC -metL;

[0047] 7. Use the primer pairs fliA-F1 / fliA-R1 and fliA-F2 / fliA-R2 to perform stepwise PCR amplification on the pET-lysA-metL plasmid to obtain a linearized vector, and connect the fliA promoter sequence to the positions of the T7 promoters in the MCS I region and MCS II region of the linearized plasmid respectively through homologous recombination technology to obtain plasmid pET-P fliA -lysA-P fliA -metL;

[0048] 8. Use the primer pairs fliA-F1 / fliA-R1 and fliC-F2 / fliC-R2 to perform stepwise PCR amplification on the pET-lysA-metL plasmid to obtain a linearized vector, and connect the fliA and fliC promoter sequences to the positions of the T7 promoters in the MCS I region and MCS II region of the linearized plasmid respectively through homologous recombination technology to obtain plasmid pET-P fliA -lysA-PfliC -metL;

[0049] 9. Use primer pairs fliA-F1 / fliA-R1 and flgC-F2 / flgC-R2 to perform stepwise PCR amplification on the pET-lysA-metL plasmid to obtain a linearized vector, and connect the fliA and flgC promoter sequences to the positions of the T7 promoter in the MCS I region and MCS II region of the linearized plasmid through homologous recombination technology to obtain plasmid pET-P fliA -lysA-P flgC -metL;

[0050] 10. Use primer pairs fliC-F1 / fliC-R1 and fliA-F2 / fliA-R2 to perform stepwise PCR amplification on the pET-lysA-metL plasmid to obtain a linearized vector, and connect the fliC and fliA promoter sequences to the positions of the T7 promoter in the MCS I region and MCS II region of the linearized plasmid through homologous recombination technology to obtain plasmid pET-P fliC -lysA-P fliA -metL;

[0051] 11. Use primer pairs fliC-F1 / fliC-R1 and fliC-F2 / fliC-R2 to perform stepwise PCR amplification on the pET-lysA-metL plasmid to obtain a linearized vector, and connect the fliC promoter sequence to the positions of the T7 promoter in the MCS I region and MCS II region of the linearized plasmid through homologous recombination technology to obtain plasmid pET-P fliC -lysA-P fliC -metL;

[0052] 12. Use primer pairs fliC-F1 / fliC-R1 and flgC-F2 / flgC-R2 to perform stepwise PCR amplification on the pET-lysA-metL plasmid to obtain a linearized vector, and connect the fliC and flgC promoter sequences to the positions of the T7 promoter in the MCS I region and MCS II region of the linearized plasmid through homologous recombination technology to obtain plasmid pET-P fliC -lysA-P flgC -metL;

[0053] 13. Use primer pairs flgC-F1 / flgC-R1 and fliA-F2 / fliA-R2 to perform stepwise PCR amplification on the pET-lysA-metL plasmid to obtain a linearized vector, and connect the flgC and fliA promoter sequences to the positions of the T7 promoter in the MCS I region and MCS II region of the linearized plasmid through homologous recombination technology to obtain plasmid pET-PflgC -lysA-P fliA -metL;

[0054] 14. Use primer pairs flgC-F1 / flgC-R1 and fliC-F2 / fliC-R2 to perform stepwise PCR amplification on the pET-lysA-metL plasmid to obtain a linearized vector, and connect the flgC and fliC promoter sequences to the positions of the T7 promoter in the MCS I region and MCS II region of the linearized plasmid respectively through homologous recombination technology to obtain plasmid pET-P flgC -lysA-P fliC -metL;

[0055] 15. Use primer pairs flgC-F1 / flgC-R1 and flgC-F2 / flgC-R2 to perform stepwise PCR amplification on the pET-lysA-metL plasmid to obtain a linearized vector, and connect the flgC promoter sequence to the positions of the T7 promoter in the MCS I region and MCS II region of the linearized plasmid respectively through homologous recombination technology to obtain plasmid pET-P flgC -lysA-P flgC -metL;

[0056] 3. Construction of different recombinant Escherichia coli engineering bacteria

[0057] (1) Use the CRISPER method to knockout the diaminopimelate decarboxylase gene lysA and the homoserine dehydrogenase gene metL to obtain the gene knockout Escherichia coli E.coli BL21(DE3)ΔlysA, E.coli BL21(DE3)ΔmetL, and E.coli BL21(DE3)ΔlysAΔmetL respectively;

[0058] (2) Mix the obtained recombinant vector pRSF-ectABC with the competent cells of E.coli BL21(DE3)ΔlysA, E.coliBL21(DE3)ΔmetL, and E.coli BL21(DE3)ΔlysAΔmetL respectively, place them on ice for 30 min, then quickly perform heat shock (42 °C, 90 s), then quickly place them on ice, let them stand for 2 min, and then aseptically add 1 mL of LB liquid medium, and recover and culture at 37 °C and 220 rpm for 1 h to obtain strains ECT-01, ECT-02, and ECT-03 respectively; perform the same operation on the plasmid pRSF-ectABC-lysC-aspA to obtain strains ECT-04, ECT-05, and ECT-06;

[0059] (3) The pET-P fliA -lysA, pET-PfliC -lysA, pET-P flgC -lysA was transformed into ECT-04 strain respectively to obtain strains ECT-07, ECT-08, and ECT-09; pET-P fliA -metL, pET-P fliC -metL, pET-P flgC -metL was transformed into ECT-05 strain respectively to obtain strains ECT-10, ECT-11, and ECT-12; pET-P fliA -lysA-P fliA -metL, pET-P fliA -lysA-P fliC -metL, pET-P fliA -lysA-P flgC -metL, pET-P fliC -lysA-P fliA -metL, pET-P fliC -lysA-P fliC -metL, pET-P fliC -lysA-P flgC -metL, pET-P flgC -lysA-P fliA -metL, pET-P flgC -lysA-P fliC -metL, pET-P flgC -lysA-P flgC -metL was transformed into ECT-06 strain respectively to obtain strains ECT-13, ECT-14, ECT-15, ECT-16, ECT-17, ECT-18, ECT-19, ECT-20, and ECT-21.

[0060] The primer pairs described in the examples are shown in Table 1.

[0061] Table 1

[0062] Primer Name Primer Sequence lysC-F CCACAGCCAGGATCCGAATTCGATGGCCCTGGTCGTACAG lysC-R GCATTATGCGGCCGCAAGCTTTTAGCGTCCGGTGCCTGC pRSF-F CTGATGAAAGCGAACAGTAACATCATCACCACAGCCAGGA pRSF-R ATACGAATGTTGTTTGACATGTGATGGCTGCTGCCCATGG aspA-F ATGTCAAACAACATTCGTAT aspA-R TTACTGTTCGCTTTCATCAG fliA-F1 ATAACGCAGGGCTGTTTATCGGAATTGTGAGCGGATAACA fliA-R1 ATTAGTGGGTGAAATGAGGGATTTCGCGGGATCGAGATCG fliC-F1 GCGATTGAGCCGACGGGTGGGGAATTGTGAGCGGATAACA fliC-R1 TTTCAAAAACAGCCATTTTTATTTCGCGGGATCGAGATCG flgC-F1 TTGATACCTGCGGAGGAGATGGAATTGTGAGCGGATAACA flgC-R1 GAATAAACGCAAAATGGGTCATTTCGCGGGATCGAGATCG fliA-F2 ATAACGCAGGGCTGTTTATCGGAATTGTGAGCGGATAACA fliA-R2 ATTAGTGGGTGAAATGAGGGATTTCGATTATGCGGCCGTG fliC-F2 GCGATTGAGCCGACGGGTGGGGAATTGTGAGCGGATAACA fliC-R2 TTTCAAAAACAGCCATTTTTATTTCGATTATGCGGCCGTG flgC-F2 TTGATACCTGCGGAGGAGATGGAATTGTGAGCGGATAACA flgC-R2 GAATAAACGCAAAATGGGTCATTTCGATTATGCGGCCGTG

[0063] Example 2. Fermentation of Escherichia coli engineering strain to produce ectoine (ECT)

[0064] The specific method is as follows:

[0065] (1) The composition of the batch fermentation medium is: Na 2 HPO 4 ·12H 2 O 17.9 g / L, KH 2 PO 4 3.1 g / L, NH4 Cl₂ 2.0 g / L, (NH 4 ) 2 HPO 4 1.0 g / L, trisodium citrate dihydrate 2.2 g / L, yeast extract 2.0 g / L, glycerol 30 g / L, tryptone 15 g / L, adjust the pH to 7.0, and make up the volume with deionized water.

[0066] (2) Pick a single colony of the genetically engineered bacterium producing ectoine and transfer it into a 250 mL round-bottomed Erlenmeyer flask containing the batch fermentation seed medium. Use 50 mL of the seed medium, and culture it at 37 °C and 220 rpm / min for 6 h. The seed medium is LB broth.

[0067] (3) Conduct batch fermentation culture. Inoculate the seed culture into a 1.5 L shake flask containing 100 mL of the batch fermentation medium at an inoculation amount of 20%. Add 1 mL of trace elements simultaneously during inoculation, culture at 37 °C for 6 h, and add 150 mL of 0.2 mmol / L IPTG for induction culture at 37 °C. The composition of the trace elements is: ammonium ferric citrate 5.6 g / L, zinc sulfate heptahydrate 0.9 g / L, CoCl 2 ·6H 2 O 0.2 g / L, manganese chloride tetrahydrate 1.0 g / L, CuCl 2 ·2H 2 O 0.10 g / L, boric acid 0.2 g / L, Na 2 MoO 4 ·2H 2 O 0.2 g / L.

[0068] (4) Centrifuge the fermentation broth and determine the concentration of ectoine by high performance liquid chromatography. The ectoine yields of different engineered strains are shown in Table 2.

[0069] Table 2

[0070]

[0071]

[0072] As can be seen from Table 2, the expression effect of plasmid pRSF-ectABC-lysC-aspA is significantly better than that of plasmid pRSF-ectABC. That is, overexpressing the gene cluster ectABC, aspartokinase gene lysC, and aspartate ammonia-lyase gene aspA in the engineered Escherichia coli bacteria to construct the biological metabolic pathway of ectoine in the bacteria, while realizing the heterologous synthesis of ectoine, further improving the yield of ectoine; moreover, it was found that the yield was significantly limited in the strain ECT-03 lacking both lysA and metL genes, but after strengthening the pathway construction, the yield was significantly increased (ECT-06), indicating that on the basis of overexpressing the gene cluster ectABC, co-expressing lysC and aspA can further increase the yield of ectoine; in addition, by gene complementation in the strain lacking lysA and metL genes and controlling the expression level of the gene with a growth-dependent promoter, an increase in the ECT yield was obtained. Complementation after deletion of the single gene lysA or metL improved the ECT yield to a certain extent, and the yield was further increased after defect complementation of the two genes. Among the replaced growth-dependent promoters fliA, fliC, and flgC, regulation by the fliC or flgC promoter had a more significant effect on increasing the yield of ectoine.

[0073] In summary, the present invention uses Escherichia coli BL21(DE3) as the starting strain, overexpresses the gene cluster ectABC, aspartokinase gene lysC, and aspartate ammonia-lyase gene aspA, and uses the growth-dependent promoters fliA, fliC, and flgC to regulate the expression levels of the diaminopimelate decarboxylase gene lysA and the homoserine dehydrogenase gene metL, respectively. This combined regulation realizes the heterologous expression of ectoine, and while not affecting the production of key amino acids to meet the growth of the bacteria, effectively improves the yield of ectoine.

[0074] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. An Escherichia coli engineered strain for producing ectoine, characterized in that, the expression of the diaminopimelate decarboxylase gene lysA and / or the homoserine dehydrogenase gene metL of the Escherichia coli engineered strain is regulated by growth-dependent promoters respectively; the Escherichia coli engineered strain overexpresses a recombinant gene, and the recombinant gene includes the gene cluster ectABC; the starting strain of the Escherichia coli engineered strain is Escherichia coli BL21(DE3), and the genotype of the Escherichia coli BL21(DE3) is E.coli BL21(DE3)ΔlysA, E.coli BL21(DE3)ΔmetL or E.coli BL21(DE3)ΔlysAΔmetL; the recombinant gene further includes the aspartokinase gene lysC and the aspartate ammonia-lyase gene aspA; the growth-dependent promoters include the fliA, fliC, and flgC promoters; the method for regulating the expression of the diaminopimelate decarboxylase gene lysA and / or the homoserine dehydrogenase gene metL by growth-dependent promoters respectively is any one of the following (1)-(3): (1) When the genotype of the Escherichia coli BL21(DE3) is E.coli BL21(DE3)ΔlysA, fliC or flgC is used to regulate the complementation of lysA; (2) When the genotype of the Escherichia coli BL21(DE3) is E.coli BL21(DE3)ΔmetL, fliA, fliC or flgC is used to regulate the complementation of metL; (3) When the genotype of the Escherichia coli BL21(DE3) is E.coli BL21(DE3)ΔlysAΔmetL, fliA, fliC or flgC is used to regulate the complementation of lysA and metL simultaneously.

2. The Escherichia coli engineered strain according to claim 1, characterized in that, the nucleotide sequence of the fliA promoter is as shown in SEQ ID NO: 1, the nucleotide sequence of the fliC promoter is as shown in SEQ ID NO: 2, and the nucleotide sequence of the flgC promoter is as shown in SEQ ID NO:

3.

3. The Escherichia coli engineered strain according to claim 1, characterized in that, the expression vector of the recombinant gene is pRSFDuet-1.

4. The Escherichia coli engineered strain according to claim 1, characterized in that, the specific process of regulating the expression of the diaminopimelate decarboxylase gene lysA and the homoserine dehydrogenase gene metL by growth-dependent promoters respectively is: integrating the diaminopimelate decarboxylase gene lysA derived from Escherichia coli and / or the homoserine dehydrogenase gene metL derived from Escherichia coli into the MCS I region and / or the MCS II region of the pETDuet-1 expression vector, and replacing the T7 promoter in the gene integration region with a growth promoter by homologous recombination.

5. The construction method of the Escherichia coli engineered strain for producing ectoine according to any one of claims 1-4, characterized in that, it includes the following steps: (1) Integrate the recombinant gene into an expression vector to construct recombinant expression vector I; (2) Integrate the diaminopimelate decarboxylase gene lysA from Escherichia coli and / or the homoserine dehydrogenase gene metL from Escherichia coli into the MCS I region and / or the MCS II region of the pETDuet-1 expression vector, and replace the T7 promoter in the gene integration region with a growth-type promoter by homologous recombination to construct recombinant expression vector II; (3) Transfer the above recombinant expression vectors I and II into the Escherichia coli starting strain in step to obtain the Escherichia coli engineering bacterium.

6. Use of the Escherichia coli engineering bacterium according to any one of claims 1-4 in the production of ectoine.

7. According to the use described in claim 6, characterized in that the production comprises the following steps: (1) Seed culture: Activate the Escherichia coli engineering bacterium, pick a single colony and inoculate it into a seed medium, and culture it at 35-39 °C and 200-240 rpm for 5-7 h; (2) Fermentation culture: Inoculate the seed culture into a batch fermentation medium at an inoculation amount of 20%, add 1 mL of trace elements, culture it at 35-39 °C for 5-7 h, add 150 ml of 0.2 mmol / L IPTG and induce culture at 35-39 °C to obtain it; The components of the batch fermentation medium are: Na 2 HPO 4 ·12H 2 O 17.9 g / L, KH 2 PO 4 3.1 g / L, NH 4 Cl 2.0 g / L, (NH 4 ) 2 HPO 4 1.0 g / L, trisodium citrate dihydrate 2.2 g / L, yeast extract 2.0 g / L, glycerol 30 g / L, tryptone 15 g / L, and adjust the pH to 7.0; The trace element components are: ammonium ferric citrate 5.6 g / L, zinc sulfate heptahydrate 0.9 g / L, CoCl 2 ·6H 2 O 0.2 g / L, manganese chloride tetrahydrate 1.0 g / L, CuCl 2 ·2H 2 O 0.10 g / L, boric acid 0.2 g / L, Na 2 MoO 4 ·2H 2 O 0.2 g / L.

Citation Information

Patent Citations

  • Genetically engineered bacterium producing tetrahydropyrimidine and structuring method and application thereof

    CN105018403A

  • Genetically engineered bacterium for high yield of ectoine and application thereof

    CN112961815A