Method for regulating rice plant type

Abstract

The application belongs to the field of plant biotechnology, and particularly relates to a method for regulating rice plant type by pri-miRNA coding peptide. The application aims to provide a new option for regulating rice plant type. The technical scheme of the application is a method for regulating rice plant type by pri-miRNA coding peptide, which is realized by blocking or weakening the expression of a pri-miRNA coding peptide gene OsmiPEP162a in rice. The application provides a rice pri-miRNA coding peptide (miPEP) that can be used for regulating plant type, and a knock-out rice miPEP gene (OsmiPEP162a) is obtained, and an edited mutant with changed plant type is obtained.

Description

Technical Field

[0001] This invention belongs to the field of plant biotechnology, specifically relating to a method for regulating rice plant architecture. Background Technology

[0002] Plant architecture is a comprehensive expression of agronomic traits, mainly including plant height, tillering, leaf shape, leaf angle, and panicle characteristics. Plant architecture is one of the core factors determining the yield of crops such as rice and is an important indicator for variety breeding. In particular, plant height is not only a key factor in crop adaptation to different environments, but also the most important factor in crop yield and lodging resistance. Currently, the National Rice Data Center has collected / annotated 21 genes related to rice plant architecture, of which 18 genes belong to the biosynthesis and signaling pathways of hormones such as gibberellin, brassinolide, and stigmasterone (https: / / www.ricedata.cn / gene / gene_sd.htm).

[0003] MicroRNAs (miRNAs) are endogenous small RNAs, 20–24 nucleotides in length, and are crucial post-transcriptional regulators that control gene expression by inducing the degradation of target gene mRNAs or inhibiting the translation of target genes. Previous studies considered pri-miRNAs, the primary transcripts derived from mature miRNAs, to be non-protein-coding RNAs. However, recent research in Arabidopsis thaliana has shown that some miRNA primary transcripts, pri-miRNAs, contain small open reading frames (ORFs) that encode functional peptides (miRNA-encoded peptides, miPEPs). Studies have shown a positive correlation between miPEP expression and miRNA expression. miPEPs shuttle from the translated cytoplasm back to the nucleus, specifically enhancing the transcription of their pri-miRNAs, thereby increasing the accumulation of the corresponding mature miRNAs, without affecting the expression of other miRNAs, even those within the same family. The activity and specificity of miPEPs depend on their coding sequence (miORF). Deletion of the miORF from pri-miRNAs prevents miPEPs from inducing pri-miRNA transcription. miPEPs participate in plant growth and development regulation, secondary metabolite regulation, and abiotic stress response by altering the expression patterns of target genes through the regulation of corresponding miRNA expression. Currently, more than 600 pri-miRNAs are known from the public database (miRBase, http: / / www.mirbase.org). Whether these pri-miRNAs truly encode protein peptides (ORFs) and whether they contain rice miPEPs that regulate plant architecture remains unresearched. Summary of the Invention

[0004] The technical problem to be solved by this invention is to provide a new option for regulating rice plant architecture.

[0005] The technical solution of the present invention is a method for regulating rice plant architecture, which is achieved by blocking or weakening the expression of the pri-miRNA-encoded peptide gene OsmiPEP162a in rice.

[0006] Specifically, the regulation of rice plant type involves reducing plant height and / or increasing the number of tillers.

[0007] Furthermore, the method of blocking or weakening the expression of the pri-miRNA-encoded peptide gene OsmiPEP162a in rice is to knock out the OsmiPEP162a gene or interfere with the expression of the OsmiPEP162a gene.

[0008] The method for knocking out the OsmiPEP162a gene is at least one of genome editing, homologous recombination, or random insertion mutation.

[0009] Furthermore, the genome editing method includes at least one of the following: giant nuclease method, ZFN method, TALEN method, or CRISPR-Cas method.

[0010] Specifically, the CRISPR-Cas method includes the following steps:

[0011] a. Design sgRNA targeting the OsmiPEP162a gene;

[0012] b. Construct a Cas editing expression vector that expresses sgRNA;

[0013] c. Transform the Cas editing expression vector into rice.

[0014] The CRISPR-Cas method is CRISPR-Cas9, CRISPR-Cas12a, or CRISPR-Cas12b.

[0015] Specifically, the sgRNA sequence is shown in SEQ ID No. 1.

[0016] Preferably, the expression vector is pZHY988.

[0017] Specifically, in step c, the rice is transformed using the Agrobacterium-mediated transformation method.

[0018] This invention also provides a method for regulating seed traits, achieved by blocking or weakening the expression of the pri-miRNA-encoded peptide gene OsmiPEP162a in rice.

[0019] Furthermore, the negative regulation is achieved by blocking or weakening the expression of the pri-miRNA-encoded peptide gene OsmiPEP162a in rice.

[0020] Furthermore, the method of blocking or weakening the expression of the pri-miRNA-encoded peptide gene OsmiPEP162a in rice is to knock out the OsmiPEP162a gene or interfere with the expression of the OsmiPEP162a gene.

[0021] The method for knocking out the OsmiPEP162a gene is at least one of genome editing, homologous recombination, or random insertion mutation.

[0022] Furthermore, the genome editing method includes at least one of the following: giant nuclease method, ZFN method, TALEN method, or CRISPR-Cas method.

[0023] Specifically, the CRISPR-Cas method includes the following steps:

[0024] a. Design sgRNA targeting the OsmiPEP162a gene;

[0025] b. Construct a Cas editing expression vector that expresses sgRNA;

[0026] c. Transform the Cas editing expression vector into rice.

[0027] The CRISPR-Cas method is CRISPR-Cas9, CRISPR-Cas12a, or CRISPR-Cas12b.

[0028] Specifically, the sgRNA sequence is shown in SEQ ID No. 1.

[0029] Preferably, the expression vector is pZHY988.

[0030] Specifically, the seed traits are seed length and width.

[0031] The present invention also provides sgRNA targeting the OsmiPEP162a gene, as shown in SEQ ID No. 1.

[0032] Furthermore, the sgRNA is suitable for the CRISPR-Cas9 gene editing system.

[0033] The present invention also provides a vector for expressing the above-mentioned sgRNA targeting the OsmiPEP162a gene.

[0034] Furthermore, the carrier is an expression carrier.

[0035] Preferably, the expression vector is pZHY988.

[0036] The present invention also provides the use of the above-mentioned sgRNA or the vector expressing the above-mentioned sgRNA targeting the OsmiPEP162a gene in regulating rice plant architecture or seed traits.

[0037] The beneficial effects of this invention are as follows: This invention provides a rice pri-miRNA-encoded peptide (miPEP) that can be used to regulate plant architecture. Based on a protoplast transient expression system, miPEPs that truly encode proteins were screened and identified, and the miPEP gene was then directionally edited using a gene editing system. Results showed that knocking out the rice miPEP gene (OsmiPEP162a) yielded an edited mutant with altered plant architecture. This invention provides ideal material for studying the function of the rice OsmiPEP162a gene. Furthermore, this invention also provides a foundation for accurate targets in rice targeted editing breeding. Attached Figure Description

[0038] Figure 1 Analysis of pri-miRNAs in rice. 380 pri-miRNAs without peptide annotation were found in the MSU and RAP-DB databases, while 224 pri-miRNAs had peptide annotations.

[0039] Figure 2 Schematic diagram of some miPEP transient expression vectors. (a) Backbone vector; (b) miPEP transient expression vector.

[0040] Figure 3 Transient fluorescence spectrum of partial pri-miRNA fusion fluorescent protein. Negative control: backbone vector pLSD298; positive control: pZHZ669 vector (GFP initiated by pZmUbi1).

[0041] Figure 4 Schematic diagram of the CRISPR-Cas9 targeted knockout vector structure targeting miPEP162a. (a) Backbone vector pZHY988; (b) miPEP targeted knockout vector constructed based on the CRISPR-Cas9 system.

[0042] Figure 5 Phenotypic diagram of OsmiPEP162a knockout mutant. (a) Genotype of OsmiPEP162a mutant. Underlined lines indicate sgRNA locations, red letters indicate PAM sites, and lowercase blue letters indicate inserted bases; (b) Amino acid sequence alignment of OsmiPEP162a-KO-1 mutant; (c) Plant height of OsmiPEP162a mutant, scale bar = 20cm; (d) Plant height statistics of OsmiPEP162a mutant; (e) Seed size of OsmiPEP162a mutant, scale bar = 1cm. Detailed Implementation

[0043] To achieve regulation of rice plant architecture, the applicant chose to utilize pri-miRNAs in rice. After preliminary analysis of 604 pri-miRNA sites in publicly available databases, 20 were initially identified as research subjects. During the initial screening, to shorten the research cycle, the applicant constructed a vector suitable for transient expression and performed protoplast transformation. Significant fluorescent signals were observed in 10 pri-miRNA transformants, indicating their ability to express miPEP. Based on the transient expression results, pri-miR162a was selected for subsequent experiments.

[0044] To confirm its function, the applicant considered knocking out its expression for testing. Knockout methods could include genome editing, homologous recombination, or random insertion mutation. In one embodiment, the CRISPR-Cas9 system was chosen to knock out pri-miR162a. Transforming the constructed knockout expression vector into rice resulted in mutant plants with reduced plant height, increased tiller number, and increased seed length and width, but other agronomic traits such as spikelet number, grain number per spike, and seed setting rate showed no significant changes. This indicates that pri-miR162a can regulate rice plant architecture.

[0045] Example 1: Transient expression of OsmiPEP

[0046] Based on the rice miRNA sites already recorded in the miRBase database, we searched for pri-miRNAs with peptide annotations in the rice genome in the MSU (http: / / rice.uga.edu / ) and RAP-DB (https: / / rapdb.dna.affrc.go.jp / ) databases. A total of 604 pri-miRNAs were found in rice; 224 pri-miRNAs (37% of all pri-miRNAs) were found to have peptide annotations, while 380 pri-miRNAs (63% of all pri-miRNAs) did not have peptide annotations. Figure 1 ).

[0047] (1) Construction of transient expression carriers

[0048] Transient expression vector construction using pLSD298 as the backbone vector ( Figure 2 The maize ubiquitin promoter ZmUbi1 is a strongly expressed constitutive promoter used to drive the expression of target genes; the cauliflower mosaic virus promoter (p35S) drives the expression of the hygromycin resistance gene, which is used to screen for resistant rice callus.

[0049] Rice pri-miRNA sequences were retrieved and downloaded from MSU (http: / / rice.uga.edu / ) and RAP-DB (https: / / rapdb.dna.affrc.go.jp / ).

[0050] First, all 604 rice pri-miRNAs were analyzed, and those with annotated ORFs were selected for further analysis. Second, the research progress on the formation of mature miRNAs from annotated ORFs was reviewed. Finally, 21 pri-miRNAs were selected for the next stage of experiments. Primers were synthesized for the precursor pri-miRNA (transcription initiation to before the stop codon encoding peptide) and GFP (without ATG) sequences of OsMIR162a (MIR162a-F: gttgtttggtgttacttCTGCAGcctgcaggAGAAAGATTCCTAGTCCTCCTCTC; MIR162a-R: gTGAACAGCTCCTCGCCCTTGCTCACCATACAAGCACCGAGCATATAATTGATA). Partial sequences of pri-miRNAs and GFP sequences without the start codon ATG were amplified by PCR. The amplification system (50 μL) was as follows: 10×KOD Plus Neo Buffer 5 μL, 2 mM dNTPs 5 μL, Mg 2+ 3 μL of KOD-Plus-Neo, 1 μL of Primer-Forward, 1 μL of Primer-Reverse, 1 μL of template, and 33 μL of ddH2O were added. The amplification program was 95℃, 3 min → (95℃, 30 sec → 57℃, 30 sec → 68℃) × 40 Cycles → 68℃, 5 min → 4℃, 10 min. The extension time was determined according to the length of the amplified fragment. The amplified products were subjected to agarose gel electrophoresis, and the target fragment was recovered.

[0051] Meanwhile, the backbone vector pLSD298 was digested with the restriction endonuclease BsmBI at 50℃ for 2 hours. The digestion system was as follows: NEB Buffer 3.1 5μL, pLSD298 5μL, BsmBI 1μL, ddH2O 39μL.

[0052] The enzyme digestion product and the GFP gel recovery product were ligated using T4 DNA ligase, and the ligation product was named pHQQ001. pHQQ001 and the pri-miRNA gel recovery product were then assembled using Golden Gate assembly. The Golden Gate system was as follows: 10×T4 DNA Ligase Buffer 2 μL, T4 DNA Ligase 1 μL, BsaⅠ 1 μL, pHQQ001 1 μL, pri-miRNA gel recovery product 2 μL, ddH2O 13 μL. The assembly conditions were (37℃, 5 min → 16℃, 10 min) × 15 Cycles → 37℃, 5 min → 65℃, 10 min → 12℃, 10 min.

[0053] Thaw *E. coli* DH5α competent cells on ice, add 20 μL of the ligation product, mix well, and incubate on ice for 30 min. Heat shock at 42℃ for 1 min, then incubate on ice for 2 min. Add 500 μL of LB liquid medium and incubate at 37℃ with shaking at 200 rpm for 45 min. Centrifuge at 12000 rpm for 2 min, discard 400 μL of supernatant, and gently resuspend the cells by pipetting. Spread the entire bacterial culture onto LB solid medium (containing 50 mg / L Kan), incubate upright at 37℃ for 1 h, then invert for 12–16 h. Pick resistant single colonies, inoculate for expansion culture, and send the bacterial culture to Chengdu Qingke Biotechnology Co., Ltd. for sequencing. The miPEP162a transient expression vector was successfully constructed. Figure 2 After successful sequencing, plasmids were extracted using the AxyPrep Plasmid Medium Extraction Kit manufactured by Axygen. The other 20 miRPEPs were constructed using the same method.

[0054] (2) Rice protoplast transformation

[0055] Take rice etiolated seedlings cultured in the dark for 10 days, cut them into particles of about 1 mm with a sterile blade, and transfer them to a petri dish. Add 10 mL of enzyme solution and gently shake to mix the enzyme solution with the seedling particles. Place the petri dish in a vacuum desiccator and vacuum for 30 minutes with the lid off to ensure the seedling particles are fully in contact with the enzyme solution. Seal the petri dish with sealing film, place it on a shaker for digestion, and cover it with aluminum foil. The shaker speed is 60-80 rpm, and digestion lasts for 6-7 hours. After digestion, take a 40 μm filter screen and moisten it with 2 mL of W5 Buffer. Squeeze the seedling particles repeatedly with a pipette tip, and carefully transfer the liquid from the petri dish to the filter screen for filtration. The liquid should be slowly and continuously pipetted out. Add 5 mL of W5 Buffer to the petri dish, continue to squeeze the seedling particles, and transfer them to the filter screen for filtration. Repeat this process three times. Transfer 30 mL of filtrate to a 50 mL centrifuge tube, centrifuge at 100 × g for 5 minutes, and discard the supernatant. Add 2 mL of W5 Buffer to resuspend the cell pellet, then add 8 mL of W5 Buffer, mix well, centrifuge at 100×g for 5 min, and discard the supernatant. Add 1 mL of W5 Buffer to resuspend the cell pellet, then add 4 mL of W5 Buffer, mix well, take 100 μL of the cell suspension for cell counting, centrifuge the remaining cell suspension at 100×g for 5 min, and discard the supernatant. Add 5×10 -7 Resuspend cells in MMG Buffer to a multiple of the cell count. In a 2 mL centrifuge tube, add 30 μg of plasmid and 30 μL of MMG Buffer (total 30 μL), then add 200 μL of cell suspension. Add 230 μL of 40% PEG4000, mix gently, and incubate for 30 min. Add 1 mL of W5 Buffer and mix gently to stop the reaction. Centrifuge at 250 × g for 5 min and discard the supernatant. Add 1.5 mL of W5 Buffer to a six-well plate. Transfer 500 μL of W5 Buffer from the six-well plate, mix the cells by pipetting, and transfer the entire cell suspension to the six-well plate. Seal the six-well plate with sealing film, wrap it with aluminum foil, and incubate in the dark at 32°C for 24 h. Observation and image acquisition are then performed using an inverted fluorescence microscope, and fluorescence intensity analysis is performed using ImageJ. The results showed that no obvious fluorescence signal was observed in 11 pri-miRNAs, including pri-miR160a and pri-miR160d, while obvious fluorescence signals were observed in 10 pri-miRNAs, including pri-miR159a and pri-miR162a, indicating that pri-miRNAs such as pri-miR159a and pri-miR162a can express miPEP (…). Figure 3 ), and targeted knockout of 10 miPEPs that can be expressed.

[0056] Example 2: Construction of OsmiPEP Directed Knockout Vector

[0057] (1) sgRNA design

[0058] For pri-miR162a, sgRNAs were designed in the coding region of the gene based on the target site recognition and cleavage rules of the CRISPR-Cas9 system. Then, the mismatch rate and off-target sites of the sgRNAs were predicted online using the CRISPR-P website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and the optimal sgRNA (shown in SEQ ID No. 1) was selected to knock out miPEP162a. Using the restriction enzyme sites of the knockout vector pZHY988 used in this invention, a BsaI restriction site was added to the 5' end of the sgRNA, and two single-stranded nucleotide sequences with annealed sticky ends (the sequences are shown in SEQ ID No. 2 and SEQ ID No. 3) were designed and synthesized by Shanghai Sangon Biotech Co., Ltd.

[0059] The designed sgRNA sequence (used to edit the CRISPR-Cas9 guide RNA that knocks out the OsmiPEP162a gene) SEQ ID No. 1: GCACAAUGUCUCUAUUGCUG;

[0060] Synthesized single-stranded nucleotide sequence of SEQ ID No. 2 (for constructing the OsmiPEP162a knockout vector)

[0061] sg162a-F:GTGTGCACAATGTCTCTATTGCTG;

[0062] Synthesized single-stranded nucleotide sequence of SEQ ID No. 3 (for constructing the OsmiPEP162a knockout vector)

[0063] sg162a-R:aaacCAGCAATAGAGACATTGTGC.

[0064] (2) Ligation reaction and plasmid transformation of competent Escherichia coli cells

[0065] Each pair of single-stranded nucleotide sequences was diluted 10-fold, and 10 μL of each was mixed and denatured at 98°C for 5 min. After natural cooling, the annealed product was diluted 20-fold and set aside. The annealed product was used to assemble sgRNA into the vector pZHY988 via the Golden Gate reaction system and procedure, as in Example 1. The plasmid was transformed into competent E. coli cells as in Example 1.

[0066] (3) Colony PCR and plasmid extraction and sequencing verification

[0067] Single clones were picked from LB agar plates using sterile toothpicks and placed in water containing 50 μL ddH2O. 1 μL of this bacterial culture was used as a template for PCR amplification. A 25 μL system was used, containing: 2.5 μL 10×PCR Buffer, 0.5 μL dNTPs, 0.5 μL sg162a-F, 0.5 μL ZY065-RB (SEQ ID No. 8), 0.2 μL Taq DNA enzyme, 1 μL Template, and 19.8 μL ddH2O. The PCR program was: 94℃, 2 min → (94℃, 30 s → 55℃, 30 s → 72℃, 30 s) 35 cycles → 72℃, 5 min → 4℃, 10 min (Taq DNA enzyme, dNTPs, etc., were purchased from Tiangen Biotech). After PCR, add 5 μL of 6× bromophenol blue and perform electrophoresis on a 1% agarose gel at 130V for 30 min.

[0068] SEQ ID No. 8 is used for colony-positive detection.

[0069] ZY065-RB: TTCTAATAAACGCTCTTTTCCT

[0070] For single clones verified by colony PCR, 50 μL of bacterial culture was inoculated into LB broth containing 50 mg / L Kans and cultured for 12–16 h. Plasmids were then extracted. Plasmid DNA extraction was performed according to the AXYGEN AxyPrep™ Plasmid Miniprep Kit instructions. The extracted plasmids were sent to Qingke Biotechnology Co., Ltd. for sequencing verification. A directed editing expression vector pHQQ042 targeting the rice OsmiPEP162a encoding gene was obtained. Figure 4 The other nine miPEPs were knocked out in the same way.

[0071] Example 3 Agrobacterium-mediated genetic transformation of rice

[0072] The experimental method for Agrobacterium-mediated transformation of rice is described in the reference Tang X, Lowder LG, Zhang T, Malzahn A, Zheng X, Voytas DF, Zhong Z, Chen Y, Ren Q, Li Q, Kirkland ER, Zhang Y, Qi Y. 2017. ACRISPR-Cpf1 system for efficient genome editing and transcriptional repression in plants. Nature Plants, 3:17018.

[0073] The specific steps of genetic transformation in rice are as follows: Mature rice (Nipponbare) seeds are dehulled and sterilized; the sterilized seeds are inoculated onto N-6-D solid medium containing 0.4% gellan gum and cultured at 32°C under continuous light for 1–5 days; the cultured seeds are transformed into rice using Agrobacterium-mediated transformation to transfer plasmid pHQQ042; the transformed rice seeds are then cultured at 32°C under continuous light for 2 weeks in an induction and selection medium; the resulting callus tissue is transferred to RE-III medium; the young plantlets from the callus tissue are transferred to HF medium to induce root development. When the obtained resistant regenerated seedlings reach approximately 15 cm in length, the root culture medium is washed off with water, and the seedlings are transplanted into nutrient soil for greenhouse cultivation.

[0074] Example 4 Identification of rice OsmiPEP mutant

[0075] (1) Extraction of genomic DNA from rice seedlings

[0076] DNA extraction from rice seedlings was performed using the CTAB method. The specific steps are as follows:

[0077] Preheat the CTAB extraction buffer in a 65°C water bath. Place approximately 2cm of plant leaf into a 2mL centrifuge tube containing two steel balls, flash-freeze in liquid nitrogen, and shake until powdery. Add 600μL of preheated CTAB extraction buffer, incubate at 65°C for 30min, and invert and shake for 15min to fully lyse the plant leaf. Add 500μL of chloroform:isoamyl alcohol (24:1), mix well, and centrifuge at 12000rpm for 10min. Transfer the supernatant to a new 1.5mL centrifuge tube, add 500μL of isopropanol, mix well, and incubate at -20°C for at least 1 hour. Centrifuge at 12000rpm for 10min and discard the supernatant. Air-dry the DNA. Dissolve the DNA in 50μL of ddH2O and store at -20°C for later use.

[0078] (2) Detection of genetically modified rice seedlings

[0079] The target fragment was amplified using specific primers dcas9-F (primer sequence as shown in SEQ ID No. 4) and dcas9-R (primer sequence as shown in SEQ ID No. 5) to detect transgene positivity. The amplified fragment size was 684 bp. The PCR amplification system and reaction procedure were the same as the previous colony PCR.

[0080] SEQ ID No. 4 upstream primer for positive detection of genetically modified organisms

[0081] dcas9-F:GGGCTGATCCTAAGAAGAAGAGGAA;

[0082] SEQ ID No. 5 downstream primer for positive detection of genetically modified organisms

[0083] dcas9-R: CGCAGTAATGCCAACTTTGTAC.

[0084] (3) Identification of mutant genotypes and phenotypes

[0085] The positive plants obtained from the test were subjected to PCR using specific primer pairs (primer sequences as shown in SEQ ID No. 6 and SEQ ID No. 7), and the PCR products were sent for Sanger sequencing. The PCR amplification system and reaction procedure were the same as before. The OsmiPE162a knockout mutant was obtained, with a genotype of +1bp / +1bp. Figure 5 a) The amino acid length changed from 71 to 43, with only 8 corresponding amino acids being the same. Figure 5 b). Agronomical trait observations of the mutant revealed that the OsmiPEP162a mutant had decreased plant height, increased tiller number, and increased seed length and width. Figure 5 While the number of spikelets, grains per spike, and seed setting rate showed no significant changes, other agronomic traits such as spikelet number, grain number per spike, and seed setting rate did not change significantly. Agronomic traits of the other nine miPEPs have not yet been observed.

[0086] SEQ ID No. 6 Upstream primer sequence for mutant detection

[0087] 22-162a-F: GACATTATTCGATGCTTCCTACAGG;

[0088] SEQ ID No. 7 Downstream primer sequence for mutant detection

[0089] 22-162a-R:CGGCAGATCCACTTAACTTCAC.

Claims

1. A method for regulating rice plant architecture, characterized by: This is achieved by blocking or attenuating the expression of the pri-miRNA-encoded peptide gene OsmiPEP162a in rice; the regulation of rice plant architecture is to reduce plant height and / or increase tiller number; the method of blocking or attenuating the expression of the pri-miRNA-encoded peptide gene OsmiPEP162a in rice is to knock out the OsmiPEP162a gene using the CRISPR-Cas method; the CRISPR-Cas method includes the following steps: a. Design an sgRNA targeting the OsmiPEP162a gene; the sgRNA sequence is shown in SEQ ID No. 1; b. Construct a Cas editing expression vector that expresses sgRNA; c. Transform the Cas editing expression vector into rice.

2. The method according to claim 1, characterized in that: The CRISPR-Cas method is CRISPR-Cas9, CRISPR-Cas12a, or CRISPR-Cas12b.

3. The method according to claim 1, characterized in that: The expression vector is pZHY988.

4. The method according to claim 1, characterized in that: In step c, the transformed rice is transformed using the Agrobacterium-mediated transformation method.

5. A method for regulating rice seed traits, characterized in that: This is achieved by blocking or attenuating the expression of the pri-miRNA-encoded peptide gene OsmiPEP162a in rice; the regulation of rice seed traits is to increase seed length and width; the method of blocking or attenuating the expression of the pri-miRNA-encoded peptide gene OsmiPEP162a in rice is to knock out the OsmiPEP162a gene using the CRISPR-Cas method; the CRISPR-Cas method includes the following steps: a. Design sgRNA targeting the OsmiPEP162a gene; b. Construct a Cas editing expression vector expressing sgRNA; the sgRNA sequence is shown in SEQ ID No. 1; c. Transform the Cas editing expression vector into rice.

6. The method according to claim 5, characterized in that: The CRISPR-Cas method is CRISPR-Cas9, CRISPR-Cas12a, or CRISPR-Cas12b.

7. The method according to claim 5, characterized in that: The expression vector is pZHY988.

8. The method according to claim 5, characterized in that: In step c, the transformed rice is transformed using the Agrobacterium-mediated transformation method.

9. An sgRNA targeting the OsmiPEP162a gene, characterized by: Its nucleotide sequence is shown in SEQ ID No.

1.

10. A vector expressing the sgRNA of claim 9 targeting the OsmiPEP162a gene.

11. The use of the sgRNA of claim 9 or the vector of claim 10 in regulating rice plant architecture or rice seed traits, characterized in that: The regulation of rice plant type is to reduce plant height and / or increase tiller number; the regulation of rice seed traits is to increase seed length and width.

Images