Hybridoma cell strain, anti-hp monoclonal antibody and application thereof
By developing the hybridoma cell line OTI2C8 and preparing anti-Hp monoclonal antibodies, the problems of insufficient sensitivity and specificity in the detection of Helicobacter pylori (Hp) have been solved, achieving efficient immunohistochemical detection, which is suitable for accurate diagnosis of Hp infection.
Patent Information
- Application Number
- CN202410022563.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-08
- Publication Date
- 2026-07-03
- Estimated Expiration
- 2044-01-08
AI Technical Summary
Existing technologies for detecting Helicobacter pylori (Hp) infection suffer from insufficient sensitivity and specificity. In particular, bacterial culture methods are highly demanding and easily affected by antibiotics, staining methods are difficult to detect at low concentrations, and while immunohistochemistry has advantages, it still needs improvement.
A hybridoma cell line, OTI2C8, was developed. An anti-Hp monoclonal antibody that specifically binds to Helicobacter pylori (Hp) was prepared. The hybridoma cell line was screened and the antibody was purified by recombinant expression of the FlaA protein of Hp. The antibody was then applied to immunohistochemical detection.
It significantly improves the specificity and sensitivity of Helicobacter pylori (Hp) detection, is applicable to the detection of Hp infection in various tissues, and provides a highly accurate and reliable detection tool.
Smart Images

Figure CN117821397B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and in particular relates to a hybridoma cell line, an anti-Hp monoclonal antibody, and their applications. Background Technology
[0002] Helicobacter pylori (Hp) is a Gram-negative bacillus with high pathogenicity and infection rate. It can be transmitted from person to person and has become a global public health problem. Family-based epidemiological studies of Hp show that the average Hp infection rate in individuals is 40.66%, with 43.45% in adults and 20.55% in children and adolescents. Family Hp infection rates in 29 provinces ranged from 50.27% to 85.06%, with an average infection rate of 71.21%. Hp infection is closely related to the occurrence of many digestive system diseases, such as various types of gastritis, peptic ulcers, gastric mucosa-associated lymphoid tissue lymphoma, and gastric cancer. It is the most important and controllable risk factor for gastric cancer prevention. According to current detection data, the detection rate of Hp in gastric ulcers is 70%-80%, and the detection rate in duodenal ulcers is approximately 90%. In gastritis caused by Helicobacter pylori (Hp) infection, 15-20% develop ulcerative lesions. Currently, various methods are available for detecting Hp infection, but each method has its own characteristics. Hp infection typically lacks clinical manifestations, and diagnosis relies primarily on laboratory testing. Bacterial culture is the gold standard for diagnosing Hp infection, but this method is technically demanding, and Hp morphology changes after antibiotic treatment, making bacterial culture impossible. Other staining methods include HE (Hematoxylin-eosin staining), Giemsa, WS silver staining, and basic fuchsin staining. However, these methods do not provide clear contrast between the bacteria and the surrounding tissue background, making it difficult to detect Hp under high magnification when the amount is small, and hindering slide interpretation. In contrast, immunohistochemistry (IHC) has high sensitivity; the bacteria appear brownish-yellow, while the tissue appears light blue, providing a significant color contrast that aids in diagnosis. Therefore, developing highly specific and sensitive anti-Hp monoclonal antibodies is crucial for the diagnosis of Helicobacter pylori (Hp) infection. Summary of the Invention
[0003] The present invention aims to provide a hybridoma cell line, an anti-Hp monoclonal antibody, and their applications, in order to provide a monoclonal antibody that specifically binds to Helicobacter pylori (Hp) and improve the specificity and sensitivity of Hp immunodetection.
[0004] To achieve the above objectives, the technical solution of the present invention is implemented as follows:
[0005] This invention provides a hybridoma cell line, named mouse anti-human HP monoclonal hybridoma cell line OTI2C8, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 45713, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, on September 6, 2023.
[0006] The anti-Hp monoclonal antibody is secreted by the hybridoma cell line OTI2C8.
[0007] The method for screening hybridoma cell lines and preparing monoclonal antibodies described in this invention is as follows:
[0008] (1) Construction of recombinant expression vector: Not all Helicobacter pylori (Hp) strains express urease, so it is crucial to identify conserved gene-encoded proteins as targets for monoclonal antibody development. The Fla gene is a conserved gene common to all Helicobacter pylori (Hp) strains, encoding flagellin composed of two subunits, FlaA and FlaB. Monoclonal antibodies can be developed using FlaA as a target. The antigenicity, hydrophilicity, and other characteristics of the FlaA protein were analyzed, and the full-length prokaryotic FlaA protein was designed as an immunogen (its corresponding nucleotide sequence is shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.2). Primers were designed, and restriction endonuclease sites SgfI and MluI were introduced on both sides of the gene, respectively. The gene was then inserted into the expression vector pET23a-N-His to construct the recombinant expression plasmid pET23a-rHp.
[0009] (2) Expression and purification of Helicobacter pylori Hp protein: The constructed recombinant expression plasmid of Helicobacter pylori Hp was transformed into E. coli cells, and the supernatant was obtained by lysis and centrifugation. The supernatant was purified by nickel affinity chromatography to obtain the purified recombinant Helicobacter pylori Hp FlaA protein.
[0010] (3) Screening of monoclonal antibody hybridoma cell lines and preparation of monoclonal antibodies secreted by them: BALB / c mice were immunized with the above-mentioned recombinant Helicobacter pylori Hp FlaA protein, mouse spleen cells were fused with sp2 / 0 cells, monoclonal antibodies were obtained by limiting dilution, positive hybridoma cells were screened by ELISA, and hybridoma cell lines that could secrete specific antibodies against Helicobacter pylori Hp FlaA protein were obtained and subtype identification was performed; antibodies were prepared by serum-free culture medium and purified by affinity chromatography column to obtain anti-Hp monoclonal antibodies.
[0011] Furthermore, the anti-Hp monoclonal antibody has a light chain variable region containing 105 amino acids, and its amino acid sequence is shown in SEQ ID NO. 3; its heavy chain variable region contains 112 amino acids, and its amino acid sequence is shown in SEQ ID NO. 7.
[0012] Furthermore, the anti-Hp monoclonal antibody includes CDR1, CDR2 and CDR3 in the light chain variable region, which are 27aa-32aa, 50aa-52aa and 89aa-94aa respectively, and their amino acid sequences are shown in SEQ ID NO.4-6 respectively.
[0013] Furthermore, the anti-Hp monoclonal antibody includes CDR1, CDR2 and CDR3 in the heavy chain variable region, which are 26aa-33aa, 51aa-58aa and 91aa-101aa respectively, and their amino acid sequences are shown in SEQ ID NO.8-10 respectively.
[0014] Furthermore, the anti-Hp monoclonal antibody can bind to Helicobacter pylori Hp with high specificity, and the sensitivity and specificity of the monoclonal antibody can be verified by immunoassay methods, such as immunohistochemistry (IHC).
[0015] Furthermore, the application of the anti-Hp monoclonal antibody in the preparation of immunoassay tools; preferably, the immunoassay tool is a reagent kit, chip, or test strip.
[0016] Furthermore, the anti-Hp monoclonal antibody is used in the preparation of an immunoassay tool; preferably, the immunoassay tool is used to detect Helicobacter pylori (Hp).
[0017] Furthermore, the anti-Hp monoclonal antibody is used in the preparation of a kit for labeling Helicobacter pylori (Hp) infected tissue; preferably, the tissue comprises gastric tissue infected with Helicobacter pylori (Hp).
[0018] An immunohistochemical detection kit, comprising an anti-Hp monoclonal antibody as described above, is used to detect Helicobacter pylori (Hp) infection in various tissues.
[0019] Compared with existing technologies, the hybridoma cell line OTI2C8, anti-Hp monoclonal antibody, and their applications described in this invention have the following advantages:
[0020] The hybridoma cell line OTI2C8 described in this invention can stably secrete anti-Hp monoclonal antibodies, which specifically bind to Helicobacter pylori (Hp), significantly improving the specificity, sensitivity, accuracy, and reliability of Hp immunodetection. It can be applied to the detection of Hp infection in various tissues. Attached Figure Description
[0021] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings:
[0022] Figure 1 The image shows the Western blot results of the recombinant Helicobacter pylori Hp FlaA protein as described in Example 2 of this invention. The expression of the recombinant FlaA protein in E. coli cells was detected using anti-HIS antibody. Lane L represents the detection results of E. coli cell lysate transfected with the empty vector as the antigen, and lane R represents the detection results of E. coli cell lysate transfected with pET23a-rHp plasmid as the antigen.
[0023] Figure 2 The image shown is an SDS-PAGE result of the FlaA protein described in Example 2 of this invention. The FlaA protein of recombinant Helicobacter pylori Hp was purified using a nickel affinity chromatography column. The purified protein was subjected to SDS-PAGE electrophoresis and Coomassie brilliant blue staining.
[0024] Figure 3 and Figure 4 This is a schematic diagram showing the results of IHC detection of two cases of gastritis tissue infected with Helicobacter pylori (Hp) using anti-Hp monoclonal antibodies secreted by the hybridoma cell line OTI2C8 described in Example 5 of the present invention. Detailed Implementation
[0025] Unless otherwise defined, the technical terms used in the following embodiments have the same meanings as commonly understood by those skilled in the art. Unless otherwise specified, the experimental reagents used in the following embodiments are conventional biochemical reagents; and the experimental methods described are conventional methods.
[0026] The present invention will now be described in detail with reference to the embodiments and accompanying drawings.
[0027] Example 1: Construction of a recombinant expression plasmid for Helicobacter pylori (Hp) protein
[0028] Based on the amino acid sequence characteristics of Helicobacter pylori (Hp), the amino acid fragment from position 1 to 510 of Hp was designed as an immunogen (its corresponding nucleotide sequence is shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.2). Primers were designed, and restriction endonuclease sites SgfI and MluI were introduced on both sides of the gene, respectively. The gene was inserted into the expression vector pET23a-N-His to construct the recombinant expression plasmid pET23a-rHp.
[0029] Example 2: Expression and purification of recombinant Helicobacter pylori Hp protein
[0030] 1. Experimental Methods
[0031] (1) Transformation of E. coli cells: After thawing 100 μl of competent cells on ice, add recombinant plasmid DNA and mix gently. Incubate on ice for 30 min, then heat shock at 42°C for 90 sec, and then continue to incubate on ice for 1-2 min. Add 500 μl of fresh antibiotic-free LB medium in a clean bench, incubate at 37°C on a shaker for 45 min, then take an appropriate amount of bacterial solution and spread it evenly on an antibiotic-containing plate. Invert the culture dish and incubate overnight in a 37°C constant temperature incubator.
[0032] (2) Cell lysis: Single clones were picked and cultured in fresh culture medium at 37°C and 200 rpm until the OD value reached 0.4–0.6. IPTG (final concentration 1 mM) was then added for induction culture for 7 hours. The cells were collected by centrifugation, resuspended in lysis buffer, sonicated for 20 min, and then centrifuged at 12000 rpm for 20 min at 4°C. The supernatant was collected. A small amount of supernatant protein was used for Western blotting with anti-His antibody. (See...) Figure 1 .
[0033] (3) Nickel affinity chromatography purification: The nickel column was equilibrated with buffer. The supernatant was filtered through a 0.45 μm filter membrane, loaded onto the column, and collected. Unbound proteins were washed with buffer to remove them. Finally, the column was eluted with elution buffer containing different concentrations of imidazole. The collected proteins were combined, and 10% glycerol was added. The purified recombinant Hp protein was identified by SDS-PAGE electrophoresis. See [link to SDS-PAGE]. Figure 2 .
[0034] 2. Experimental Results
[0035] (1) By Figure 1 The results showed that the lysate of E. coli cells transfected with the pET23a-rHp plasmid exhibited a distinct specific band at 50 kDa in lane R, while the lysate of the control transfected with the empty vector did not show a band of the corresponding size in lane L. This indicates that the cells specifically expressed the FlaA protein of recombinant Helicobacter pylori Hp.
[0036] (2) By Figure 2 The results showed that the purified protein had a distinct specific band at 50kD in the SDS-PAGE gel image, indicating that the FlaA protein of recombinant Helicobacter pylori Hp with good purity had been obtained.
[0037] Example 3: Preparation and screening of anti-Hp monoclonal antibodies secreted by hybridoma cell line OTI2C8
[0038] Purified recombinant Helicobacter pylori Hp FlaA protein was used to immunize BALB / c mice (Beijing Vital River Laboratory Animal Technology Co., Ltd.) according to standard methods. The specific method is as follows:
[0039] (1) Animal immunization: The purified FlaA antigen was emulsified with complete Freund's adjuvant and administered subcutaneously or...
[0040] Six- to eight-week-old BALB / c mice were immunized via intraperitoneal injection at a dose of 60 μg per mouse. A second immunization was administered two weeks later, using incomplete Freund's adjuvant emulsification at a dose of 30 μg per mouse. Tail blood was collected after both immunizations and serum titers were determined using a serially diluted ELISA method. Based on the results, a booster immunization was determined, and mice with the highest antibody titers were selected for cell fusion.
[0041] (2) Cell fusion: Myeloma cells were sp2 / 0 derived from BALB / c and were in a logarithmic phase at the time of fusion.
[0042] Growth period; take spleens from immunized mice and prepare single-cell suspensions of lymphocytes; mix mouse spleen lymphocytes and myeloma cells at a ratio of 1:5 to 1:10, add 1 mL of 50% PEG (pH 8.0) preheated at 37℃, add incomplete culture medium and the remaining stop solution, centrifuge and discard the supernatant, add HAT culture medium to suspend and mix well, bring the MC volume to 50 mL, dispense into 3.5 cm culture dishes, place in a humidified box, and incubate in a 37℃, 5% CO2 constant temperature incubator.
[0043] (3) Screening and Cloning: Hybridoma cell clones were selected within 7-10 days of fusion and tested using purified recombinant FlaA protein via ELISA. Cell line numbers were labeled. Positive wells were subjected to limiting dilutions, with ELISA values measured 5-6 days after each dilution. Wells with high OD280 positive values were selected for further limiting dilutions until the entire 96-well plate tested positive for ELISA. High-positive-value clones were selected for identification. The corresponding cell line for the fusion plate was OTI2C8.
[0044] (4) Preparation and purification of monoclonal antibodies on cells: The hybridoma cell line OTI2C8 was cultured in DMEM medium containing 15% serum in 10cm culture dishes and expanded to approximately 4×10⁶ cells / year. 7 Centrifuge at 800 rpm for 5 min, discard the supernatant and transfer the cells to a 2 L roller flask. Add serum-free culture medium to bring the cell density to approximately 3 × 10⁶ cells / min. 5 Cells / ml. Continue culturing for 1-2 weeks, until the cell death rate reaches 60%-70% (at which point the cell density is approximately 1-2 × 10⁶ cells / ml). 6 Cell suspension was collected (cells / ml), centrifuged at 6000 rpm for 20 min, and the supernatant was collected and purified by affinity chromatography. The appropriate column material was selected according to the antibody subtype (for subtype IgG2a, protein G column material was used for purification). The concentration of the purified monoclonal antibody was determined, lyophilized, and aliquoted (100 μg / tube), and finally stored at -20℃.
[0045] Example 4: Analysis of the variable region gene and amino acid sequence of anti-Hp monoclonal antibody
[0046] Purchased from Takara Bio USA The RACE 5' / 3' kit uses 5'RACE (Rapid Amplification of cDNA Ends) technology to amplify the variable region light and heavy chain gene sequences of hybridoma cell functional antibodies. For detailed experimental procedures, please refer to Takara Bio USA. RACE 5' / 3' Kit User Manual.
[0047] Based on the fact that the anti-Hp monoclonal antibody is of the IgG2a subtype, specific gene primers pRace-H-GSP and pRace-K-GSP targeting the 3' end of its Ig and Kappa constant regions were designed. The primer sequences are as follows:
[0048] pRace-H-GSP:CATCDGTCTATCCACTGGCCCCTG
[0049] pRace-K-GSP:CTTCCCACCATCCAGTGAGCAGTT
[0050] mRNA was extracted from the hybridoma cell line OTI2C8 and reverse transcribed into cDNA. DNA fragments of the antibody heavy and light chains were amplified using RACE. The amplified light and heavy chains were ligated into the cloning vector PUC119 by enzyme digestion. Positive clones were selected using blue-white screening, and the positive plasmids were purified and sequenced using an ABI 3730 sequencer with universal primers M13f and M13r.
[0051] Using the internet and the IMGT / V-QUEST analysis software at http: / / www.imgt.org, the nucleotide sequences of the light and heavy chains were sequenced and analyzed. The amino acid sequence of the light chain variable region of the anti-Hp monoclonal antibody is shown in SEQ ID NO.3, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.7. The total length of the light chain variable region is 105 amino acids. The number of amino acids in the four domains of FR are 26, 17, 36, and 11, respectively, and the number of amino acids in the three domains of CDR are 6, 3, and 6, respectively. The regions of CDR1, CDR2, and CDR3 are 27aa-32aa, 50aa-52aa, and 89aa-94aa, respectively, with amino acid sequences of QDIGSN, ATS, and LQYGSF, respectively. Analysis revealed that the full-length variable region of the heavy chain of the anti-Hp monoclonal antibody is 112 amino acids. The number of amino acids in the four domains of its FR is 25, 17, 38 and 11, respectively. The number of amino acids in the three domains of its CDR is 8, 8 and 5, respectively. CDR1, CDR2 and CDR3 are 26aa-33aa, 51aa-58aa and 97aa-101aa, respectively. Their amino acid sequences are GYTLTDYW, INTETGVT and ARSLG, respectively.
[0052] Example 5: Immunohistochemical detection using anti-Hp monoclonal antibody as primary antibody
[0053] 1. Experimental Methods:
[0054] (1) Formalin-fixed gastritis tissue blocks were embedded in paraffin and sectioned using a Leica tissue slicer with a tissue thickness of 4 μm.
[0055] (2) Dewaxing and hydration: analytical grade xylene for 10 min × 3 times, anhydrous ethanol for 1 min × 3 times, 95% ethanol for 1 min, 85% ethanol for 1 min, 75% ethanol for 1 min, and deionized water for 2 min × 3 times.
[0056] (3) Antigen retrieval: Add antigen retrieval solution [1mM EDTA, 10mM Tris buffer (pH 8.0)] and pressure cook for 3 minutes. When the pressure cooker temperature drops to about 90℃, open the pressure cooker, remove the slices, and then allow them to cool naturally to room temperature. Soak in deionized water for 2 minutes × 3 times.
[0057] (4) Inactivation: Use 3% hydrogen peroxide to inactivate endogenous peroxidase in tissues, let stand at room temperature for 15 min, and soak in deionized water for 2 min × 3 times.
[0058] (5) Draw a border around the tissue with an immunohistochemical pen, and wash with 0.1% PBST for 2 min × 1 time.
[0059] (6) Incubation with primary antibody: Add 200 μl of diluted monoclonal antibody (0.293 ug / mg) secreted by hybridoma cell line OTI2C8 and place in a humidified chamber. Incubate at 37°C for 60 min. Wash with 0.1% PBST for 2 min × 3 times.
[0060] (7) Incubation with secondary antibody: Add 100 μl of secondary antibody PV-8000 and incubate at 37℃ for 30 min. Wash with 0.1% PBST for 2 min × 3 times.
[0061] (8) DAB color development: Add 120 μl of DAB color development solution, let stand at room temperature for 5 min, rinse with tap water to stop the color development, and rinse 3 times with tap water.
[0062] (9) Hematoxylin counterstaining, differentiation, and blueing: Let the stain stand in the hematoxylin solution for 10-120 seconds, rinse three times with tap water to stop the color development, differentiate in 1% hydrochloric acid-ethanol solution, rinse three times with tap water to stop the differentiation, then place in freshly boiled pH 8.0 Tris-EDTA disodium solution for blueing, and then place in room temperature pH 9.0 Tris-EDTA disodium solution for a few seconds, rinsing three times with tap water. Observe the staining under a microscope. If normal, the process is complete and the hematoxylin staining solution is recovered; if differentiation is excessive, the above steps must be repeated until the staining is satisfactory.
[0063] (10) Dehydration and clearing: 75% ethanol for 1 min, 85% ethanol for 1 min, 95% ethanol for 1 min, 100% ethanol for 1 min × 3 times, xylene for 1 min × 3 times, and neutral resin for mounting.
[0064] (11) Microscopic examination, such as Figure 3 and 4 As shown.
[0065] 2. Experimental Results:
[0066] The anti-Hp monoclonal antibody secreted by the hybridoma cell line OTI2C8 was detected by IHC in two cases of gastritis tissue infected with Helicobacter pylori (Hp). The antibody concentration was 0.293 ug / mg. The results are as follows: Figure 3 and 4 As shown, the left image is the result under low magnification, and the right image is a high magnification view of the area within the box in the left image. The results show that the epithelial cells, lymphocytes, and other tissue cells of the gastric mucosa layer show negative expression, that is, there is no nonspecific background staining; positive expression is shown on the surface of epithelial cells and in glandular lumens. The high magnification image clearly shows the stained arc-shaped and S-shaped Helicobacter pylori, whose morphology is consistent with the natural morphology of Helicobacter pylori (Hp). Moreover, at a concentration of 0.293 mg / ml, the staining intensity is strong, and the bacterial morphology is clear and distinct, indicating that the anti-Hp monoclonal antibody described in this invention has good specificity and sensitivity.
[0067] The above results indicate that the anti-Hp monoclonal antibody secreted by the hybridoma cell line OTI2C8 described in this invention has high specificity and sensitivity, and can be used for immunohistochemical detection and for research on Helicobacter pylori (Hp) infection-related diseases.
[0068] The above specific embodiments are used to explain and illustrate the present invention, and are only preferred embodiments of the present invention, and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made to the present invention within the spirit and principles of the present invention shall fall within the protection scope of the present invention.
[0069]
[0070]
Claims
1. A hybridoma cell line, characterized in that, The hybridoma cell line was named OTI2C8 and is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 45713.
2. An anti-Hp monoclonal antibody, characterized in that, Produced by the hybridoma cell line OTI2C8 as described in claim 1.
3. The anti-Hp monoclonal antibody according to claim 2 in the preparation of a drug for detecting Helicobacter pylori (Hp) Helicobacter pylori Applications of ) in immune detection tools.
4. The application according to claim 3, characterized in that: The immunoassay tool is a reagent kit, chip, or test strip.
5. The use of the anti-Hp monoclonal antibody according to claim 2 in the preparation of a kit for labeling Helicobacter pylori (Hp) infected tissues.
6. The application according to claim 5, characterized in that, The tissue contains gastric tissue infected with Helicobacter pylori (Hp).
7. An immunohistochemical detection kit for detecting Helicobacter pylori, characterized in that, Including the anti-Hp monoclonal antibody as described in claim 2.
Citation Information
Patent Citations
Helicobacter pylori urease B subunit B cell antigen epitope polypeptide, identification method and application
CN101033468A
Preparation process for gene vaccines containing UreB and CagA protein of helicobacter pylori
CN102688502A