Application of Brassica rapa BrPILS5 gene in improving plant pollen heat tolerance

Abstract

The present invention discloses the use of the Brassica rapa BrPILS5 gene for improving plant pollen heat tolerance. The application involves inhibiting the expression of the Brassica rapa BrPILS5 gene to enhance pollen resistance to high temperature stress during pollen development. The inhibition of the Brassica rapa BrPILS5 gene co-suppresses the Brassica rapa BrPILS5a and BrPILS5b genes. Overexpression of an artificial miRNA fragment that inhibits the expression of the Brassica rapa BrPILS5 gene can improve heat tolerance in both the early and late stages of pollen development, reversing complete male sterility caused by high temperature conditions. This gene has promising application prospects for resistance breeding in Brassica rapa or other flowering plants.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to application of a Chinese cabbage BrPILS5 gene in improving the heat resistance of plant pollen. Background Art

[0002] In recent years, with population growth and economic development, the greenhouse effect has become increasingly prominent, and the losses caused by high temperatures have posed a significant threat to global food security (Peng et al., 2004; Charles et al., 2010; Chaturvedi et al., 2021). Plants, which are sessile, are constantly exposed to environmental stresses, including heat damage, which poses a serious threat to their growth and development (Ding et al., 2020). In seed plants, reproductive development is a crucial process for seed formation and the alternation of generations. Studies have shown that it is the most sensitive developmental process in the plant life cycle to environmental stresses such as high temperatures. Male reproductive development (primarily anther and pollen development) is more sensitive to environmental stresses than female reproductive development (Begcy et al., 2019). Environmental stresses severely impact pollen development, thereby affecting the normal production of crop seeds and seed-based products such as grains and vegetables (De Storme and Geelen, 2014; Ghadirnezhad and Fallah, 2014). Therefore, developing technical measures to cope with environmental stress or cultivating stress-resistant crops is crucial to ensuring global food security.

[0003] Auxin plays an important regulatory role in anther dehiscence, pollen maturation, filament elongation, and pollen tube growth (Cecchetti et al., 2008). Auxin's effects on plants include four major processes: synthesis, metabolism, transport, and signal transduction. Abnormal changes in any of these processes can affect pollen development. For example, in Arabidopsis, double mutations in the auxin synthesis genes yuc2 and yuc6 result in short stamens without pollen (Cheng et al., 2006). In rice, studies have found that the auxin metabolism mutant dao exhibits indehiscent anthers and defective pollen grain development (Zhao et al., 2013). In the auxin signaling gene mutant arf17, pollen wall development and anther dehiscence are abnormal (Yang et al., 2013). The tir1 afb2 afb3 triple mutant and the tir1 afb1 afb2 afb2 quadruple mutant exhibit premature pollen maturation (Cecchetti et al., 2008). The auxin transport mutant pin8 causes abnormal pollen exine development and pollen germination (Dal Bosco et al., 2012; Ding et al., 2013). et al., 2012), and early pollen maturation in the abcb1 abcb19 double mutant (Cecchetti et al., 2015).

[0004] In flowering plants, the normal development of the male reproductive organ, the stamen, is essential for successful sexual reproduction. In Arabidopsis, six stamen primordia typically appear in the third whorl of floral organs and subsequently differentiate into stamen filaments and anthers, where male meiosis occurs. This early stage is followed by a later developmental phase that includes rapid elongation of the stamen filaments, coordinated with anther dehiscence and pollen maturation. Increasing evidence indicates that auxin transport is essential for both early and late stages of stamen development (Cecchetti et al., 2017). Proteins of the PIN family are major efflux transporters with a polarized cell distribution (Galweiler et al., 1998; Friml et al., 2003; Paponov et al., 2005; Friml, 2010). PIN transporters can be divided into a large ring and a short ring subgroup. The large-ring PINs (PIN1, PIN2, PIN3, PIN4, and PIN7) are characterized by a large hydrophilic ring and localize to the plasma membrane, where they directly transport auxin. The short-ring PINs (PIN5, PIN6, and PIN8) are not recruited to the plasma membrane but are proposed to regulate auxin homeostasis between the cytoplasm and the endoplasmic reticulum (ER) (Mravec et al., 2009; Wabnik et al., 2011).

[0005] Plant cells also harbor a conserved family of intracellular auxin transporters, the PIN-LIKES protein family (PILS). The PILS family is a newly discovered class of auxin transporters whose physiological functions have been elucidated in recent years. While these proteins share limited sequence homology with PIN proteins, they share a high degree of similarity in their higher-order structures. Seven members of the PILS family exist in Arabidopsis thaliana. These members mediate the transport of auxin from the cytoplasm to the ER lumen by localizing to the ER (Barbez et al., 2012). PILS proteins are essential for auxin-dependent plant growth regulation. PILS proteins regulate the accumulation of intracellular auxin in the ER, thereby regulating its availability in the nucleus for auxin signaling. PILS activity may influence the levels of the endogenous auxin indole-3-acetic acid (IAA) through intracellular accumulation and metabolism (Barbez et al., 2012; Feraru et al., 2012; Sauer and Kleine-Vehn, 2019). However, there is still little research on the function of PILS proteins.

[0006] Only a few studies have found that overexpression of PILS1, 3, 5, and 6 inhibits plant growth (Barbez et al., 2012; Beziat et al., 2017; Feraru et al., 2019; Sun et al., 2020). However, pils6 mutant plants grow well. Under high temperature conditions (29°C), PILS6 alters root elongation (root length is shortened in both overexpression and mutant plants compared to controls, with overexpression roots showing the shortest length) (Feraru et al., 2019). GASP1 (Gloomy and Shiny Pils) encodes a RING / U-box superfamily protein that influences auxin signaling output. Low auxin signaling in gasp1 mutants is associated with reduced abundance of PILS5 and PILS6 proteins. High and low auxin conditions increase and decrease PILS6 protein levels, respectively. Thus, suboptimal auxin concentrations are buffered by alterations in PILS6 abundance, leading to steady-state auxin output regulation (Feraru et al., 2022).

[0007] The primary role of pollen maturation appears to be provided by ER-localized PINs (such as PIN8 and PIN5, and possibly PILS5). Developing and germinating pollen grains are known to have high auxin levels, and ER-localized PINs may regulate the release of auxin stored within the ER to control pollen development and drive auxin-mediated pollen tube elongation (Cardarelli and Cecchetti, 2014). p35S:PIN8-VEN and p35S:PILS5-GFP plants exhibit insensitive root growth and reduced auxin responses when grown on auxin-supplemented medium. Both phenotypes suggest a negative impact of PIN8 and PILS5 on nuclear auxin signaling. Furthermore, root hair-specific expression of PILS5 results in inhibition of cell length (DalBosco et al., 2012). Whether the functions of PILS5 and PIN8 are interconnected and how their activities in the ER influence pollen function remain to be determined. Furthermore, the function of PILS5 in plant pollen and its role in heat tolerance have not yet been investigated. Therefore, using modern biotechnology to study the potential relationship between the cabbage BrPILS5 gene and plant pollen heat tolerance will help provide theoretical support for taking effective protective measures in the breeding of cabbage and other flowering crops to improve seed yield and quality.

[0008] References

[0009] Barbez E,Kubes M,Rolcik J,Beziat C,Pencik A,Wang B,Rosquete MR,Zhu J,Dobrev PI,Lee Y,Zazimalova E,Petrasek J,Geisler M,Friml J,Kleine-Vehn J(2012)A novel putative auxin carrier family regulates intracellular auxinhomeostasis in plants.Nature 485:119-122

[0010] Begcy K,Nosenko T,Zhou LZ,Fragner L,Weckwerth W,Dresselhaus T(2019)Male Sterility in Maize after Transient Heat Stress during the Tetrad Stageof Pollen Development.Plant Physiol 181:683-700

[0011] Beziat C,Barbez E,Feraru MI,Lucyshyn D,Kleine-Vehn J(2017)Lighttriggers PILS-dependent reduction in nuclear auxin signalling for growthtransition.Nat Plants 3:17105

[0012] Cardarelli M,Cecchetti V(2014)Auxin polar transport in stamenformation and development:how many actors?Front Plant Sci 5:333

[0013] Cecchetti V,Altamura MM,Falasca G,Costantino P,Cardarelli M(2008)Auxin regulates Arabidopsis anther dehiscence,pollen maturation,and filamentelongation.Plant Cell 20:1760-1774

[0014] Cecchetti V,Brunetti P,Napoli N,Fattorini L,Altamura MM,Costantino P,Cardarelli M(2015)ABCB1 and ABCB19 auxin transporters have synergisticeffects on early and late Arabidopsis anther development.J Integr Plant Biol57:1089-1098

[0015] Cecchetti V,Celebrin D,Napoli N,Ghelli R,Brunetti P,Costantino P,Cardarelli M(2017)An auxin maximumin the middle layer controls stamendevelopment and pollen maturation in Arabidopsis.New Phytol 213:1194-1207

[0016] Charles JH,Godfray JR,Beddington IR,Crute LH,Lawrence.D,FJ,Muir JP,Robinson.S,Sandy M.Thomas,Toulmin C(2010)Food Security:The Challenge ofFeeding 9Billion People.Science327(5967):812–818

[0017] Chaturvedi P,Wiese AJ,Ghatak A,Zaveska Drabkova L,Weckwerth W,Honys D(2021)Heat stress response mechanisms in pollen development.New Phytol 231:571-585

[0018] Cheng Y,Dai X,Zhao Y(2006)Auxin biosynthesis by the YUCCA flavinmonooxygenases controls the formation of floral organs and vascular tissuein Arabidopsis.Genes Dev 20:1790-1799

[0019] Dal Bosco C,Dovzhenko A,Liu X,Woerner N,Rensch T,Eismann M,Eimer S,Hegermann J,Paponov IA,Ruperti B,Heberle-Bors E,Touraev A,Cohen JD,Palme K(2012)The endoplasmic reticulum localized PIN8 is a pollen-specific auxincarrier involved in intracellular auxin homeostasis.Plant J 71:860-870

[0020] Dal Bosco C,Dovzhenko A,Palme K(2012)Intracellular auxin transport inpollen:PIN8,PIN5 and PILS5.Plant Signal Behav 7:1504-1505

[0021] De Storme N,Geelen D(2014)The impact of environmental stress on malereproductive development in plants:biological processes and molecularmechanisms.Plant Cell Environ 37:1-18

[0022] Ding Y,Shi Y,Yang S(2020)Molecular regulation of plant responses toenvironmental temperatures.Mol Plant 13:544-564

[0023] Ding Z,Wang B,Moreno I,Duplakova N,Simon S,Carraro N,Reemmer J,PencikA,Chen X,Tejos R,Skupa P,Pollmann S,Mravec J,Petrasek J,Zazimalova E,Honys D,Rolcik J,Murphy A,Orellana A,Frimsler M,Frimler J(2012)ER-localized auxintransporter PIN8 regulates auxin homeostasis and male gametophyte developmentin Arabidopsis.Nat Commun 3:941

[0024] Feraru E,Feraru MI,Barbez E,Waidmann S,Sun L,Gaidora A,Kleine-Vehn J(2019)PILS6 is a temperature-sensitive regulator of nuclear auxin input andorgan growth in Arabidopsis thaliana.Proc Natl Acad Sci USA 116:38983-38983

[0025] Feraru E,Feraru MI,Moulinier-Anzola J,Schwihla M,Ferreira Da SilvaSantos J,Sun L,Waidmann S,Korbei B,Kleine-Vehn J(2022)PILS proteins provide ahomeostatic feedback on auxin signaling output.Development 149

[0026] Feraru E,Vosolsobe S,Feraru MI,Petrasek J,Kleine-Vehn J(2012)Evolution and Structural Diversification of PILS Putative Auxin Carriers inPlants.Front Plant Sci 3:227

[0027] Friml1.J1,Anne V,Michael S,Dolf W,Heinz S,Thorsten H,Remko O,rgens1GJ(2003)Efflux-dependent auxin gradients establish the apical–basal axis ofArabidopsis.Nature 426:146-153

[0028] Friml J(2010)Subcellular trafficking of PIN auxin efflux carriers inauxin transport.European Journal of Cell Biology 89:231-235

[0029] Galweiler L,Guan C,Muller A,Wisman E,Mendgen K,Yephremov A,Palme K(1998)Regulation of polar auxin transport by AtPIN1 in Arabidopsis vasculartissue.Science 282:2226-2230

[0030] Ghadirnezhad R,Fallah A(2014)Temperature effect on yield and yieldcomponents of different rice cultivars in flowering stage.Intl J Agron 2014:1-4

[0031] Mravec J, Skupa P, Bailly A, Hoyerová K, Krecek P, Bielach A, Petrásek J, Zhang J, Gaykova V, Stierhof YD, Dobrev PI, Schwarzerová K, Rolcík J, Seifertová D, Luschnig C, Benková E, Zazímalová E, Geisler M, Friml J(2009) Subcellularhomeostasis of phytohormone auxin is mediated by the ER-localized PIN5transporter. Nature 459:1136-U1127

[0032] Paponov IA,Teale WD,Trebar M,Blilou K,Palme K(2005)The PIN auxinefflux facilitators:evolutionary and functional perspectives.Trends in PlantScience 10:170-177

[0033] Peng SP,Jianliang Huang,John E.Sheehy,Rebecca C.Laza,Romeo M.Visperas,Xuhua Zhong,Grace S.Centeno,Gurdev S.Khush,Cassman aKG(2004)Riceyields decline with higher night temperaturefrom global warming.Proc NatlAcad Sci USA 101:9971–9997

[0034] Sauer M, Kleine-Vehn J(2019) PIN-FORMED and PIN-LIKES auxin transport facilitators. Development 146

[0035] Sun L,Feraru E,Feraru MI,Waidmann S,Wang W,Passaia G,Wang ZY,WabnikK,Kleine-Vehn J (2020)PIN-LIKES Coordinate Brassinosteroid Signaling withNuclear Auxin Input in Arabidopsis thaliana.Curr Biol 30:1579-1588 e1576

[0036] Wabnik K,Kleine-Vehn J,Govaerts W,Friml J(2011)Prototype cell-to-cellauxin transport mechanism by intracellular auxin compartmentalization.Trendsin Plant Science 16:468-475

[0037] Yang J,Tian L,Sun MX,Huang XY,Zhu J,Guan YF,Jia QS,Yang ZN(2013)AUXINRESPONSE FACTOR17 is essential for pollen wall pattern formation inArabidopsis.Plant Physiol 162:720-731

[0038] Zhao Z,Zhang Y,Liu X,Zhang X,Liu S,Yu X,Ren Y,Zheng X,Zhou K,Jiang L,Guo X,Gai Y,Wu C,Zhai H,Wang H,Wan J(2013)ARole for a Dioxygenase in AuxinMetabolism and Reproductive Development in Rice.Developmental Cell 27:113-122 Summary of the Invention

[0039] The present invention provides an application of the cabbage BrPILS5 gene in improving the heat resistance of plant pollen. An artificial miRNA fragment that inhibits the expression of the cabbage BrPILS5 gene is overexpressed in a recipient plant. It is found that inhibiting the expression of the cabbage BrPILS5 gene can improve the heat resistance of pollen in the early and late stages of development, and rescue the complete male sterility caused by high temperature conditions, providing a valuable resource for breeding new plant-resistant varieties.

[0040] The technical solutions specifically adopted in the present invention are as follows:

[0041] The application of the cabbage BrPILS5 gene in improving the heat resistance of plant pollen is to inhibit the expression of the cabbage BrPILS5 gene to improve the resistance of plant pollen under high temperature stress during the pollen development period. The inhibition of the expression of the cabbage BrPILS5 gene is to co-suppress the cabbage BrPILS5a and BrPILS5b genes, wherein the BrPILS5a gene is numbered BraA09g010950.3C, and the gene sequence is shown in SEQ ID NO.1; the BrPILS5b gene is numbered BraA07g003460.3C, and the gene sequence is shown in SEQ ID NO.2.

[0042] Furthermore, the pollen development stage is the early pollen development stage and / or the late pollen development stage.

[0043] Furthermore, the plant pollen is dicotyledonous angiosperm pollen or monocotyledonous angiosperm pollen.

[0044] Furthermore, the plant pollen is cruciferous plant pollen.

[0045] Furthermore, the plant pollen is cabbage pollen.

[0046] Furthermore, when used, the artificial miRNA fragment that inhibits the expression of the cabbage BrPILS5 gene is connected to a plant overexpression vector to construct a recombinant overexpression vector, and then the recombinant overexpression vector is transformed into a recipient plant.

[0047] Furthermore, the plant overexpression vector is pCAMBIA1300.

[0048] Furthermore, the recombinant overexpression vector is transformed into a recipient plant by the following operation: the recombinant overexpression vector is transformed into Agrobacterium, and then the recipient plant is infected with the obtained recombinant Agrobacterium.

[0049] Beneficial effects of the present invention:

[0050] The present invention cloned the Brassica rapa BrPILS5 gene and an artificial miRNA fragment that inhibits its expression, and genetically transformed it into the Brassica rapa plant. The results showed that overexpressing the artificial miRNA fragment that inhibits the expression of the Brassica rapa BrPILS5 gene can improve heat tolerance in both early and late pollen development stages, reversing complete male sterility caused by high-temperature conditions. This indicates that the Brassica rapa BrPILS5 gene has potential for improving seed yield and quality during plant seed production under high-temperature conditions. This gene has promising application prospects in resistance breeding for Brassica rapa and other flowering plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 Expression analysis of seven PILS genes in anthers at different stages of pollen development. CKT, CKU, CKB, and CKM represent the tetrad stage, uninucleate stage, binucleate stage, and pollen maturity stage under normal conditions, respectively.

[0052] Figure 2 This figure shows a protein sequence alignment analysis of two BrPILS5 homologous genes in Brassica rapa. A shows a protein sequence alignment of the two BrPILS5 homologous genes, with approximately 92% similarity. B shows expression analysis of the two BrPILS5 homologous genes in Brassica rapa anthers treated with high temperatures and in untreated controls. HST represents anthers in the tetrad stage after high-temperature stress (i.e., anthers subjected to high-temperature stress during the tetrad stage); CKT represents anthers in the tetrad stage grown under normal conditions; HSTM represents anthers in the pollen-developing tetrad stage after high-temperature stress and then grown to maturity under normal conditions; CKTM represents anthers in the tetrad stage grown under normal conditions; HSM represents anthers in the mature stage after high-temperature stress (i.e., anthers subjected to high-temperature stress during maturity); CKM represents anthers in the mature stage grown under normal conditions.

[0053] Figure 3 Overexpression of BrPILS5 gene in Chinese cabbage OE ) and inhibited expression (BrPILS5 RNAi ) vector construction. A, pCAMBIA1300 vector enzyme digestion electrophoresis. Lane M is a DNA marker, the same below. B, PCR electrophoresis of the CDS clone of the Brassica rapa BrPILS5 gene. C, Brassica rapa BrPILS5 gene overexpression (BrPILS5 OE ) Electrophoresis diagram of positive identification of recombinant vector bacterial solution. D, Artificial miRNA fragment inhibiting the expression of Brassica rapa BrPILS5 gene (BrPILS5 RNAi / BrPILS5-amiRNA) clone PCR electrophoresis. E, Brassica rapa BrPILS5 gene expression inhibition (BrPILS5 RNAi) Electrophoresis diagram of positive identification of recombinant vector bacterial solution. F, Overexpression of BrPILS5 gene in Chinese cabbage (BrPILS5 OE ) and inhibition of expression (BrPILS5 RNAi ) Schematic diagram of the recombinant vector.

[0054] Figure 4 Overexpression of BrPILS5 gene in Chinese cabbage OE ) and inhibition of expression (BrPILS5 RNAi ) positive plants identification. A, Brassica rapa BrPILS5 gene overexpression (BrPILS5 OE ) positive plants were identified by GFP fluorescence. The left side was photographed under white field conditions, and the right side was photographed under fluorescence conditions. B, cabbage BrPILS5 gene overexpression (BrPILS5 OE ) positive plants were identified by PCR. The square frame is the selected lines, the M lane is the DNA marker, and the P lane is the positive control (vector plasmid), the same below. C, the expression of the BrPILS5 gene in Chinese cabbage was suppressed (BrPILS5 RNAi ) positive plants were identified by GFP fluorescence. The left side was photographed under white field conditions, and the right side was photographed under fluorescence conditions. D, expression of the BrPILS5 gene in Chinese cabbage was suppressed (BrPILS5 RNAi ) PCR identification of positive plants.

[0055] Figure 5 To inhibit the expression of BrPILS5 gene in Chinese cabbage (BrPILS5 RNAi )Observation and statistical analysis of heat tolerance of transgenic lines pollen. A, expression of BrPILS5 gene in cabbage was suppressed (BrPILS5 RNAi ) transgenic plants and non-transgenic control plants were observed for pollen germination in vitro and fruiting in vivo (pollen from transgenic plants and non-transgenic control plants was pollinated on the stigma of non-transgenic (wild-type) plants) under normal conditions. CK is non-transgenic, and RNAi-2 / 10 / 14 are transgenic lines expressing the BrPILS5 gene in cabbage, labeled 2, 10, and 14, respectively. C and D are corresponding statistical analyses. B, expression of the BrPILS5 gene in cabbage (BrPILS5) was suppressed. RNAiPollen germination in vitro and pollination fruiting in vivo (pollen from transgenic and non-transgenic control plants was pollinated onto the stigma of non-transgenic (wild-type) plants) were observed under high temperature stress conditions in transgenic plants and non-transgenic control plants. HSTM-CK represents non-transgenic control plants subjected to high temperature stress at the tetrad stage and then recovered to maturity under normal conditions. HSTM-RNAi-2 / 10 / 14 represents transgenic plants expressing the BrPILS5 gene in Chinese cabbage subjected to high temperature stress at the tetrad stage and then recovered to maturity under normal conditions. HSM-CK represents non-transgenic control plants subjected to high temperature stress at the mature stage, and HSM-RNAi-2 / 10 / 14 represents transgenic plants expressing the BrPILS5 gene in Chinese cabbage subjected to high temperature stress at the mature stage. EH represents the corresponding statistical analysis. One-way analysis of variance followed by multiple comparisons was performed. Different letters (P < 0.05) indicate statistically significant differences between samples. The scale for the pollen in vitro germination diagram is 50 μm, the scale for the silique and flower diagrams is 1 cm, and the scale for the plant diagram is 10 cm. DETAILED DESCRIPTION

[0056] The present invention will be further explained below in conjunction with the examples and drawings. The following examples are only used to illustrate the present invention, but are not intended to limit the scope of the present invention.

[0057] Example 1 Plant Materials and High-Temperature Treatment

[0058] (1) Cabbage variety 'Byq97-02' (Brassica campestris L.ssp.chinensis Makino, syn.B.rapa ssp.chinensis, referred to as Brassica campestris syn.B.rapa) was sown in a substrate consisting of peat, vermiculite, and perlite in a mass ratio of 3:2:1. The pots were watered thoroughly and kept at a relative humidity of 65% and a humidity of 300 μmol*m -2 *s -1 The plants were cultured in a greenhouse under maximum light intensity until flowering stage, with a day / night photoperiod and temperature of 16h / 8h and 22°C / 18°C, respectively.

[0059] (2) For high temperature treatment, cabbage plants grown under normal conditions (above (1)) to the flowering stage were marked (i.e., different pollen development stages were marked, and the open flowers of the cabbage inflorescence were removed, leaving the 5-level flower buds for testing. The five typical stages of pollen development are: pollen mother cell stage, tetrad stage, uninucleate stage, binucleate stage, and trinucleate mature stage (i.e., pollen mature stage), confirmed by the size of the flower buds and microscopic observation) and then transferred to a high temperature incubator (Ningbo Southeast Instrument Co., Ltd.) for high temperature treatment, 38℃ / 28℃ (day / night 16h / 8h) for 24h, and other conditions remained unchanged. The control was a cabbage plant sown at the same time and grown under normal conditions. The high temperature treatment started at 9:00 am. After the high temperature treatment was completed, the tetrad stage anthers, mature stage anthers and the untreated control tetrad stage anthers and mature stage anthers were immediately taken and quickly frozen in liquid nitrogen for gene expression analysis or stored at -75℃ for later use. After the tetrad-stage flower buds treated with high temperature recovered and matured under normal conditions, anthers were collected and collected along with untreated mature anthers (i.e., mature anthers grown from the tetrad stage under normal conditions) and quickly frozen in liquid nitrogen for gene expression analysis or stored at -75°C until further use. Ten plants were treated for each treatment, and the experiment was repeated three times.

[0060] Example 2 Overexpression of Brassica rapa BrPILS5 gene (BrPILS5 OE ) and inhibition of expression (BrPILS5 RNAi ) Vector construction

[0061] (1) Transcriptome analysis of anthers at different stages of Arabidopsis thaliana showed that the PILS5 gene was more abundant in pollen development than other genes in the same family, and was highly expressed in the late stage of pollen development ( Figure 1 ), indicating that this gene is particularly important in the process of pollen development, so this gene was selected for transgenic research.

[0062] (2) Anther tissue samples of cabbage treated with high temperature and untreated control at the two most sensitive periods of high temperature stress during pollen development (i.e., the tetrad period and the pollen maturity period) were taken, and total RNA was extracted using Trizol reagent. The synthesis of cDNA was completed using the TAKARA reverse transcription kit. The specific method is as follows: 5×gDNAEraser Buffer 2μL, gDNA Eraser 1μL, RNA 1μg, RNase Free H2O to 10μL, 42℃, 2min to remove genomic DNA, 5×Primer Script Buffer 4μL, RT Primer Mix 1μL, Primer Script RT Enzyme Mix 1μL, RNase Free H2O 4μL were added to the reaction solution in the previous step, and the mixture was mixed by pipetting and reacted at 37℃ for 20min, and then at 85℃ for 5s to complete the synthesis of cDNA. The cDNA was stored in a -20℃ refrigerator.

[0063] (3) Using the cabbage anther cDNA from (2) as a template, the cabbage BrPILS5 gene (which has two copies in cabbage but has a very high homology) was cloned. Figure 2 A), analysis of the transcriptome of cabbage anthers revealed that one copy was highly expressed (BrPILS5a, gene number BraA09g010950.3C), while the other (BrPILS5b, gene number BraA07g003460.3C) was almost zero ( Figure 2 B), probably because of their high homology, it is difficult to distinguish each other during gene expression signal detection, so they are concentrated in one copy ID. Based on the above reasons, BrPILS5a with extremely high expression level is selected as BrPILS5 by default. PCR amplification is performed using primers with the homologous wall of the pCAMBIA1300 vector in Table 1 using a high-fidelity enzyme to obtain a PCR product, namely, the cabbage BrPILS5 gene clone with the vector homologous wall is obtained. The target band is excised and recovered by gel cutting. At the same time, the linearized pCAMBIA1300 vector is digested with restriction endonucleases Sac I and BamH I, and the gel is run and excised to recover. Finally, the cabbage BrPILS5 gene fragment and the linearized vector fragment are recombined by homologous recombination. The recombinant product is transformed by heat shock. Single colonies are randomly picked for PCR identification using the primers in Table 2. Plasmids are extracted from positive colonies and sent to a sequencing company (Zhejiang Youkang Biotechnology Co., Ltd.) for sequencing verification, thus obtaining BrPILS5. OE The recombinant plasmid was stored at -20℃ for future use. Figure 3 AC and F.

[0064] The specific steps involved are as follows:

[0065] ① Fragment amplification

[0066] PCR system 50 μL: DNA / cDNA (template) 1 μL, 2× Phanta Max Master Mix (high-fidelity enzyme premix) 25 μL, 2 μL each of forward and reverse primers, and 20 μL of ddH2O.

[0067] PCR program: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 58°C for 15 s (temperature can be adjusted according to the designed primers), extension at 72°C for 1 min (adjusted according to the enzyme effect and fragment size), and total extension at 72°C for 5 min.

[0068] The amplified product was spotted into a 1.0% gel in the middle well and run in an electrophoresis apparatus at 120V and 100mA for 30min, and photographed in a gel imaging apparatus.

[0069] ② Enzyme digestion

[0070] System: 1 μg DNA plasmid, 2 μL each of Sac I and Bam HI enzymes, 4 μL Buffer, and ddH2O to 20 μL.

[0071] Reaction: 37℃ for 1h.

[0072] The digested product was spotted into a 1.0% gel in the middle well and run in an electrophoresis apparatus at 120V 100mA for 30min, and photographed in a gel imaging apparatus.

[0073] ③ Gel recovery

[0074] Under UV light, cut the gel block containing the target band and place it in a 1.5mL centrifuge tube. Add about 300μL of Buffer MB to the centrifuge tube (enough to completely immerse the gel block, generally add 300μL for every 0.1g of gel). Heat in a 37℃ metal bath / water bath to melt the gel block and release the target fragment (approximately 5-10 minutes). Transfer the above solution to the DNA Fragment Minicolumn (i.e., the column provided with the kit) and let it stand at room temperature for 1 minute. Centrifuge at 12000rpm for 1 minute and discard the filtrate. Add 750mL of Buffer WB (previously added with the specified volume of anhydrous ethanol) to the Mini column and centrifuge at 12000rpm for 1 minute. Discard the filtrate and repeat once. Place the Mini column in a new 2mL Collection Tube and centrifuge at 12000rpm for 2 minutes. Place the Minicolumn in a new 1.5mL centrifuge tube and add 50μL of Buffer WB to the center of the Mini column membrane. Add ddH2O (heating to 50-65°C improves DNA elution efficiency), let stand at room temperature for 1 minute, and centrifuge at 12,000 rpm for 2 minutes to obtain the purified fragment. Measure the concentration and store at -20°C.

[0075] ④Homologous recombination

[0076] System: 200 ng of linearized vector, about 60 ng of gene fragment (adjusted according to fragment size, generally equal to about 0.04 × total base pairs of the fragment), 4 μL of 5 × CE MultiS Buffer, 2 μL of Exnase MultiS, and ddH2O to 20 μL.

[0077] Reaction: 37℃ for 30min.

[0078] ⑤ Heat shock conversion

[0079] Thaw DH5а E. coli on ice; pipette 10 μL of homologous recombination product into 100 μL of E. coli and mix gently by pipetting; let it stand on ice for 30 min; heat shock in a 42°C metal bath for 60 s, then immediately cool on ice for 2-3 min; add 1 mL of LB liquid culture medium without any antibiotics to the clean bench and place it in a 37°C shaker to recover for 45-60 min; centrifuge at 5000 rpm for 2 min, discard most of the filtrate and keep about 100 μL; use a pipette to mix the remaining filtrate and bacterial block; evenly apply the bacterial liquid to LB solid culture medium containing antibiotics (kanamycin 50 mg / L), seal the plate with sealing film, mark it, and place it in a 37°C incubator for overnight culture.

[0080] ⑥ Colony positive identification

[0081] In a clean bench, randomly pick 8 single colonies from the solid culture medium of each recombinant vector in step ⑤, add 1 mL of LB liquid culture medium containing kanamycin (kanamycin 50 mg / L) into 1.5 mL centrifuge tubes, and shake at 37°C for 4-5 h.

[0082] PCR system 25 μL: 1 μL bacterial solution (template), 12.5 μL 2× Rapid Taq Master Mix, 1 μL each of forward and reverse primers, and 9.5 μL ddH2O.

[0083] PCR program: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 58°C for 15 s (temperature can be adjusted according to the designed primers), extension at 72°C for 1 min (adjusted according to the enzyme effect and fragment size), and total extension at 72°C for 5 min.

[0084] The amplified product was spotted into a 1.0% gel in a small hole and run in an electrophoresis apparatus at 120V 100mA for 30 minutes, and photographed in a gel imaging apparatus.

[0085] ⑦Plasmid extraction

[0086] Add 100μL 3M NaOH to the adsorption column and centrifuge at 12,000rpm for 30-60s to balance the column; centrifuge the positive bacterial solution at 5000rpm for 1min and discard the supernatant; add 250μL Solution I and mix thoroughly to resuspend the bacteria; add 250μL Solution II, gently invert up and down several times, and let it stand for 2-3min; 350μL Solution III, immediately invert up and down several times to produce precipitation; centrifuge at 12000rpm for 10min; transfer the supernatant to the balanced adsorption column, centrifuge at 12000rpm for 1min, and discard the waste liquid; add 500μL HBC buffer, centrifuge at 12000rpm for 1min, and discard the waste liquid; add 700μL Wash Buffer, centrifuge at 12,000rpm for 1min, discard the waste liquid, repeat once; centrifuge at 12,000rpm for 2min, and discard the waste liquid; transfer to a 1.5mL centrifuge tube and add 50μL Add ddH2O and let stand at room temperature for 1 min; centrifuge at 12,000 rpm for 1 min; after concentration determination, store at -20°C.

[0087] Table 1 Primers used for PCR amplification of the CDS sequence of the Brassica rapa BrPILS5 gene with vector homology arms

[0088] Primer name Primer sequence (5'-3') BrPILS5-CDS-p1300-F gagaacacgggggacgagctcATGGGGTTTTGGTCATTGTTGG BrPILS5-CDS-p1300-R catgtcgactctagaggatccGACTAACAAGTGAAGGAAGATTGTGG

[0089] Table 2 Primers for identifying positive colonies of the recombinant vector of the BrPILS5 gene in Chinese cabbage

[0090] Primer name Primer sequence (5'-3') 35S-1300GFP-F CTCCTCGGATTCCATTGCCC BrPILS5-R GACTAACAAGTGAAGGAAGATTGTGG

[0091] (4) Based on the CDS sequence of the cabbage BrPILS5 gene obtained in (3), online network tools (http: / / wmd3.weigelworld.org / ) and (https: / / www.zhaolab.org / psRNATarget / ) were used to design and screen artificial miRNA fragments that inhibit the expression of the cabbage BrPILS5 gene. The fragments initially screened were then compared with the cabbage database (http: / / brassicadb.cn). Finally, the preferred artificial miRNA fragment (BrPILS5-amiRNA, as shown in SEQ ID NO.3) that inhibits the expression of the cabbage BrPILS5 gene (co-inhibiting BrPILS5a and BrPILS5b) was determined and handed over to a biological company (Beijing Qingke Biotechnology Co., Ltd.) for synthesis. PCR amplification was performed using the primers with the homologous wall of the pCAMBIA1300 vector in Table 3 using a high-fidelity enzyme to obtain a PCR product, that is, an artificial miRNA fragment (BrPILS5) with the homologous wall of the vector that inhibits the expression of the cabbage BrPILS5 gene (co-inhibiting BrPILS5a and BrPILS5b) was obtained. RNAi / BrPILS5-amiRNA) clone. The recombinant plasmid was constructed according to the specific method in (3) (the linearized pCAMBIA1300 vector was digested with restriction endonucleases BamH I and Sal I), and PCR identification was performed (positive colony PCR identification primers are shown in Table 4) and then submitted to a sequencing company for sequencing verification, thus obtaining BrPILS5. RNAi The recombinant plasmid was stored at -20℃ for future use. Figure 3 DF.

[0092] Table 3 Primers used for PCR amplification of BrPILS5-amiRNA with vector homology wall

[0093] Primer name Primer sequence (5'-3') BrPILS5-amiRNA-p1300-F gagctcggtacccggggatccGGGTGAGAATCTCCATGTTTATGTC BrPILS5-amiRNA-p1300-R gcccttgctcaccatgtcgacGGGTGAAGAGCTCATGTTTATGTCC

[0094] Table 4 Primers for identifying positive colonies of BrPILS5-amiRNA recombinant vector

[0095] Primer name Primer sequence (5'-3') BrPILS5-amiRNA-F GGGTGAGAATCTCCATGTTTATGTC 35S-1300GFP-R AACTTGTGGCCGTTTACGTC

[0096] Example 3 Genetic transformation of Chinese cabbage using vacuum flower immersion

[0097] (1) Transformation of Agrobacterium with recombinant overexpression vector

[0098] The BrPILS5 gene of Chinese cabbage obtained in Example 2 was selected to overexpress BrPILS5 OE and BrPILS5 that inhibits the expression of the Brassica rapa BrPILS5 geneRNAi The recombinant plasmids were respectively transformed into Agrobacterium GV3101. The specific method was as follows: 50 μL of thawed Agrobacterium competent cells was mixed with 1 μg of the recombinant plasmid obtained in Example 2, and then allowed to stand on ice for 10 min, reacted in liquid nitrogen for 5 min, reacted at 28°C for 5 min, and allowed to stand on ice for 5 min; 1 mL of liquid LB medium without any antibiotics was added on a clean bench, and cultured at 28°C on a shaker at 200 rpm for 4-5 h; centrifuged at 5000 rpm for 2 min, discarded most of the supernatant, and the remaining about 100 μL was resuspended in the culture medium and applied to a plate containing rifampicin (50 mg·L -1 ) and kanamycin (50 mg·L -1 ) solid LB plate; place it upright at 28℃ for 30 minutes and then invert and culture for 2 days. After the positive colony is tested by PCR, the strain is resuspended in 30v / v% glycerol LB to obtain the strain containing BrPILS5. OE Agrobacterium tumefaciens GV3101 strain containing recombinant plasmid and BrPILS5 RNAi The Agrobacterium tumefaciens GV3101 strains containing the recombinant plasmids were stored at -75°C for future use.

[0099] (2) Transformation of Chinese cabbage by vacuum immersion method

[0100] Two days before infection, take out the BrPILS5 OE Agrobacterium tumefaciens GV3101 strain containing recombinant plasmid and BrPILS5 RNAi Agrobacterium tumefaciens GV3101 strains carrying the recombinant plasmid were inoculated with an inoculation loop on a clean bench containing rifampicin (50 mg·L -1 ) and kanamycin (50 mg·L -1 ) solid LB screening plate to activate the bacteria. After inoculation, seal it and place it upside down in a 28℃ incubator for 36 hours. Pick a single colony and add it to 15mL containing rifampicin (50mg·L -1 ) and kanamycin (50 mg·L -1 ) in LB liquid medium. Place in a 28°C shaker at 200 rpm for 12 hours to prepare Agrobacterium stock solution, which is then stored at 4°C. One day before infection, take 5 mL of the stock solution and add it to 500 mL of liquid LB medium (containing rifampicin (50 mg·L)). -1 ) and kanamycin (50 mg·L -1 )) and cultured at 28°C to an OD value of 0.8-1.0.

[0101] On the day of infection, remove the open flowers of the cabbage plant after they have bolted and opened, and strip the buds of the unopened flowers (just enough to expose the stigma). Centrifuge the bacterial solution at room temperature (4000 rpm for 10 minutes), discard the waste liquid, and resuspend the cells in 500 mL of a 5wt% sucrose solution. Add 200 μL / L of the surfactant Silwet-77 and stir evenly. Completely immerse the stripped cabbage inflorescence in the Agrobacterium suspension. Vacuum the solution at -0.09 MPa for 5 minutes, release the air for 5 minutes, and then vacuum the solution again under the same conditions for 5 minutes. Remove any excess Agrobacterium suspension with absorbent paper and incubate in a moist, dark environment for 48 hours. Pollen from the unsoaked plants is then used to pollinate the soaked plants, repeating this process every other day for two weeks. Seeds are obtained after incubation for approximately one month.

[0102] (3) Screening and detection of transgenic positive cabbage plants

[0103] GFP fluorescence initial screening: The seeds harvested in step (2) were evenly sown in a square culture dish covered with three layers of moist filter paper. After germination, photos were taken and observed using a handheld fluorescence instrument in a completely dark environment.

[0104] PCR test: Take 1cm of the seedlings screened above 2 DNA extraction from leaves: DNA was extracted using a simple DNA extraction method. First, DNA extraction buffer was prepared, 0.5 mL of 20 wt% SDS solution, 0.5 mol·L -1 0.5 mL of EDTA aqueous solution, 1 mol·L -1 2 mL of Tris-HCl buffer (pH 9.0), 2 mol·L -1 2mL of LiCl solution was added with ddH2O to 10mL, and the mixture was mixed well before use. Then, about 0.1g of sample was taken and placed in a 2mL centrifuge tube, 200μL of DNA extraction buffer and 1 magnetic bead were added, and the tube was placed in a sample grinder for grinding (65Hz, 120s). After removing the magnetic beads from the centrifuge tube, the tube was centrifuged at 12000rpm for 5min. 100μL of supernatant was transferred to a new 1.5mL centrifuge tube, 100μL of isopropanol was added, and the tube was quickly and gently inverted to mix. After standing at room temperature for 5min, the tube was centrifuged at 13,000rpm for 10min. The supernatant was discarded, and the precipitate was washed with 1mL of 70v / v% ethanol, and the tube was centrifuged at 12000rpm for 3min. The supernatant was discarded. After repeated washing, the tube was inverted on absorbent paper, the ethanol was blown off, and 50μL of ddH2O was added to dissolve the DNA. The obtained DNA was detected by PCR. The specific steps and primers used are shown in (3) and (4) in Example 2.

[0105] See the results Figure 4 .

[0106] Example 4 Phenotypic Observation and Statistical Analysis

[0107] Because the cabbage BrPILS5 gene is overexpressed (BrPILS5 OE ) strains grew weakly and could not grow and bear fruit normally, so only the expression of BrPILS5 gene (BrPILS5 RNAi ) strains were observed and statistically analyzed.

[0108] (1) In vitro germination test

[0109] The transgenic plants obtained in Example 3 and the non-transgenic (wild-type) control plants were treated according to the planting and high-temperature treatment methods in Example 1 and allowed to grow under normal conditions. Mature pollen from the transgenic plants and the non-transgenic control plants under normal conditions, and mature pollen from the transgenic plants and the non-transgenic control plants after high-temperature treatment (pollen after high-temperature stress at the mature stage, and pollen after high-temperature stress at the tetrad stage and then restored to maturity under normal conditions) were taken and incubated in 30 μL of a culture medium (15 wt% sucrose, 0.4 mmol·L -1 HBO3, 0.4mmol·L -1 Ca(NO3)2 and 0.1wt% agar, with 2mmol·L -1 After culturing at 20°C in the dark for 3 h in a solution of NaOH (pH adjusted to 5.8), 30 μL of Alexander dye solution (for detecting pollen viability) was added dropwise, and the flowers were stained for 30 min in the dark at room temperature. The flowers were observed and photographed under a microscope, and the images were analyzed using ImageJ software.

[0110] (2) In vivo pollination and fruiting test

[0111] Mature pollen of transgenic plants under normal conditions and non-transgenic control plants, mature pollen of transgenic plants after high temperature treatment and non-transgenic control plants (pollen after suffering high temperature stress at the mature stage, pollen after suffering high temperature stress at the tetrad stage and recovering to mature stage under normal conditions) were taken as male parents, and plants that were not transgenic under normal conditions were taken as female parents. Pollination and growth were carried out under normal conditions, and the fruit setting of siliques was observed for about 20 days.

[0112] (3) Statistical analysis

[0113] These experimental results were statistically analyzed and graphed using GraphPad Prism 9.0 (GraphPad Software, San Diego, USA). Data were expressed as mean ± SD and were further evaluated using analysis of variance to determine significance. Differences were considered significant at a 95% confidence level (p < 0.05).

[0114] The results are as follows Figure 5 As shown, although the expression of BrPILS5 gene in Brassica rapa was inhibited (BrPILS5 RNAi ) transgenic plants under normal conditions had significantly lower pollen germination and seed setting rates than the control (cabbage has a racemose inflorescence and a large number of pollen, so it has little effect on seed production). However, under high temperature conditions, the expression of the cabbage BrPILS5 gene (BrPILS5 RNAi ) transgenic plants exhibited significantly improved pollen heat tolerance, as evidenced by significantly increased pollen germination and seed set rates during the two periods of pollen development most sensitive to heat stress: the early pollen development period (represented by the tetrad stage) and the late pollen development period (represented by pollen maturity). Therefore, inhibiting the expression of the BrPILS5 gene in the recipient plants can improve heat tolerance during the pollen development period (early and late pollen development), reversing the complete male sterility caused by high-temperature conditions, and providing valuable resources for breeding new plant-resistant varieties.

[0115] The above-described implementation scheme provides a detailed description of the technical solution of the present invention. It should be understood that the above is only a specific embodiment of the present invention and is not intended to limit the present invention. Any modifications, supplements or similar substitutions made within the scope of the principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Application of the cabbage BrPILS5 gene in improving the heat resistance of plant pollen, characterized in that: The application is to inhibit the expression of the cabbage BrPILS5 gene to improve the resistance of plant pollen under high temperature stress during the pollen development period. The inhibition of the expression of the cabbage BrPILS5 gene is to co-suppress the cabbage BrPILS5a and BrPILS5b genes, wherein the BrPILS5a gene is numbered BraA09g010950.3C, and the gene sequence is shown in SEQ ID NO.1; the BrPILS5b gene is numbered BraA07g003460.3C, and the gene sequence is shown in SEQ ID NO.2; and the plant pollen is cabbage pollen.

2. The use according to claim 1, characterized in that The pollen development stage is the early pollen development stage and / or the late pollen development stage.

3. The use according to claim 1, characterized in that During application, the artificial miRNA fragment that inhibits the expression of the cabbage BrPILS5 gene is connected to a plant overexpression vector to construct a recombinant overexpression vector, and then the recombinant overexpression vector is transformed into a recipient plant.

4. The use according to claim 3, characterized in that The plant overexpression vector is pCAMBIA1300.

5. The use according to claim 3, characterized in that The recombinant overexpression vector is transformed into a recipient plant by the following operation: the recombinant overexpression vector is transformed into Agrobacterium, and then the recipient plant is infected with the obtained recombinant Agrobacterium.

Images