Method and application of early pregnancy detection in cattle based on indirect competition and recombinase polymerase isothermal amplification reaction

Abstract

The present invention discloses a method and application of detecting early pregnancy in cattle based on indirect competition and recombinase polymerase isothermal amplification reaction. The detection method comprises an aptamer that can specifically bind to bovine pregnancy-associated glycoprotein (bPAG) as shown in SEQ ID: 1, a forward primer as shown in SEQ ID: 2, and a reverse primer as shown in SEQ ID: 3. The aptamer is used as a recognition probe and an amplification template, and a recombinase polymerase isothermal amplification reaction is performed. The signal is amplified by a luminescent substance or biotin on the amplification product, and bPAG is qualitatively and quantitatively detected. The bPAG detection method provided by the present invention is simple to operate, has low detection cost, and short detection time, and can be used for laboratory and field detection.

Description

Technical Field

[0001] The invention relates to the technical field of biological detection, and in particular to a method and application of bovine early pregnancy detection based on indirect competition and recombinase polymerase isothermal amplification reaction. Background Art

[0002] In the process of large-scale cattle breeding, due to factors such as fertilization failure and reproductive diseases, a series of problems such as extended calving interval and decreased milk production have been caused, which have reduced reproductive efficiency, increased feeding costs, and seriously affected the economic benefits of ranch breeding. Accurate early pregnancy diagnosis of livestock after mating is a fundamental requirement and important means to improve the reproductive efficiency and economic benefits of dairy cows.

[0003] At present, the main methods for diagnosing pregnancy in dairy cows include: (1) rectal palpation, (2) ultrasonic examination, and (3) rapid detection technology of bovine pregnancy-related glycoproteins based on antibody technology. Rectal palpation is the most commonly used method, but this method can generally be performed 45-60 days after mating, and the technical level of the operator is relatively high, which cannot meet the requirements for early pregnancy diagnosis. Ultrasonic diagnosis can be performed 30 days after mating, with a high accuracy rate, but the instrument price is relatively high. The detection of bPAG in blood or milk samples based on immunoassay is the most widely used early pregnancy detection method, and its principle is antibody-antigen recognition reaction. At present, commercialized PAG detection kits have been applied to production, such as the bovine rapid visual detection kit based on enzyme-linked immunosorbent reaction developed by IDEXX in the United States. However, the recognition molecules of PAG detection technology based on immunoassay are all antibodies, and the preparation of antibodies requires animal experiments, which has problems such as long preparation time, high cost, and poor stability.

[0004] In recent years, aptamers have gradually become a research hotspot as a new type of recognition molecule. Its essence is a single-stranded oligonucleotide folded into secondary or tertiary structures such as hairpins, stem loops, pseudoknots and G-quadruplexes, which interact with target molecules through hydrogen bonds, van der Waals forces, etc. to form a stable complex. Compared with traditional antibodies, aptamers have the advantages of not being restricted by immune conditions and immunogenicity, simple preparation, low production cost, high stability, easy labeling and storage, etc. Therefore, aptamers are widely used as an ideal molecular probe in the fields of analytical detection, disease diagnosis and treatment.

[0005] Recombinase polymerase isothermal amplification (RPA) uses a complex formed by the combination of recombinase and primers to search for homologous sequences on the template, trigger a chain exchange reaction after positioning, start DNA synthesis, and exponentially amplify the target area on the template. RPA technology can quickly complete nucleic acid amplification under constant temperature conditions of 25-42°C. The product can be monitored in real time by fluorescence quantification using a probe method, or it can be combined with lateral flow chromatography test strips, biochips, gel electrophoresis and other methods for detection.

[0006] At present, there are no reports on the research of early pregnancy detection in cattle based on aptamer recognition-recombinase polymerase isothermal amplification reaction. Summary of the invention

[0007] In view of the shortcomings of existing bovine pregnancy diagnosis technology, the present invention provides a bovine early pregnancy detection method based on indirect competition and recombinase polymerase isothermal amplification reaction, which can achieve simple, rapid, highly sensitive and low-cost early pregnancy diagnosis of cattle.

[0008] The technical solution adopted by the present invention to solve the above technical problems is:

[0009] A primer-aptamer combination for detecting bPAG based on RPA reaction, comprising: an aptamer sequence, a forward primer sequence and a reverse primer sequence, wherein the aptamer sequence is shown in SEQ ID No. 1, the forward primer sequence is shown in SEQ ID No. 2, and the reverse primer sequence is shown in SEQ ID No. 3. The aptamer is used as a recognition probe and amplification template, and after adding primers, a recombinase polymerase isothermal amplification reaction is performed, and the signal is amplified by a luminescent substance or biotin on the amplification product, so as to qualitatively and quantitatively detect bPAG.

[0010] Preferably, the forward primer and reverse primer sequences can be selectively linked to fluorescent groups, biotin, avidin, amino groups, digoxigenin, and horseradish peroxidase.

[0011] A method for detecting early pregnancy in cattle based on indirect competition and recombinase polymerase isothermal amplification reaction, comprising the following steps:

[0012] bPAG9 is coated on a 96-well ELISA plate; the sites on the surface of the ELISA plate that are not bound to bPAG9 are blocked with a blocking reagent; the sample to be tested and the aptamer sequence are added, and the aptamer sequence competes with the bPAG on the solid-phase enzyme label and the bPAG in the test solution for binding; the aptamer bound to the bPAG on the enzyme label is eluted by a heating method, and the RPA detection system is constructed as a template for isothermal amplification; and the qualitative and quantitative detection of the bPAG protein is achieved by detecting fluorescence information.

[0013] Preferably, the coating solution of bPAG9 is 50 mmol / L carbonate buffer with a pH of 9.6.

[0014] Preferably, the blocking reagent is 1% BSA (w / v), and the blocking time is 2 hours.

[0015] Preferably, the bPAG and the aptamer are incubated at room temperature for 0.5 h.

[0016] Preferably, the heating elution temperature of the aptamer is 95°C.

[0017] Preferably, the RPA detection system is: 29.5 μL of a reconstitution buffer, preferably TwistAmp hydration buffer, 2.5 μL of a 5 μM upstream primer, 2.5 μL of a 5 μM downstream primer, 12 μL of ultrapure water, 1 μL of a template, and 2.5 μL of 280 mM magnesium acetate; the upstream primer is the forward primer sequence in the primer-aptamer combination, the downstream primer is the reverse primer sequence, and the template is the aptamer sequence, i.e., the SEQ ID No. 1 sequence.

[0018] Preferably, the RPA reaction temperature is 37° C. and the reaction time is 20 min.

[0019] The primer-aptamer combination is used in bPAG detection in bovine body fluids and in bovine early pregnancy detection.

[0020] The bovine early pregnancy detection method based on indirect competition and recombinase polymerase isothermal amplification reaction is used for bPAG detection in bovine body fluids and in bovine early pregnancy detection.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] (1) Low cost: Aptamers and primers can be synthesized in vitro, which overcomes the shortcomings of long antibody preparation cycle and high cost and reduces production costs;

[0023] (2) Simple operation: Compared with the traditional RPA detection technology, the present application does not need to extract DNA as a template, but uses the aptamer that specifically recognizes the target as a template for RPA amplification. No expensive instruments are required, the whole process is carried out under constant temperature conditions, the detection steps are fewer, and the operation is simple;

[0024] (3) High efficiency: Compared with traditional B-ultrasound detection methods, it does not require professional operating techniques, has extremely low technical requirements for operators, and can realize on-site detection of batch samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 A is a schematic diagram of the bPAG detection principle of Example 1 of the present invention;

[0026] Figure 1B is a schematic diagram of the bPAG detection principle of Example 2 of the present invention;

[0027] Figure 2 This is a standard curve diagram for detecting bovine pregnancy-associated glycoprotein 9 in Example 1 of the present invention;

[0028] Figure 3 This is a standard curve diagram for detecting bovine pregnancy-associated glycoprotein 9 in Example 2 of the present invention;

[0029] Figure 4 This is a result diagram of visual detection of bPAG9 based on the method of Example 2; wherein - is a negative control, + is a positive control, 1-3 are the test results of non-pregnant cow serum, and 4-6 are the test results of pregnant cow serum. DETAILED DESCRIPTION

[0030] The technical scheme of the present invention is further described below in conjunction with the accompanying drawings and specific embodiments. The aptamers, forward primers, and reverse primers used in the following examples are all synthesized by Shanghai Bioengineering Technology Co., Ltd. using the sequences described. The bPAG9 described in the examples is bovine pregnancy-associated glycoprotein 9, PBST is phosphate-tween buffer, PBS is phosphate buffered saline, BSA is bovine serum albumin, EvaGreen is a green fluorescent nucleic acid dye, and Aptamer is a nucleic acid aptamer.

[0031] A primer-aptamer combination for detecting bPAG based on RPA reaction, comprising: an aptamer sequence, a forward primer sequence and a reverse primer sequence, wherein the aptamer sequence is shown in SEQ ID No. 1: 5'-

[0032] CTACGGTGCCTTGAAGTGACGCCAGGGTGGGGGGGTGGGTGTTGGCGTACACTTCGCATAGCAGGTCACTTCCAGG-3'; its forward primer sequence is shown in SEQ ID No.2: 5'-CTACGGTGCCTTGAAGTGACGCCAG-3'; the reverse primer sequence is shown in SEQ ID No.3: 5'-CCTGGAAGTGACCTGCTATGCGAAG-3'. The aptamer is used as a recognition probe and amplification template, and after adding primers, a recombinase polymerase isothermal amplification reaction is carried out. The signal is amplified by the luminescent substance or biotin on the amplification product, and bPAG is qualitatively and quantitatively detected. Preferably, the forward primer and reverse primer sequences can be selectively connected to a fluorescent group, biotin, avidin, an amino group, digoxigenin, or horseradish peroxidase.

[0033] Example 1: Figure 1As shown in A, the bovine early pregnancy detection method based on indirect competition and recombinase polymerase isothermal amplification reaction, that is, the method for detecting bPAG9 based on indirect competition-RPA reaction fluorescence, includes the following specific steps:

[0034] (1) bPAG9 was coated on the ELISA plate: bPAG9 was prepared into a solution with a concentration of 2 μg / mL using 50 mmol / L carbonate buffer (pH 9.6), 200 μL was added to each well, and the plate was incubated overnight at 4°C; the plate was washed three times with PBST (10 mmol / L PBS, pH 7.4, 0.05% Tween-20) and patted dry;

[0035] (2) Blocking: Add 200 μL of 1% BSA (w / v) blocking solution to each well, incubate at room temperature for 2 h, wash with PBST, and pat dry;

[0036] (3) Sample addition: add 100 μL of different concentrations of bPAG9 (0, 0.05, 0.5, 1, 5, 25, 100, 200, 500 ng / mL) and 100 μL of aptamer solution (100 nM) dissolved in buffer, incubate at room temperature for 30 min, wash with PBST, and pat dry;

[0037] (4) RPA reaction: add 100 μL ultrapure water to each well, heat at 95°C for 5 min, elute the aptamer, and take 1 μL of the eluted aptamer as a template for RPA reaction. RPA reaction system: reconstitution buffer 29.5 μL, 5 μM upstream primer 2.5 μL, 5 μM downstream primer 2.5 μL, ultrapure water: 12 μL, 280 mM magnesium acetate 2.5 μL, 0.5× EvaGreen 2.5 μL; incubate at 37°C for 20 min;

[0038] (5) Fluorescence detection: The fluorescence signal of the reaction solution was measured using a full-wavelength scanning multifunctional reader at an excitation wavelength of 500 nm and an emission wavelength of 530 nm;

[0039] (6) Establishment of standard curve: Plot the standard curve using bPAG9 concentration as the horizontal axis and F / F0 as the vertical axis. Use software to draw the standard curve and establish a regression equation. F is the fluorescence intensity corresponding to the presence of bPAG9; F0 is the fluorescence intensity corresponding to the bPAG9 mass concentration of 0; Figure 2 The standard curve determined by this method is: y=0.714-0.228Igx, R=0.997, the linear range is 0.5-100ng / mL, and the detection limit is 0.20ng / mL.

[0040] Example 2: Figure 1 As shown in B, the method for detecting early pregnancy in cattle based on indirect competition and isothermal amplification reaction of recombinase polymerase comprises the following steps:

[0041] (1) bPAG9 coated on ELISA plate: bPAG9 was prepared into a solution with a concentration of 2 μg / mL using 50 mmol / L carbonate buffer (pH 9.6), 200 μL was added to each well, and incubated at 4°C overnight. Washed with PBST (10 mmol / L PBS, pH 7.4, 0.05% Tween-20) 3N5 times, and patted dry;

[0042] (2) Blocking: Add 200 μL of 1% BSA (w / v) blocking solution to each well, incubate at room temperature for 2 h, wash with PBST, and pat dry;

[0043] (3) Sample addition: add 100 μL of different concentrations of bPAG9 (0, 0.05, 0.5, 1, 5, 25, 50, 100, 200, 400 ng / mL) and 100 μL of aptamer solution (100 nM), incubate at room temperature for 30 min, wash with PBST, and pat dry;

[0044] (4) RPA reaction: add 100 μL ultrapure water to each well, heat at 95°C for 5 min, elute the aptamer, take 1 μL of the aptamer as a template for RPA reaction, RPA reaction system: 29.5 μL of reconstitution buffer, 2.5 μL of 5 μM biotinylated upstream primer, 2.5 μL of 5 μM downstream primer, 12 μL of ultrapure water, 1 μL of template, 2.5 μL of 280 mM magnesium acetate; incubate at 37°C for 20 min; after the reaction, add 100 μL of 0.05 U / mL streptavidin-horseradish peroxidase (SA-HRP) to each well, react at room temperature for 10 min, wash with PBST, add 100 μL of color development solution to each well, color for 10 min in the dark, add 100 μL of stop solution (2.0 mol / L H2SO4), and measure the absorbance at 450 nm with an enzyme reader;

[0045] (4) Establishment of standard curve: With bPAG9 concentration as the horizontal axis and A / A0 as the vertical axis, a standard curve was drawn using software and a regression equation was established, where A is the absorbance at 450 nm corresponding to each mass concentration of bPAG9, and A0 is the absorbance at 450 nm when the mass concentration of bPAG9 is 0; Figure 3 The standard curve determined by this method is: y=0.703-0241Igx, R=0.996, the linear range is 0.5-200ng / mL, and the detection limit is 0.26ng / mL.

[0046] Example 3: Early pregnancy detection in dairy cows. The method for colorimetric detection of bPAG9 in Example 2 above is applied to early pregnancy detection in dairy cows, and the steps are as follows:

[0047] (1) Preparation of test samples: 50 Holstein cows bred for 28 days were selected, and blood was collected from the vein. The blood samples were placed on ice and transported to the laboratory within 3 hours. The blood samples were centrifuged at 2000×g for 10 minutes, and the serum was transferred to a centrifuge tube and diluted 2-fold with PBS (0.01M, pH 7.4) for later use.

[0048] (2) Sample detection: Take several ELISA plates coated with bPAG9 and blocked with 1% BSA in Example 2, add 100 μL of diluted serum sample and 100 μL of aptamer solution (100 nM), incubate at room temperature for 30 min, wash with PBST, and pat dry; add 100 μL of ultrapure water to each well, heat at 95°C for 5 min, elute the aptamer, take 1 μL of aptamer as a template for RPA reaction, RPA reaction system: reconstitution buffer 29.5 μL, 5 μM biotinylated upstream primer 2.5 μL, 5 μM downstream primer 2.5 μL, ultrapure water: 12 μL, template 1 μL, 280 mM magnesium acetate 2.5 μL; incubate at 37°C for 20 min, add 100 μL of ultrapure water to each well 0.05U / mL streptavidin-horseradish peroxidase (SA-HRP), react at room temperature for 10 minutes, wash with PBST, add 100μL colorimetric solution to each well, color for 10 minutes in the dark, add 100μL stop solution (2.0mol / L H2SO4), and measure the absorbance at 450nm with a microplate reader. Use bPAG9 (5ng / mL) as a positive control and PBS buffer as a blank control;

[0049] (3) Test results: The test results are determined as positive or negative using a critical value (cut-off, CD). Some researchers have reported that the critical value of bPAG is 0.5 ng / mL. When cut-off ≥ 0.5 ng / m, it is positive, indicating pregnancy; when cut-off ≤ < 0.5 ng / m, it is negative, indicating non-pregnancy. Figure 4 The colorimetric results of some samples were detected based on the method of Example 2. Ultrasonic examination (gold label method) was used to confirm the detection results of the present invention on the 45th day after the cows were bred. The detection results of the indirect competitive-RPA colorimetric method are shown in Table 1, and the accuracy rate reached 90%.

[0050] Table 1 Results of indirect competition-RPA colorimetric method for detecting early pregnancy in dairy cows

[0051]

[0052] The above description is only a preferred embodiment of the present application and is not intended to limit the present invention. For those skilled in the art, the present application may have various modifications and changes. Any modification, equivalent replacement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A method for detecting bovine pregnancy-associated glycoprotein 9 by fluorescence based on indirect competition-RPA reaction, characterized in that: The specific steps include: (1) bPAG9 was coated on the ELISA plate; (2) Blocking: Use a blocking reagent to block the sites on the surface of the ELISA plate that are not bound to bPAG9; (3) Adding samples: adding the sample to be tested and the aptamer solution, incubating the reaction at room temperature, so that the aptamer competes with the bPAG on the solid-phase enzyme label and the bPAG in the test solution for binding. The sequence of the aptamer is shown in SEQ ID No. 1; (4) RPA reaction: The aptamer bound to the bPAG on the enzyme label is eluted by heating method, and the eluted aptamer is used as a template to construct an RPA detection system, and isothermal amplification is performed using a forward primer with a sequence as shown in SEQ ID No. 2 and a reverse primer with a sequence as shown in SEQ ID No. 3; the sequences of the forward primer and the reverse primer are connected to a fluorescent group; the temperature of the heating method elution is 95°C; (5) Fluorescence detection: Qualitative and quantitative detection of bPAG protein can be achieved by detecting fluorescence information.

2. The method according to claim 1, characterized in that: The bPAG9 coating solution was 50 mmol / L, pH 9.6 carbonate buffer, the blocking reagent was 1% BSA (w / v), and the blocking time was 2 h.

3. The method according to claim 2: in step (3), the room temperature incubation time is 0.5 h.

4. The method according to claim 3: in step (4), the temperature of the RPA reaction is 37°C and the time is 20 min.

5. According to the method of claim 4: the RPA detection system is: 29.5 μL of reconstitution buffer, 2.5 μL of 5 μM upstream primer, 2.5 μL of 5 μM downstream primer, 12 μL of ultrapure water, 1 μL of template, and 2.5 μL of 280 mM magnesium acetate.

Images