ShRNA targeting growth hormone release inhibitory hormone gene and its medical application

Abstract

The present invention relates to a shRNA for relieving and / or treating the itch of chronic dermatitis or chronic dry skin, wherein the shRNA is a nucleic acid molecule targeting the SST gene. The shRNA can directly inhibit the activation of neurons in the spinal cord that are involved in the occurrence of abnormal itch sensation in chronic dermatitis, reduce the expression of itch-related neuropeptides, and inhibit the occurrence of abnormal itch sensation in chronic dermatitis and chronic dry skin from the root, thereby solving the problem of chronic itch that clinically troubles patients. The shRNA is integrated into an shRNA expression vector, prepared into a pharmaceutical preparation, transfected into cells through a viral vector, enters the RNAi pathway, inhibits the expression of the SST gene, and has great potential application value for relieving itch of various skin diseases and itch of chronic dry skin.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to shRNA targeting growth hormone release inhibitory hormone gene and its medical application. Background Art

[0002] Chronic dermatitis is also called chronic allergic dermatitis. It is caused by the patient's continuous high sensitivity or repeated contact with external allergens. After the onset of this disease, the skin surface usually shows symptoms of redness and abnormal itching. Abnormal itching includes mechanical itch sensitization (itch alienation) and persistent spontaneous itching. The more you scratch during an attack, the more itchy it becomes, affecting the patient's quality of life. Long-term repeated scratching may cause the patient's skin fungal infection to worsen, and secondary and infectious other diseases. Chronic dermatitis includes atopic dermatitis, psoriasis, and allergic contact dermatitis.

[0003] Atopic dermatitis (AD) is a chronic, recurrent, inflammatory skin disease with severe itching of the skin. At present, its etiology is not clear, and genetic susceptibility, food allergen stimulation, inhaled allergen stimulation, autoantigens, infection and skin dysfunction can all induce it. Existing antipruritic drugs mainly act on the periphery and can only treat the symptoms but not the root cause. Since chronic dermatitis such as atopic dermatitis can cause the release of itch-causing substances in the spinal cord and the activation of itch-related neurons, existing antipruritic drugs cannot improve the changes in the spinal cord in chronic dermatitis, and cannot solve the problem of abnormal itch sensation in chronic dermatitis from the root.

[0004] Somatostatin (SST) is a brain-gut peptide that inhibits the release of growth hormone. There are a large number of somatostatin-positive neurons in the dorsal horn of the spinal cord (SST + neurons).

[0005] RNA interference (RNAi) is an efficient and specific tool for gene deletion research. It was originally discovered by Andrew Fire and Craig Mello in nematodes as a gene silencing phenomenon mediated by double-stranded RNA (dsRNA), and exists in almost all eukaryotic organisms. With the in-depth development of research, there are currently three types of RNA interference, namely 1. siRNA: (short / small interfering RNAs), 2. microRNA (miRNA, micro RNA), 3. shRNA (RNA-Short hairpin RNAs): short hairpin RNA, which is a non-coding small RNA molecule designed to form a hairpin structure, can inhibit gene expression through RNA interference. shRNA is a DNA molecule that can be cloned into an expression vector and express a double-stranded siRNA. Short hairpin RNA sequences can be designed according to the target gene and cloned into a specific vector.

[0006] shRNAs (Short hairpin RNAs): short hairpin RNAs, generally constructed with DNA vectors, are small non-coding RNA molecules designed to form hairpin structures, which can inhibit gene expression through RNA interference. The shRNA cloned into the shRNA expression vector usually includes two short inverted repeat sequences separated by a stem-loop sequence, forming a hairpin structure controlled by the RNA polymerase III (PolIII) promoter. Then 5-6 Ts are attached as the transcription terminator of PolIII.

[0007] RNAi has been widely used in gene function research, drug target discovery and drug screening in various eukaryotic organisms. In recent years, a variety of clinical trials have shown that RNAi drugs targeting pathogenic genes have great potential to treat diseases that have plagued humans for many years. Summary of the invention

[0008] Based on this, the object of the present invention is to provide shRNA and applications thereof for alleviating and treating chronic dermatitis or chronic dry skin.

[0009] The technical solutions to achieve the above objectives include the following:

[0010] The first aspect of the present invention is to provide a shRNA for alleviating and / or treating itching caused by chronic dermatitis or chronic dry skin, wherein the shRNA is a nucleic acid molecule targeting the SST gene.

[0011] The second aspect of the present invention is to provide the use of the above shRNA in the preparation of a drug for alleviating and / or treating itching caused by chronic dermatitis or chronic dry skin.

[0012] The third aspect of the present invention is to provide a drug for alleviating and / or treating chronic dermatitis and itch, which comprises an shRNA expression vector integrated with shRNA targeting the SST gene.

[0013] In some of the embodiments, the sequence of the shRNA is shown in any one of SEQ ID NO.1-SEQ ID NO.3.

[0014] In some embodiments, the sequence of the shRNA is shown as SEQ ID NO.1.

[0015] In some embodiments, the chronic dermatitis is atopic dermatitis, allergic contact dermatitis, or psoriasis.

[0016] In some embodiments, the shRNA vector in the drug is a lentivirus or an adenovirus vector, more preferably a recombinant adeno-associated virus (rAAV) vector.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The shRNA developed by the present invention can directly inhibit the activation of neurons in the spinal cord that are involved in the occurrence of abnormal itch in chronic dermatitis, reduce the expression of itch-related neuropeptides, and fundamentally inhibit the occurrence of abnormal itch in chronic dermatitis or chronic dry skin models, thereby solving the problem of chronic itch that clinically plagues patients with atopic dermatitis, and providing a new and effective solution for the clinical treatment of chronic dermatitis, especially atopic dermatitis, allergic contact dermatitis, psoriasis, and pruritus caused by chronic dry skin. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 .Relative expression levels of SST genes after HEK293T cells were transfected with different plasmids.

[0020] Figure 2.The expression levels of SST protein (A and B) and mRNA (C and D) in the spinal cord of mice with atopic dermatitis, including: (A) the change of SST protein expression in the spinal cord of mice with atopic dermatitis model; (B) the effect of shRNA (P5943) targeting the SST gene on the change of SST protein expression in the spinal cord of mice with atopic dermatitis model; (C) the change of the relative expression level of SST mRNA in the spinal cord of mice with atopic dermatitis model; (D) the effect of shRNA targeting the SST gene on the change of the relative expression level of SST mRNA in the spinal cord of mice with atopic dermatitis model; In the figure, AD stands for atopic dermatitis, atopic dermatitis model; Control: model control; Neg: Negative Control, shRNA control virus.

[0021] Figure 3 .Activation of SST-positive neurons (tdTomato) in the spinal cord of AD model mice and the interference effect of shRNA; (AC) co-expression of c-Fos and tdTomato in the spinal cord of the model control group; (DF) co-expression of c-Fos and tdTomato in the spinal cord of atopic dermatitis model mice; (GI) co-expression of c-Fos and tdTomato in the spinal cord of atopic dermatitis model mice injected with shRNA (P5943) targeting the SST gene; (J) comparison of the proportion of c-Fos / tdTomato double-positive neurons in the spinal cord of the three groups of animals.

[0022] Figure 4 .Abnormal itch sensation in atopic dermatitis model and the interference effect of shRNA (P5943) targeting the SST gene, including: (A) mechanical itch sensitization phenomenon in atopic dermatitis model; (B) increased spontaneous itch phenomenon in atopic dermatitis model; (C) relief of mechanical itch sensitization phenomenon in atopic dermatitis model by shRNA targeting the SST gene; (D) relief of increased spontaneous itch phenomenon in atopic dermatitis model by shRNA targeting the SST gene.

[0023] Figure 5.ELISA (A and B) and RT-PCR (C and D) were used to detect the expression level of SST in the spinal cord of animals in the ACD model group. (A) The expression of SST protein in the spinal cord of ACD model mice was significantly increased; (B) shRNA (P5943) targeting the SST gene interfered with the increase of SST protein expression in the spinal cord of ACD model mice; (C) The relative expression level of SST mRNA in the spinal cord of ACD model mice was significantly increased; (D) shRNA targeting the SST gene interfered with the increase of the relative expression level of SST mRNA in the spinal cord of ACD model mice. In the figure, ACD is Allergic contact dermatitis, allergic contact dermatitis model; Control: model control; Neg: Negative Control, shRNA control virus.

[0024] Figure 6 .The effect of shRNA interference virus targeting SST gene on the activation of SST-positive neurons in the dorsal horn of the spinal cord caused by the ACD model; (AC) the co-expression of c-Fos and tdTomato in the spinal cord of the model control group; (DF) the co-expression of c-Fos and tdTomato in the spinal cord of ACD model mice; (GI) the co-expression of c-Fos and tdTomato in the spinal cord of ACD model mice after injection of shRNA targeting SST gene; (J) comparison of the proportion of c-Fos / tdTomato double-positive neurons in the spinal cord to tdTomato-positive neurons in the above three groups of animals.

[0025] Figure 7 .The effect of shRNA interference virus targeting SST gene on itch abnormality in ACD model mice;

[0026] (A) shRNA targeting SST gene alleviates the mechanical itch sensitization phenomenon in the ACD model; (B) shRNA targeting SST gene alleviates the increase in spontaneous itch phenomenon in the ACD model.

[0027] Figure 8.The expression level of SST in the spinal cord of chronic dry skin model mice, wherein, (A) ELISA method was used to detect the change of SST protein expression in the spinal cord of chronic dry skin model mice; (B) ELISA method was used to detect the interference effect of shRNA targeting SST gene on the change of SST protein expression in the spinal cord of chronic dry skin model mice; (C) RT-PCR method was used to detect the change of relative expression level of SST mRNA in the spinal cord of chronic dry skin model mice; (D) RT-PCR method was used to detect the interference effect of shRNA targeting SST gene on the change of relative expression level of SST mRNA in the spinal cord of chronic dry skin model mice; in the figure, CDS is Chronicdry skin, chronic dry skin; Control: model control group; Neg: Negative Control, shRNA control virus.

[0028] Fig. 9 .Activation of SST-positive neurons (tdTomato) in the spinal cord of CDS model mice and the interference effect of shRNA; (AC) co-labeling of c-Fos and tdTomato in the spinal cord of animals in the CDS model control group; (DF) co-labeling of c-Fos and tdTomato in the spinal cord of CDS model mice; (GI) interference effect of shRNA targeting SST gene on the expression of c-Fos in tdTomato-positive neurons in the spinal cord of CDS model mice; (J) comparison of activation ratios of tdTomato-positive neurons in the spinal cord of three groups of animals (c-Fos+tdTomato) / tdTomato).

[0029] Fig.10 . The interference effect of shRNA targeting SST gene on abnormal itch sensation in chronic dry skin model, including: (A) the alleviation of mechanical itch sensitization phenomenon after injection of shRNA targeting SST gene in chronic dry skin model; (B) the alleviation of increased spontaneous itch phenomenon after injection of shRNA targeting SST gene in chronic dry skin model.

[0030] Fig.11.The expression levels of SST protein (A and B) and mRNA (C and D) in the spinal cord of PSO model mice, among which, (A) the psoriasis model caused a significant increase in the expression of SST protein in the spinal cord of model mice; (B) shRNA interference targeting SST gene significantly increased the expression of SST protein in the spinal cord of psoriasis model mice; (C) the psoriasis model caused a significant increase in the relative expression level of SST mRNA in the spinal cord of model mice; (D) shRNA interference targeting SST gene increased the relative expression level of SST mRNA in the spinal cord of psoriasis model mice; In the figure, PSO: Psoriasis, psoriasis model; Control: model control group; Neg: Negative Control, shRNA control virus.

[0031] Fig.12 .The PSO model induces the activation (c-Fos) of SST-positive neurons (tdTomato) in the spinal cord and the interference effect of shRNA; (AC) co-labeling of c-Fos and tdTomato in the spinal cord of PSO model control animals; (DF) co-labeling of c-Fos and tdTomato in the spinal cord of psoriasis model animals; (GI) co-labeling of c-Fos and tdTomato in the spinal cord of psoriasis model mice after injection of shRNA targeting the SST gene; (J) comparison of the ratio of activated tdTomato-positive neurons in the spinal cord of the three groups of animals (c-Fos+tdTomato) / tdTomato).

[0032] Fig.13 .Abnormal itch sensation in psoriasis model and the interference effect of shRNA targeting SST gene on the abnormal itch sensation, including: (A) the interference effect of shRNA targeting SST gene on the mechanical itch sensitization phenomenon in psoriasis model animals; (B) the interference effect of shRNA targeting SST gene on the increase of spontaneous itch in atopic dermatitis model animals. DETAILED DESCRIPTION

[0033] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0034] The experimental methods in the following examples without specifying specific conditions are usually carried out according to conventional conditions, such as the fourth edition of Molecular Cloning: A Laboratory Manual edited by Green and Sambrook, published in 2013, or according to the conditions recommended by the manufacturer. The various commonly used chemical reagents used in the examples are all commercially available products.

[0035] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0036] The present invention has found in the research process that in multiple models of chronic dry skin and chronic dermatitis, SST-positive neurons in the spinal cord are activated in large quantities, and the SST content increases significantly, thereby participating in the abnormal itch sensation of the above-mentioned models, including mechanical itch sensitization (itch alienation) and abnormal increase in spontaneous scratching behavior. The present invention provides shRNA targeting the SST gene, which can be used to alleviate and / or treat chronic dry skin and chronic dermatitis itch, especially for chronic dry skin and atopic dermatitis, allergic contact dermatitis, psoriasis itch, and has a good inhibitory effect. The shRNA is packaged in an shRNA expression vector (for example, rAAV-U6-shRNA1 (Somatostatin)-CMV-EGFP-SV40 polyA in some embodiments) as a pharmaceutical preparation, transfected into cells through a viral vector, enters the RNAi pathway, and inhibits the expression of the SST gene, which has great potential application value for relieving itch for various skin diseases and chronic dry skin itch.

[0037] The present invention is further described in detail below with reference to specific embodiments.

[0038] Example 1

[0039] 1. Experimental Materials

[0040] The present invention prepares an adeno-associated virus (AAV) carrying a shRNA gene fragment that specifically interferes with the SST gene, and injects the AAV into mice intrathecally to inhibit the expression of the mouse SST gene. The specific operation is as follows:

[0041] 1. Screening of effective shRNA interference sequences targeting SST genes

[0042] 1.1 Use of plasmids

[0043]

[0044] 2. Experimental Methods

[0045] 1. Preparation of shRNA-carrying viruses:

[0046] 1.1 On the first day, trypsinize HEK293T cells (1640 + 10% FBS) to make a cell suspension and adjust the cell density to 1.0*10 5 Cells were inoculated in 6-well plates at 2000ul / well, with 2*10 cells per well. 5 Incubate the cells at 37°C in 5% CO2 overnight.

[0047] 1.2 On the second day, HEK293T cells were transfected with the plasmid combinations shown in the table below (transfection method was performed according to FUGENE HD), with 3 replicates for each combination. After transfection, the cells were placed in a 37°C, 5% CO2 incubator for 72 hours.

[0048] PT-5943 PT-5944 PT-5945 PT-0916 PT-6019 1.0+1.0ug / well 1.0+1.0ug / well 1.0+1.0ug / well 1.0+1.0ug / well

[0049] 1.3 72 hours after transfection, take out the cells and use the TaKaRa MiniBEST Universal RNA Extraction Kit to extract total cell RNA (see the instruction manual for detailed steps). After the total RNA is extracted, use the HiScript II One Step qPCR-PCR-SYBR Green Kit for Real-time PCR.

[0050] The rAAV-U6-shRNA (scramble)-CMV-EGFP-SV40 polyA carrying the above-mentioned PT-5943, PT-5944, PT-5945, rAAV-cTNT-EGFP-5'miR-30a-shRNA (somatostatin)-3'miR-30a-WPREs and the control PT-0916 were obtained respectively.

[0051] 2. Virus injection

[0052] After intrathecal injection of a virus carrying shRNA targeting the Somatostatin gene (rAAV-cTNT-EGFP-5'miR-30a-shRNA (somatostatin)-3'miR-30a-WPREs) in mice 6-8 weeks after birth, an empty vector (control virus) of rAAV-U6-shRNA (scramble)-CMV-EGFP-SV40 polyA (scramble is an invalid sequence that does not exist in humans and mice, CCTAAGGTTAAGTCGCCCTCG) was injected intrathecally as a negative control. The animals were raised normally for three weeks until the virus was expressed.

[0053] 3. Establish a chronic itch model in the mice injected with the above virus

[0054] In this example, an atopic dermatitis model was established: the hair on the back of the neck of mice aged 6-8 weeks was shaved, and 5 days later, the itch-inducing agent Calcipotroil (20 μl, 0.1 μM) was dripped on the shaved part of the skin on the back of the neck for 8 consecutive days to establish an atopic dermatitis itch model, and 20 μl of anhydrous ethanol was dripped for 8 consecutive days as a control, i.e., the control group.

[0055] 4. Detection of SST protein content in mouse spinal cord using enzyme-linked immunosorbent assay (ELISA)

[0056] Mice were anesthetized with isoflurane and the spinal cord was quickly removed. The spinal cord tissue was lysed and centrifuged at high speed, and the supernatant was taken for detection. The SST protein content of the spinal cord tissue sample was determined according to the ELISA kit operating instructions. The brief procedure is as follows: Spinal cord supernatant and working solution were added to a 96-well plate and mixed for 60 minutes. Substrate was added and reacted in the dark at room temperature for 10 minutes, and the absorbance was measured at 450nm using an ELISA reader.

[0057] 5. Detection of SST mRNA content in mouse spinal cord using RT-PCR technology

[0058] Mice were anesthetized with isoflurane, the spinal cord was quickly removed, and the tissue was ground in liquid nitrogen. Lysis buffer was added and homogenized using a homogenizer. RNA was extracted and reverse transcribed to obtain DNA, which was amplified using a qPCR amplification instrument to detect the expression of the SST gene. GAPDH, which is highly expressed in almost all tissues, is often used as an internal reference to analyze the changes in the relative expression of SST / GAPDH. The relevant qRT-PCR experiment includes the following process:

[0059] a. RNA extraction from animal tissues

[0060] According to the conventional method, the concentration of the extracted RNA was measured by spectrophotometer and then stored in a -80 degree refrigerator.

[0061] b. cDNA synthesis

[0062] RNA reverse transcription to cDNA reaction system:

[0063] Reagents volume Total RNA 10pg-500ng Oligo(dT)18 0.5μl Random Primer(N9) 0.5μl 2×ES Reaction Mix 10μl RT / RIEnzyme Mix 1μl RNase-free Water Variable Total volume 20μl

[0064] c.qPCR

[0065] (1) Primer Table 1;

[0066] (2) System:

[0067]

[0068] (3) Reaction procedure:

[0069]

[0070]

[0071] The extracted RNA was reverse transcribed according to the cDNA reaction system to obtain DNA. The obtained DNA was added according to the system, and the internal reference primer was added to the first four wells of each eight-tube strip, and the target primer was added to the last four wells. After adding the sample, the eight-tube strip was gently shaken to prevent liquid from remaining on the tube wall and affecting the experimental results. The eight-tube strip with the sample was placed in the qRT-PCR instrument for amplification.

[0072] d.PCR:

[0073] (1) SST-cre amplification system:

[0074]

[0075] (2) SST-td amplification system:

[0076]

[0077] In order to detect whether the mice have the target genotype we need, PCR identification is performed on them. Tissue samples are cut from mice that are 7-12 days old and placed in a centrifuge tube containing 75ul protein solution A. The centrifuge tube is placed in a centrifuge for centrifugation. After centrifugation, the tube is placed in a constant temperature metal box and heated at 100 degrees for 1 hour. After heating, 75ul protein solution B is added to each centrifuge tube to obtain mouse DNA.

[0078] The mouse DNA obtained above was prepared according to the system, and after the preparation, it was put into the PCR amplification instrument for amplification. Agar gel was prepared 30 minutes before the end of amplification, and the prepared agar gel was placed in the electrophoresis instrument. 5ul of the amplified sample was pipetted into the agar gel, and 5ul of DL1000 Marker was added to the leftmost side of each row of the agar gel for electrophoresis.

[0079] (2) SST-cre amplification procedure:

[0080] (3) SST-td amplification procedure:

[0081]

[0082] Table 1 PCR primer sequences

[0083]

[0084] 6. Detection model induces c-Fos expression in SST-positive neurons in the dorsal horn of the spinal cord

[0085] In SST tdTomatoTransgenic mice (according to conventional methods, SST::Cre transgenic mice were crossed with ROSA26 CAG -loxP-STOP-loxP-tdTomato (Rosa tdTomato , Ai14) transgenic mice were hybridized to obtain SST tdTomato In transgenic mice, the red fluorescent protein tdTomato is expressed on SST-positive neurons. The mice were anesthetized with isoflurane, and the spinal cord was removed by perfusion. The spinal cord was dehydrated with sucrose gradient and then frozen. The expression of the immediate early gene c-Fos, which marks neuronal activation, was detected by fluorescent immunohistochemical staining. The proportion of cells co-labeled with c-Fos and tdTomato to SST-positive (tdTomato) neurons was counted to analyze the activation of SST-positive neurons.

[0086] 7. Chronic Itch Behavioral Experiment

[0087] I. Mechanical itch test

[0088] The neck skin of the model control (Control) and atopic dermatitis model (AD) mice was shaved and placed in the von-Frey test system for continuous adaptation for 5 consecutive days, 30 minutes per day. On the test day, after the mice were adapted, 0.07g of von-Frey hair was used to stimulate the neck skin of the mice, and the positive response ratio (Scratch% (5Stimuli)) in 5 stimulations was counted.

[0089] II. Spontaneous Itch Detection

[0090] The model control (Control) and atopic dermatitis model (AD) mice were placed in the von-Frey test system and adapted for 30 minutes every day for 5 consecutive days. On the test day, after the mice adapted to the test system, the behavior of the mice was continuously recorded with a camera, and the number of spontaneous scratching (Scratch bouts) of the mice was counted by watching the video.

[0091] Experimental results and analysis:

[0092] 1. Screening of effective shRNA interference sequences targeting SST genes

[0093] After plasmid transfection into HEK293T cells, the expression of SST gene was determined by real-time PCR and relative quantitative analysis (2 -δδCt The results showed that PT-5943 (SEQ ID NO.1) had the most significant effect on the downregulation of the target gene compared with other interference sequences (see the results). Figure 1 ).

[0094] 2. Effect of shRNA interference virus targeting SST gene on the content of SST protein in the spinal cord of atopic dermatitis model mice

[0095] The expression of SST protein in the spinal cord was detected by ELISA. In the atopic dermatitis model, the content of SST in the spinal cord increased significantly ( Figure 2 A). In the spinal cord of atopic dermatitis model animals, the SST content in the shRNA interference virus injection group was significantly lower than that in the control virus injection group ( Figure 2 B) The results suggest that shRNA interference virus targeting the SST gene can reverse the increase in SST protein content in the spinal cord of mice caused by the atopic dermatitis model.

[0096] 3. Effect of shRNA interference virus targeting SST gene on the expression level of SST mRNA in the spinal cord of atopic dermatitis model mice

[0097] RT-PCR was used to detect the expression levels of SST mRNA (P5943) and internal reference GAPDH in the spinal cord. In the atopic dermatitis model, the relative expression level of SST mRNA in the spinal cord increased significantly ( Figure 2 C). In the spinal cord of atopic dermatitis model animals, the relative expression level of SST mRNA in the shRNA interference virus injection group was significantly lower than that in the control virus injection group ( Figure 2 D) The results suggest that the shRNA interference virus targeting the SST gene designed by the present invention can reverse the increase in the level of SST mRNA in the spinal cord of mice caused by the atopic dermatitis model.

[0098] 4. Effects of shRNA interference virus targeting SST gene on activation of SST-positive neurons in the dorsal horn of the spinal cord caused by atopic dermatitis

[0099] Using SST tdTomato Transgenic mice were tested for c-Fos expression in the dorsal horn of the spinal cord using fluorescent immunohistochemistry, and the ratio of the number of c-Fos and tdTomato co-labeled cells to the number of tdTomato-positive cells, i.e. (c-Fos+tdTomato) / tdTomato, was calculated to observe the activation of SST-positive neurons in the dorsal horn of the spinal cord. Compared with the model control group, the ratio of (c-Fos+tdTomato) / tdTomato in the spinal cord of atopic dermatitis model mice increased significantly ( Figure 3 AF, J), indicating that the SST-positive neurons in the dorsal horn of the spinal cord of atopic dermatitis model mice were activated in large numbers. Compared with atopic dermatitis model mice, the atopic dermatitis model mice injected with shRNA (P5943) targeting the SST gene had a significant decrease in (c-Fos+tdTomato) / tdTomato in the spinal cord ( Figure 3GJ), indicating that the shRNA targeting the SST gene designed in the present invention (P5943) can inhibit the activation of SST-positive neurons in the dorsal horn of the spinal cord caused by the AD model.

[0100] 5. Effect of shRNA interference virus targeting SST gene on abnormal itch sensation in atopic dermatitis model mice

[0101] Test indicator 1: Use 0.07g von-Frey fiber to stimulate the skin on the back of the mouse neck and detect the proportion of scratching positive reaction (mechanical itch reaction) of the mouse;

[0102] Detection indicator 2: Record a video to detect the number of spontaneous scratching (spontaneous itch behavior) of mice within half an hour.

[0103] 1) Abnormal itch sensation in atopic dermatitis model mice

[0104] Specific experimental process: 14 C57 mice were randomly divided into two groups, 7 mice in each group, and the mechanical itch response basal values ​​and spontaneous itch behavior basal values ​​of the two groups of mice were detected. Then the above method was used to establish the atopic dermatitis chronic itch model in one group of C57 mice (experimental group), and the other group was treated with control (20μl of anhydrous ethanol was dripped for 8 consecutive days as a control). After the model was established, the differences in mechanical itch response and spontaneous itch behavior of mice in the experimental group and the control group were recorded respectively.

[0105] The results showed that: 1) Compared with the control group, the mechanical itch response of the atopic dermatitis model mice was significantly increased ( Figure 4 A) showed that the atopic dermatitis model mice had mechanical itch sensitization; 2) compared with the control group, the spontaneous itch behavior of the atopic dermatitis model mice increased significantly ( Figure 4 B), indicating that atopic dermatitis model mice have increased spontaneous itch behavior.

[0106] 2) Relief of itch abnormalities in atopic dermatitis model mice by shRNA interference virus targeting SST gene

[0107] Fourteen C57 mice were randomly divided into two groups, with 7 mice in each group. The shRNA (P5943) interference virus targeting the SST gene (experimental group) and the control virus (PT-0916) were injected intrathecally. After three weeks of virus expression, the mechanical itch response and spontaneous itch behavior baseline values ​​of the mice in the experimental and control groups were detected. Subsequently, an atopic dermatitis model was established, and the mechanical itch response and spontaneous itch behavior of the mice in the experimental and control groups were tested again. The results showed that the mechanical itch response of the mice in the experimental group ( Figure 4 C) and spontaneous itch behavior ( Figure 4 D) were significantly lower than those in the control group, indicating that the shRNA (P5943) designed in the present invention significantly reduced the mechanical itch sensitization and increased spontaneous itch behavior in atopic dermatitis model mice.

[0108] Example 2: Relief and treatment of itching in allergic contact dermatitis by shRNA (P5943)

[0109] Establishment of the Allergic Contact Dermatitis Model (ACD): The abdominal hair of mice 6-8 weeks after birth was shaved, and five days later, 25 μl of 1% squaric acid dibutylester (SADBE) in acetone was pipetted and dropped on the shaved skin area of ​​the mouse abdomen, once a day for 3 consecutive days. After 5 days, 25ul of 1% squaric acid dibutylester (SADBE) was pipetted and dropped on the skin area of ​​the left ear auricle of the mouse every day for 5 consecutive days to establish the allergic contact dermatitis model, and the animals were treated with physiological saline as the control group in the same steps. After that, relevant experiments (including mechanical itch test, self-itch detection, immunohistochemical staining, ELISA, RT-PCR) were carried out, and the experimental process can refer to Example 1.

[0110] See the results Figure 5 ,in, Figure 5 A, B: The expression of SST protein in the spinal cord was detected by ELISA, and the effect of shRNA (P5943) targeting SST gene on the SST protein content in the spinal cord of ACD model mice was detected. In the ACD model, the expression of SST in the spinal cord was significantly upregulated ( Figure 5 A). After injection of shRNA interference virus into ACD model animals, the expression level of SST in the spinal cord was significantly lower than that in the control virus injection group ( Figure 5 B). The results suggest that shRNA (P5943) targeting the SST gene can inhibit the increase of SST protein content in the spinal cord of mice caused by the ACD model.

[0111] RT-PCR was used to detect the expression levels of SST mRNA and internal reference GAPDH in the spinal cord. In the ACD model, the relative expression level of SST mRNA in the spinal cord increased significantly ( Figure 5 C). After the ACD model animals were injected with shRNA interference virus, the relative expression level of SST mRNA in the spinal cord was significantly lower than that in the control virus injection group ( Figure 5 D). The results suggest that the shRNA (P5943) interference virus designed by the present invention targeting the SST gene can inhibit the increase of the SST mRNA level in the spinal cord of ACD model mice.

[0112] Using SST tdTomatoTransgenic mice were used to detect the expression of c-Fos in the dorsal horn of the spinal cord using fluorescent immunohistochemistry, and the ratio of c-Fos-positive cells in tdTomato-positive cells, i.e. (c-Fos+tdTomato) / tdTomato, was counted to analyze the activation of SST-positive neurons in the dorsal horn of the spinal cord. Compared with the model control group, the (c-Fos+tdTomato) / tdTomato ratio in the spinal cord of ACD model mice was significantly upregulated ( Figure 6 AF, J), indicating that there is a large number of activated SST-positive neurons in the dorsal horn of the spinal cord of ACD model mice. After injection of the shRNA interference virus group targeting the SST gene, the (c-Fos+tdTomato) / tdTomato in the spinal cord of ACD model mice was significantly reduced ( Figure 6 GJ), indicating that the activation of SST-positive neurons in the dorsal horn of the spinal cord caused by the ACD model was inhibited by the shRNA targeting the SST gene designed by the present invention.

[0113] For the effect of shRNA interference virus targeting SST gene on itch abnormality in ACD model mice, please refer to Figure 7 The results showed that: 1) In the model control mice, there was no significant difference in the proportion of mechanical itch response between the control virus group and the shRNA interference virus group targeting the SST gene. In the ACD model mice, the mechanical itch sensitization phenomenon was significantly alleviated by the shRNA interference virus targeting the SST gene ( Figure 7 A); 2) In the model control mice, there was no significant difference in spontaneous itch behavior between the control virus group and the shRNA interference virus group targeting the SST gene. In the ACD model mice, the increase in spontaneous itch behavior was significantly alleviated by the shRNA interference virus targeting the SST gene ( Figure 7 B).

[0114] Example 3: Relief and treatment of itch caused by chronic dry skin by shRNA (P5943)

[0115] Chronic dry skin (CDS) model was established: the hair on the back of the neck of mice 6-8 weeks after birth was shaved, and 5 days later, a mixture of acetone / ether (1:1) was pipetted on the back of the neck of the mice for 20 seconds, and then treated with distilled water for 25 seconds (acetone-ether-water, AEW), and AEW was used twice a day for 10 consecutive days (once in the morning and once in the afternoon) to establish a chronic dry skin model. Animals treated with distilled water instead of acetone and ether were used as the control group in the same steps as above. Related experiments (including mechanical itch test, self-itch detection, immunohistochemical staining, ELISA, RT-PCR) were then carried out, and the experimental process can refer to Example 1.

[0116] See the results Figure 8, where B is the effect of shRNA (P5943) targeting SST gene interfering virus on the content of SST protein in the spinal cord of chronic dry skin model mice. The expression of SST protein in the spinal cord was detected using conventional ELISA method. The content of SST in the spinal cord of CDS model animals was significantly increased ( Figure 8 A). In the spinal cord of CDS model animals, the SST content in the shRNA interference virus injection group was significantly lower than that in the control virus injection group ( Figure 8 B). The results suggest that the shRNA (P5943) interference virus targeting the SST gene can significantly inhibit the increase in SST protein content in the mouse spinal cord caused by the CDS model.

[0117] As in Example 1, RT-PCR was used to detect the expression levels of SST mRNA and internal reference GAPDH in the spinal cord. In the CDS model, the relative expression level of SST mRNA in the spinal cord increased significantly ( Figure 8 Middle C). The relative expression level of SST mRNA in the spinal cord of CDS model animals in the shRNA interference virus injection group was significantly lower than that in the control virus injection group ( Figure 8 (D) From the results, it can be seen that the shRNA (P5943) targeting the SST gene designed by the present invention can significantly reverse the increase in the expression of SST mRNA in the mouse spinal cord caused by the CDS model.

[0118] As described in Example 1, using SST tdTomato Transgenic mice were tested for c-Fos expression in the dorsal horn of the spinal cord using fluorescent immunohistochemistry, and the ratio of c-Fos expression in tdTomato-positive cells, i.e. (c-Fos+tdTomato) / tdTomato, was calculated to observe the activation of SST-positive neurons in the dorsal horn of the spinal cord. Compared with the model control group, the ratio of (c-Fos+tdTomato) / tdTomato in the spinal cord of CDS model mice increased significantly (see Fig. 9 AF, J) show that SST-positive neurons in the dorsal horn of the spinal cord of CDS model mice were activated in large numbers. Fig. 9 It was found in the GJ that the (c-Fos+tdTomato) / tdTomato in the spinal cord was significantly lower in the CDS model mice injected with the shRNA interference virus group targeting the SST gene than in the CDS model mice, suggesting that the shRNA targeting the SST gene (P5943) designed by the present invention can inhibit the activation of SST-positive neurons in the dorsal horn of the spinal cord caused by the CDS model.

[0119] For the effect of shRNA interference virus targeting SST gene on itch abnormality in CDS model mice, please refer to Fig.10The results showed that: 1) In the model control mice, there was no significant difference in the proportion of mechanical itch response between the control virus group and the shRNA interference virus group targeting the SST gene. In the CDS model mice, the mechanical itch sensitization phenomenon was significantly alleviated by the shRNA interference virus targeting the SST gene ( Fig.10 A); 2) In the model control mice, there was no significant difference in spontaneous itch behavior between the control virus (PT-0916) group and the shRNA interference virus group targeting the SST gene. In the CDS model mice, the increase in spontaneous itch behavior was significantly alleviated by the shRNA interference virus targeting the SST gene ( Fig.10 B).

[0120] From the above experiments, it can be seen that the shRNA (P5943) can be well used for the relief and treatment of itching caused by chronic dry skin.

[0121] Example 4: Relief and treatment of psoriasis itch by shRNA (P5943)

[0122] Psoriasis model (PSO): The hair on the back of the neck of the mouse was shaved, and 5% Imiquimod (IMQ) cream was applied to the shaved skin, with an area of ​​2.5 cm × 2 cm, and applied once a day for 7 consecutive days to establish a psoriasis model. Vaseline was used instead of IMQ to treat the animals according to the same steps as above as a model control group. Then, related experiments (including mechanical itch test, spontaneous itch detection, immunohistochemical staining, ELISA, RT-PCR, etc.) were carried out. The experimental process can refer to Example 1.

[0123] See the results Fig.11 , Fig.11 Figure B shows the effect of shRNA (P5943) targeting the SST gene on the SST protein content in the spinal cord of psoriasis model mice. The expression of SST protein in the spinal cord was detected by ELISA, and it was found that in this PSO model, the content of SST in the spinal cord increased significantly ( Fig.11 In the spinal cord of PSO model animals, the SST content was significantly lower than that of the control virus injection group ( Fig.11 The results suggest that the shRNA (P5943) interference virus targeting the SST gene can significantly reduce the content of SST protein in the spinal cord of mice in the PSO model.

[0124] As in Example 1, RT-PCR was used to detect the expression levels of SST mRNA and internal reference GAPDH in the spinal cord. In the PSO model, the relative expression level of SST mRNA in the spinal cord increased significantly ( Fig.11Middle C). In the spinal cord of PSO model animals, the relative expression level of SST mRNA in the shRNA interference virus injection group was significantly lower than that in the control virus injection group ( Fig.11 From the results, it can be seen that the shRNA (P5943) targeting the SST gene designed by the present invention can significantly reduce the expression of SST mRNA in the spinal cord of mice caused by the PSO model.

[0125] As described in Example 1, using SST tdTomato Transgenic mice were tested for c-Fos expression in the dorsal horn of the spinal cord using fluorescent immunohistochemistry, and the ratio of the number of c-Fos and tdTomato co-labeled cells to the number of tdTomato-positive cells, i.e. (c-Fos+tdTomato) / tdTomato, was calculated to observe the activation of SST-positive neurons in the dorsal horn of the spinal cord. Compared with the model control group, the ratio of (c-Fos+tdTomato) / tdTomato in the spinal cord of PSO model mice increased significantly (see Fig.12 AF, J) show that a large number of SST-positive neurons in the dorsal horn of the spinal cord of PSO model mice were activated. Fig.12 It can be seen from GJ that compared with the PSO model mice, the (c-Fos+tdTomato) / tdTomato in the spinal cord of the PSO model mice in the group injected with the shRNA (P5943) interfering virus targeting the SST gene was significantly reduced, indicating that the shRNA (P5943) targeting the SST gene designed by the present invention can inhibit the activation of SST-positive neurons in the dorsal horn of the spinal cord of the PSO model mice.

[0126] Effects of shRNA interference virus targeting SST gene on itch abnormality in PSO model mice, see Fig.13 The results showed that: 1) There was no significant difference in the mechanical itch response ratio of the model control mice between the control virus (PT-0916) group and the shRNA interference virus group targeting the SST gene. However, in the PSO model mice, the shRNA interference virus targeting the SST gene could significantly alleviate its mechanical itch sensitization phenomenon ( Fig.13 A); 2) There was no significant difference in the spontaneous itching behavior of the model control mice between the control virus group and the shRNA interference virus group targeting the SST gene. In the PSO model mice, the shRNA interference virus targeting the SST gene can significantly alleviate the increase in its spontaneous itching behavior ( Fig.13 B).

[0127] From the above experiments, it can be known that the shRNA (P5943) designed by the present invention can be well used for alleviating and treating the itch of psoriasis.

[0128] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Use of a shRNA interference sequence targeting the SST gene in the preparation of a drug for alleviating and / or treating itching caused by chronic dermatitis, wherein the chronic dermatitis is atopic dermatitis, allergic contact dermatitis or psoriasis, and the sequence composition of the shRNA interference sequence targeting the SST gene is shown in SEQ ID NO.

1.

2. Use of an shRNA expression vector integrated with an shRNA interference sequence targeting the SST gene in the preparation of a drug for alleviating and / or treating itching of chronic dermatitis, wherein: The chronic dermatitis is atopic dermatitis, allergic contact dermatitis or psoriasis, and the sequence composition of the shRNA interference sequence targeting the SST gene is shown in SEQ ID NO.

1.

3. The use according to claim 2, wherein: The expression vector is a lentiviral vector or an adenoviral vector.

Images