Artemisia argyi AaYABBY1 gene and its application in increasing plant flavonoids content

Abstract

The invention discloses an Artemisia argyi AaYABBY1 gene, and the nucleotide sequence of the Artemisia argyi AaYABBY1 gene is shown in SEQ ID NO. 1. The invention also provides primers, vectors, host bacteria and applications, which provide a basis for increasing the content of plant flavonoids.

Description

Technical Field

[0001] The present invention relates to the technical field related to molecular biotechnology, and more specifically, to an Artemisia argyi AaYABBY1 gene, primers, vectors, host bacteria and applications. Background Art

[0002] Artemisia argyi H. Lév. & Vaniot is a dried leaf of the Asteraceae plant Artemisia argyi H. Lév. & Vaniot, which has the effects of warming the meridians and stopping bleeding, dispelling cold and relieving pain. The chemical components in Artemisia argyi mainly include flavonoids, terpenes, volatile oils, phenylpropanoids, etc. Flavonoids are a major component of Artemisia argyi. More than 50 flavonoids have been identified from Artemisia argyi, which have multiple pharmacological effects such as anti-inflammatory and anti-tumor.

[0003] The key active ingredients of medicinal plants are important material basis and quality evaluation indicators for the pharmacological effects of medicinal materials. They can be synthesized and accumulated in different organs of plants such as roots, stems, and leaves. Flavonoids are a major component of mugwort and an important material basis for the pharmacological effects of mugwort. The flavonoid components of mugwort have multiple effects such as anti-inflammatory and anti-tumor. For example, total flavonoids in mugwort can inhibit the proliferation of liver cancer cells and induce their apoptosis through multiple proteins. Isoeupretinoic acid in mugwort can inhibit the vitality and proliferation of glioma cells; it can also induce apoptosis of liver cancer cells, and its related pharmacological action mechanisms have also been explained. In addition, the flavonoid components of mugwort can also exert a certain anti-inflammatory effect by regulating the levels of pro-inflammatory cytokines in macrophages.

[0004] YABBY family transcription factors are transcription factors with zinc finger structures and helix-loop-helix structures. They are a small family of transcription factors that have only been found in seed plants. This type of transcription factor can regulate the development of plant leaves, flowers, and lateral organ cell differentiation. For example, the YABBY gene of the model plant Arabidopsis thaliana is involved in the development of floral organs and leaves. The rice OsYABBY6 gene is involved in the development and regulation of its leaves; members of the pepper YABBY gene family are widely expressed in leaves and flowers; and tomato YABBY family genes are involved in the regulation of its roots, stems, leaves, flowers, nectaries, carpels, ovules and other organs. If the YABBY gene can be used to increase the flavonoid content, it can be expected to have high medical and economic value. Summary of the invention

[0005] One object of the present invention is to provide an Artemisia argyi AaYABBY1 gene, primers, vectors, host bacteria and applications, which provide a basis for increasing the content of plant flavonoids.

[0006] In order to achieve these objects and other advantages of the present invention, according to one aspect of the present invention, the present invention provides the Artemisia argyi AaYABBY1 gene, the nucleotide sequence of the Artemisia argyi AaYABBY1 gene is shown in SEQ ID NO. 1.

[0007] The present invention also provides a homologous gene of the Artemisia argyi AaYABBY1 gene, which is homologous to the Artemisia argyi AaYABBY1 gene.

[0008] The invention also provides primers for amplifying the Artemisia argyi AaYABBY1 gene.

[0009] The invention also provides a recombinant vector containing the Artemisia argyi AaYABBY1 gene.

[0010] The invention also provides a host bacterium containing the recombinant vector.

[0011] The invention also provides application of the Artemisia argyi AaYABBY1 gene to cultivate plants with high flavonoid content.

[0012] Furthermore, the plant is tobacco or mugwort.

[0013] The present invention has at least the following beneficial effects:

[0014] The present invention clones the AaYABBY1 gene of Artemisia argyi and genetically transforms it into plants by constructing an overexpression vector, which can significantly increase the content of total flavonoids in the resulting transgenic plants, and at the same time significantly upregulate the expression of CHS, CHI, F3H, FLS and F3'H genes on the flavonoid synthesis pathway. The gene can be widely used to increase the content of flavonoids in plants and has a good application prospect for cultivating new germplasm resources of Artemisia argyi.

[0015] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The electrophoresis diagram of the segmented cloned Artemisia argyi AaYABBY1 gene of the present invention;

[0017] Figure 2 It is a phylogenetic tree analysis diagram of the Artemisia argyi AaYABBY1 gene cloned by the present invention;

[0018] Figure 3 The subcellular localization map of the Artemisia argyi AaYABBY1 gene cloned by the present invention;

[0019] Figure 4 This is a diagram showing the expression level of the cloned Artemisia argyi AaYABBY1 gene in different organs of Artemisia argyi, from left to right, respectively, leaf, stem, and root;

[0020] Figure 5 This is the electrophoresis diagram of PCR detection after the cloned Artemisia argyi AaYABBY1 gene was genetically modified into tobacco K326;

[0021] Figure 6 This is a graph analyzing the expression level of the AaYABBY1 gene cloned from Artemisia argyi after it was genetically modified into tobacco K326. DETAILED DESCRIPTION

[0022] The present invention is further described in detail below in conjunction with the accompanying drawings so that those skilled in the art can implement the invention with reference to the description.

[0023] It should be understood that the terms such as “having”, “including” and “comprising” used herein do not exclude the existence or addition of one or more other elements or combinations thereof.

[0024]

[0025] The embodiments of the present application also provide a homologous gene of the Artemisia argyi AaYABBY1 gene, which is homologous to the Artemisia argyi AaYABBY1 gene and can replace the Artemisia argyi AaYABBY1 gene.

[0026] The embodiments of the present application also provide primers for amplifying the Artemisia argyi AaYABBY1 gene, which are used to clone the Artemisia argyi AaYABBY1 gene.

[0027] The embodiments of the present application also provide a recombinant vector containing the Artemisia argyi AaYABBY1 gene, which is used to transfer the Artemisia argyi AaYABBY1 gene into a host bacterium.

[0028] The embodiments of the present application also provide a host bacteria containing the recombinant vector, for example, Agrobacterium can be used to transfer the Artemisia argyi AaYABBY1 gene into plant cells.

[0029] The embodiments of the present application also provide an application of the mugwort AaYABBY1 gene, wherein the mugwort AaYABBY1 gene is transferred into plant cells and then bred to cultivate plants with high flavonoid content; preferably, the plant is tobacco or mugwort.

[0030] The following is a description of specific embodiments.

[0031] <Example 1> provides a method for cloning the cDNA sequence SEQ ID NO.1 of Artemisia argyi AaYABBY1 gene, and also provides amplification primers.

[0032] The acquisition of the cDNA sequence of the Artemisia argyi AaYABBY1 gene comprises the following steps:

[0033] Step 1: RNA extraction: Total RNA was extracted from fresh young leaves of Artemisia argyi using an RNA extraction kit and pretreated with RNaseFree DNase (Promega, USA) to eliminate genomic DNA contamination. RNA integrity was analyzed using 1.5% agarose gel, and RNA purity and concentration were determined by spectrophotometry.

[0034] Step 2: First-strand cDNA synthesis: Add the following reagents to a 0.2 mL PCR tube: 5 μL Total RNA, 1 μL Random Primer p(dN)6 (100 pmol), 1 μL RNase-free ddH2O, incubate at 70°C for 5 min, then place on ice for 2 min, and centrifuge for 3-5 s. Add the following reagents: 2.0 μL 5× First-Strand Buffer, 0.25 μL RNase inhibitor, 0.25 μL Reverse Transcriptase, 0.5 μL 10 mmol dNTP, 10.0 μL Total volume, incubate at 42°C for 60 min, and then incubate at 72°C for 10 min.

[0035] Step 3: Gene segmentation cloning: LA Taq (TaKaRa, DRR02AG) reagent was used for detection on a PCR instrument (Eppendorf, Germany). Gene-specific primers were designed and synthesized using Primer 5.0 software.

[0036] F: ATAATGCCTTTGCCTCTTAGCTC (SEQ ID NO.2)

[0037] R: CTTGATCCTTTGGATCTCCTC (SEQ ID NO.3)

[0038] F: GAGGAGATCCAAAGGATCAAG (SEQ ID NO.4)

[0039] R: CATGAGATAACATTGAGTCATTTGATATATGAG (SEQ ID NO.5)

[0040] The PCR amplification program was as follows: 94 °C for 5 min; 94 °C for 30 s, 55 °C for 45 s, and 72 °C for 90 s, 30 cycles; and 72 °C for 10 min.

[0041] Step 4: PCR electrophoresis and recovery: Run the PCR product on 1% TAE agarose gel electrophoresis. Figure 1 As shown, the target fragment was recovered using a column-type DNA gel recovery kit (Axygen, AP-GX-50), and then the recovered fragment was sequenced to obtain the SEQ ID NO.1 sequence.

[0042] <Example 2> The phylogenetic tree of the nucleotide sequence of the mugwort YABBY transcription factor AaYABBY1 gene was analyzed, and a homologous gene of the AaYABBY1 gene cDNA was provided.

[0043] The SEQ ID NO.1 sequence of the YABBY transcription factor AaYABBY1 gene of Artemisia argyi contains 1050 nucleotides. The sequence was searched for homology on NCBI and the phylogenetic tree was analyzed by MEGA 5.0 software. The method used was Neighbor-Joinjing, bootstrap statistical test, and the number of times was set to 1000. It was found that the gene had a high homology with YABBY genes of other species, and the closest relationship was with AaYABBY5 of Artemisia annua, with a homology of 96.76%. Figure 2 shown.

[0044] <Example 3> The subcellular localization of the YABBY transcription factor AaYABBY1 gene of Artemisia argyi was performed, and the vector and host bacteria of the AaYABBY1 gene cDNA were provided.

[0045] The AaYABBY1 gene sequence obtained by the method of Example 1 was analyzed by analyzing the restriction sites of the pC131-YFP vector multiple cloning site and the AaYABBY1 gene sequence, and EcoRI and SpeI restriction sites were added to both ends of the primers. The target fragment and the vector were double-digested with EcoRI and SpeI, respectively, and the target gene AaYABBY1 was connected to the pC131-YFP vector by homologous recombination to obtain a fusion vector plasmid, which was transformed into Escherichia coli DH5α competent cells, and the PCR amplification primer sequence was designed and synthesized using Primer 5.0 software.

[0046] F: ATGTCAAGCATAGATGTAGCAGCATCATCTG (SEQ ID NO.6)

[0047] R: TTTCTTGAATAATGAGGTCCTTGATCTGTGTCG (SEQ ID NO.7)

[0048] Positive clones were screened by PCR amplification and restriction digestion for sequencing verification. After the sequencing results showed that the target gene had been fused with the vector and the sequence was completely correct, the fusion vector plasmid was transferred into Agrobacterium GV3130 competent cells by liquid nitrogen freeze-thaw method. After colony PCR identification, the leaves of tobacco K326 were transformed by Agrobacterium-mediated transient transformation. Agrobacterium cultured overnight was centrifuged and suspended. The suspension composition (10 mM MgCl2; 10 mM MES; 100 μM AS) was left to stand at room temperature for 3 hours before injection into tobacco K326 leaves at the 4-5 leaf stage. After 3-5 days of injection, the lower epidermis of tobacco K326 leaves was selected, and the fluorescence signal was observed and photographed by laser scanning confocal microscopy (Leica TCS SP8, Germany). The excitation wavelength was 514 nm and the emission wavelength range was 525-575 nm. The results showed that the subcellular localization of the AaYABBY1 gene was in the nucleus.

[0049] <Example 4> The expression differences of the YABBY transcription factor AaYABBY1 gene of mugwort in different organs of mugwort were analyzed.

[0050] Step 1. Material preparation: Collect fresh samples of mugwort roots, stems and leaves, pack them in ziplock bags, freeze them quickly with liquid nitrogen, and store them in a -80°C ultra-low temperature freezer.

[0051] Step 2: RNA extraction: Total RNA was extracted from the roots, stems, and leaves of Artemisia argyi using an RNA extraction kit and pretreated with RNaseFree DNase (Promega, USA) to eliminate genomic DNA contamination. RNA integrity was analyzed using 1.5% agarose gel, and RNA content was determined by spectrophotometry.

[0052] Step 3. cDNA preparation: cDNA was synthesized using the AMV first-strand cDNA synthesis kit (Roche, Switzerland).

[0053] Step 4: Primer design: Select 18S as the endogenous reference gene and use Primer 5.0 software to design specific primers for qRT-PCR:

[0054] AaYABBY1-F:TTGTGGTCTGTGAATATGGGCATGG (SEQ ID NO.8)

[0055] AaYABBY1-R:GAGGATGGTGAGGAGCAGTTGAATC (SEQ ID NO.9)

[0056] 18S-F:GCTGTGCAATGCTGACAAGTCTTC (SEQ ID NO.10)

[0057] 18S-R:ACCCAGTATCAACTCCCGCTGAG (SEQ ID NO. 11).

[0058] Step 5, qRT-PCR: 2×SG Fast qPCR Master Mix (High Rox, B639273, BBI) quantitative PCR reagent was used for detection on a StepOne Plus fluorescent quantitative PCR instrument (ABI, USA). The amplification program was: 95°C for 30 s; 95°C for 5 s, 60°C for 30 s, 45 cycles; data was collected every 5 seconds from 65°C to 95°C at an interval of 0.5°C.

[0059] Step 6: Use 2 -ΔΔCT The expression level of AaYABBY1 gene in different organs of mugwort was calculated by the method. The results showed that AaYABBY1 gene was expressed in roots, stems and leaves, among which the highest expression level was in the medicinal part leaves. Figure 4 shown.

[0060] <Example 5> Research and application of the gene function of Artemisia argyi YABBY transcription factor AaYABBY1.

[0061] 1. Transformation of Tobacco K326

[0062] 1. Transformation to tobacco K326

[0063] The fusion vector plasmid in Example 3 was transferred into the Agrobacterium strain GV3130 by liquid nitrogen freeze-thaw method, and colony PCR detection was performed. Tobacco K326 leaves were cut into small pieces of about 1×1 cm, and the leaf pieces were placed face down on the MS pre-culture medium. After 2 days of pre-culture, they were placed in the Agrobacterium suspension containing the expression vector and soaked for 5 to 10 minutes. The excess bacterial liquid was absorbed by sterile paper, and the leaf pieces were inoculated face down on the MS solid culture medium and cultured in the dark for 2 days.

[0064] The tobacco leaf pieces after co-cultivation were transferred to MS screening medium, and the medium was changed every 15 days until green buds were generated. When the buds grew to about 2 cm, they were transferred to MS rooting medium for rooting induction. When the seedlings grew to 5-7 cm, they were unearthed, and leaf DNA was extracted for PCR identification. The positive plants were selected as transgenic tobacco. A total of 13 AaYABBY1 positive plants were obtained. The results are as follows: Figure 5 As shown. Specific primers for PCR were designed using Primer 5.0 software:

[0065] AaYABBY1-F:AAGTACAACAGTCGAATGCC (SEQ ID NO.12)

[0066] AaYABBY1-R:CCTCGCCCTTCACGATAC (SEQ ID NO.13)

[0067] qRT-PCR amplification was performed using primers SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.9 in Example 4, and the specific amplification of the target gene was analyzed using the melting curve method. 18S was selected as the endogenous reference gene, and 2 -ΔΔCT The expression level of the target gene was calculated by the PCR method, and the significance of the difference in gene expression level was analyzed using SPSS 19.0 software. Three biological replicates were set for all treatments. By detecting the expression level of the target gene in the overexpression positive plants, the results showed that the expression level of the AaYABBY1 gene in the positive plants was 2 to 16 times that of the control. Figure 6 shown.

[0068] 2. Analysis of Metabolites of Transgenic Plants

[0069] The total flavonoid content in the leaves of transgenic tobacco K326 was determined by enzyme labeling and using a plant flavonoid assay kit (Suzhou Mengxi Biopharmaceutical Technology Co., Ltd.). The results showed that the total flavonoid content in transgenic tobacco K326 increased by 54.11% compared with the control, indicating that the AaYABBY1 gene plays an important role in plant flavonoid biosynthesis.

[0070] 3. AaYABBY1 gene overexpression regulates the expression of genes in the plant flavonoid biosynthesis pathway

[0071] The gene expression levels in the flavonoid biocomplex pathway were analyzed using the method in Example 4, and it was found that in the leaves of AaYABBY1 transgenic tobacco K326, the expression of all detected genes was upregulated. Except for CHI and F3H, the expression levels of PAL, C4H, 4CL, CHS, FLS and F3'H were significantly higher than those of the control, which were 4.62 times, 4.46 times, 2.33 times, 18.78 times, 11.89 times and 3.95 times that of the control, respectively.

[0072] The number of equipment and processing scale described here are used to simplify the description of the present invention. Modifications and variations of the AaYABBY1 gene of the present invention and its application in increasing the flavonoid content of plants are obvious to those skilled in the art.

[0073] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes, and they can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the illustrations shown and described herein.

Claims

1. AaYABBY1 gene of Artemisia argyi, characterized in that: The nucleotide sequence of the Artemisia argyi AaYABBY1 gene is shown in SEQ ID NO.

1.

2. A recombinant vector containing the Artemisia argyi AaYABBY1 gene according to claim 1.

3. A host bacteria containing the recombinant vector according to claim 2.

4. The use of the Artemisia argyi AaYABBY1 gene according to claim 1, characterized in that: A plant is cultivated to have a high flavonoid content; the plant is tobacco or mugwort.

Images