An mRNA vaccine and a preparation method and application thereof

Abstract

The application provides an mRNA vaccine and a preparation method and application thereof. Specifically, the application provides application of GMCSF as an immune adjuvant in preparation of an mRNA vaccine, and further provides an mRNA molecule, which encodes a GMCSF-antigen-FC1 fusion protein, wherein the GMCSF-antigen-FC1 fusion protein comprises, from an N terminus to a C terminus, an amino acid sequence of GMCSF, an amino acid sequence of an antigen and an amino acid sequence of FC1 in sequence, wherein the antigen is an antigen from a virus. The mRNA molecule of the application can be used for preparing a vaccine for preventing infection of novel coronavirus BA2 and BA5 mutant strains, and can induce a strong immune response.

Description

Technical Field

[0001] This invention relates to the field of mRNA drug technology, and more specifically, to an mRNA vaccine that can be used to prevent novel coronavirus infection, its preparation method, and its application. Background Technology

[0002] mRNA drugs have significant advantages over traditional drugs in terms of preparation cycle, preparation cost, and drugability, and mRNA vaccines targeting antiviral and antitumor drugs have broad market prospects. In mRNA drug design, sequence design is one of the most important aspects of the field. An ideal sequence design should endow the vaccine with better immunogenicity, manifested in its ability to stimulate a stronger humoral and cellular immune response. Summary of the Invention

[0003] One object of the present invention is to provide an mRNA molecule that can be used to prepare an mRNA vaccine.

[0004] Another object of the present invention is to provide applications of the said mRNA molecule.

[0005] This invention introduces GMCSF molecules into the mRNA sequence, enabling them to target endogenous dendritic cells (DCs) and thereby induce better B-cell and T-cell immunity. Comparative studies have shown that the GMCSF+ antigen has a stronger ability to induce neutralizing antibodies than the existing IL15SA+ antigen, and these neutralizing antibodies remain stable for up to 17 weeks, demonstrating a highly effective and long-lasting protective effect.

[0006] On the one hand, this invention provides the application of GMCSF as an immune adjuvant in the preparation of mRNA vaccines.

[0007] On the other hand, the present invention also provides an mRNA molecule that encodes a GMCSF-antigen-FC1 fusion protein, wherein the GMCSF-antigen-FC1 fusion protein comprises, from the N-terminus to the C-terminus, the amino acid sequence of GMCSF, the amino acid sequence of the antigen, and the amino acid sequence of FC1, wherein the antigen is an antigen derived from a virus.

[0008] According to a specific embodiment of the present invention, the mRNA molecule provided by the present invention comprises, in sequence, a nucleotide sequence encoding GMCSF, a nucleotide sequence encoding the antigen, and a nucleotide sequence encoding FC1.

[0009] According to a specific embodiment of the present invention, the antigen in the mRNA molecule provided by the present invention is selected from the RBD antigen of the novel coronavirus BA2 strain. Preferably, the RBD antigen has a sequence consisting of amino acid residues 160-463 as shown in SEQ ID No. 1.

[0010] According to a specific embodiment of the present invention, the mRNA molecule provided by the present invention encodes a GMCSF-antigen-FC1 fusion protein, wherein the GMCSF is a full-length sequence. Preferably, the GMCSF has a sequence consisting of amino acid residues 1-144 as shown in SEQ ID No. 1.

[0011] According to a specific embodiment of the present invention, the mRNA molecule provided by the present invention encodes a GMCSF-antigen-FC1 fusion protein, wherein the FC1 has a sequence consisting of amino acid residues 479-695 as shown in SEQ ID No. 1.

[0012] According to specific embodiments of the present invention, the mRNA molecule provided by the present invention encodes a GMCSF-antigen-FC1 fusion protein in which GMCSF and RBD antigen have an IgG hinge structure. In some specific embodiments, the IgG hinge structure has an amino acid sequence as shown in SEQ ID No. 2 (SEQ ID No. 2: EPKSCDKTHTCPPCP). The present invention ensures that GMCSF has correct spatial folding and is active.

[0013] According to a specific embodiment of the present invention, in the GMCSF-antigen-FC1 fusion protein encoded by the mRNA molecule provided by the present invention, the GMCSF and RBD antigen, as well as the RBD antigen and FC1, are linked by IgG hinge structures. Preferably, the IgG hinge structures have amino acid sequences as shown in SEQ ID No. 2.

[0014] According to a specific embodiment of the present invention, the mRNA molecule of the present invention encodes the amino acid sequence shown in SEQ ID No. 1.

[0015] According to a specific embodiment of the present invention, the mRNA molecule provided by the present invention has a nucleotide sequence encoding GMCSF that consists of nucleotides 1-432 as shown in SEQ ID No. 3.

[0016] According to a specific embodiment of the present invention, the mRNA molecule provided by the present invention has a nucleotide sequence encoding the RBD antigen consisting of nucleotides 478-1389 as shown in SEQ ID No. 3.

[0017] According to a specific embodiment of the present invention, the mRNA molecule provided by the present invention has a nucleotide sequence encoding FC1 consisting of nucleotides 1435-2085 as shown in SEQ ID No. 3.

[0018] According to a specific embodiment of the present invention, the mRNA molecule provided by the present invention further includes a nucleotide sequence encoding an IgG hinge structure between GMCSF and RBD antigen and / or between RBD antigen and FC1. Preferably, the nucleotide sequence encoding the IgG hinge structure has the nucleotide sequence shown in SEQ ID No. 4 (SEQ ID No. 4: gagccaaagtcatgtgacaaaactcacacatgcccaccgtgccca).

[0019] According to a specific embodiment of the present invention, the mRNA molecule of the present invention has a nucleotide sequence as shown in SEQ ID No. 3.

[0020] According to specific embodiments of the present invention, the mRNA molecule of the present invention may optionally include a 5'UTR sequence at its 5' end, and may optionally include a 3'UTR sequence and / or a PolyA tail sequence at its 3' end. In some specific embodiments of the present invention, the mRNA molecule of the present invention comprises, from its 5' end to its 3' end, a 5'UTR sequence, a sequence encoding the GMCSF-antigen-FC1 fusion protein, a 3'UTR sequence, and a PolyA tail sequence in sequence.

[0021] According to a specific embodiment of the present invention, the mRNA molecule of the present invention may be unmodified or modified, and the modification includes one or more of the following: 5' end capping modification and pseudouridine triphosphate modification.

[0022] On the other hand, the present invention also provides a fusion protein whose amino acid sequence includes the amino acid sequence encoded by the mRNA molecule described in the present invention.

[0023] Preferably, in the fusion protein, the antigen is selected from the RBD antigen of the novel coronavirus BA2 strain, and the RBD antigen preferably has a sequence consisting of amino acid residues from position 160 to 463 as shown in SEQ ID No. 1.

[0024] Preferably, in the fusion protein, the GMCSF has a sequence consisting of amino acid residues 1-144 as shown in SEQ ID No. 1.

[0025] Preferably, in the fusion protein, FC1 has a sequence consisting of amino acid residues 479-695 as shown in SEQ ID No. 1.

[0026] Preferably, in the fusion protein, an IgG hinge structure exists between the GMCSF and the RBD antigen. The IgG hinge structure preferably has the amino acid sequence shown in SEQ ID No. 2.

[0027] Preferably, in the fusion protein, an IgG hinge structure exists between the RBD antigen and FC1. The IgG hinge structure preferably has the amino acid sequence shown in SEQ ID No. 2.

[0028] According to a specific embodiment of the present invention, the fusion protein has the amino acid sequence shown in SEQ ID No. 1.

[0029] On the other hand, the present invention also provides a DNA molecule encoding the mRNA molecule described herein.

[0030] On the other hand, the present invention also provides a recombinant plasmid containing the DNA molecule described in the present invention.

[0031] On the other hand, the present invention also provides lipid nanoparticles loaded with the mRNA molecules described in the present invention.

[0032] On the other hand, the present invention also provides an mRNA vaccine comprising the mRNA molecule, the fusion protein, the DNA molecule, the recombinant plasmid, or the lipid nanoparticles described herein.

[0033] The mRNA vaccine of this invention exhibits a surprisingly high antibody titer against the RBD of the Omeprone variant, which has extremely low immunogenicity. Furthermore, in this invention, the GMCSF-FC-RBD fusion gene, despite its large size, still demonstrates ideal protein expression, enabling a strong immune response. In some specific embodiments, the mRNA vaccine of this invention can be used to prevent infection with the BA2 and BA5 variants of the novel coronavirus, inducing a strong immune response, generating extremely high levels of neutralizing antibodies, maintaining long-term immune protection, and simultaneously inducing high-intensity specific T-cell immunity.

[0034] On the other hand, the present invention also provides a method for preparing an mRNA vaccine, which mainly includes the construction of an mRNA expression vector, vector linearization by enzyme digestion, mRNA transcription, mRNA capping, and LNP encapsulation of the mRNA stock solution to obtain an mRNA formulation. Specific preparation methods can be performed in accordance with conventional practices in the field.

[0035] In some specific embodiments of the present invention, an mRNA vaccine against the novel coronavirus BA2 strain is designed, wherein the amino acid sequence encoded by the active ingredient mRNA molecule includes an N-terminal GMCSF sequence capable of activating endogenous DC cell function, a BA2 strain RBD sequence, and a C-terminal FC1 sequence. This mRNA vaccine is named GMCSF-RBD(BA2)-FC1 and can be in the form of lipid nanoparticles. After immunizing mice with this mRNA vaccine, serum samples were collected at 2 weeks (4 weeks), 6 weeks (8 weeks), and 15 weeks (17 weeks) after booster immunization. Binding antibodies were detected. The GMCSF-RBD(BA2)-FC1 group at a 1 μg dose showed a higher level of binding antibody production. The 1 μg dose group had a binding antibody dilution ratio of 1:400,000 two weeks after booster immunization, which is slightly higher than the data from the Moderna mRNA vaccine (mRNA-1273) under the same conditions. Serum neutralizing antibodies were detected at 2, 6, and 15 weeks after booster immunization. GMCSF-RBD(BA2)-FC1 produced high levels of neutralizing antibodies, and even 17 weeks after the initial immunization, serum diluted 1:2000 still showed neutralizing activity. Conversely, neutralization tests using BA5 pseudovirus also showed high levels of neutralizing antibodies in GMCSF-RBD(BA2)-FC1, and even 8 weeks after the initial immunization, serum diluted 1:4000 still showed neutralizing activity. Stimulation of spleen-derived T cells with a BA2 peptide library and detection of various cytokine secretion revealed that T cell immunity persisted up to 8 weeks after the start of immunization. A 1µg dose of GMCSF-RBD(BA2)-FC1 vaccine induced specific T cells to produce and secrete IFNγ, with significantly higher IFNγ secretion levels than the SP-RBD(BA2)-FC1 and IL15SA-RBD(BA2)-FC1 groups. Meanwhile, flow cytometry analysis also verified the ELISA results, showing the production of CD8+ specific T cells and the release of IFNγ cytokines after peptide stimulation.

[0036] In summary, this invention provides an mRNA vaccine that can be used to prevent infection with the BA2 and BA5 variants of the novel coronavirus and can induce a strong immune response. Attached Figure Description

[0037] Figure 1 This is a schematic diagram of the target gene sequence structure.

[0038] Figure 2 This shows the binding antibodies induced by three different mRNAs and their persistence.

[0039] Figure 3 This shows the neutralizing antibodies against BA2 induced by three different mRNAs and their maintenance status.

[0040] Figure 4 This shows the neutralizing antibodies against BA5 induced by three mRNAs and their maintenance (8 weeks).

[0041] Figure 5 The image shows the ELISA method used to detect the secretion of IFNγ by T cells targeting BA2 (over 8 weeks).

[0042] Figure 6 The flow cytometry data show the secretion of IFNγ by T cells targeting BA2 (8 weeks). Detailed Implementation

[0043] The following embodiments are for illustrative purposes only and are not intended to limit the invention. Unless otherwise specified, the experiments and methods described in the embodiments are generally performed in accordance with conventional methods well known in the art and described in various references.

[0044] Furthermore, unless specific conditions are specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products. Those skilled in the art will understand that the examples are described by way of illustration and are not intended to limit the scope of protection claimed by the invention. All disclosures and other references mentioned herein are incorporated herein by reference in their entirety.

[0045] Example 1

[0046] 1. Construction of the target gene pUTR vector

[0047] The UTR sequence was synthesized by Shanghai Sangon Biotech Co., Ltd. and cloned into the commercial vector pCDNA3.1. The resulting pUTR vector contains the following elements:

[0048] T7 promoter sequence: TAATACGACTCACTATAGGG (SEQ ID No. 5);

[0049] 5'-UTR sequence:

[0050] GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACCCCGGCGCCGCCACC (SEQ ID No. 6);

[0051] 3'-UTR sequence:

[0052] GCTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCA (SEQ ID No. 7);

[0053] The UTR sequence is 30nt polA+GCATATGACT+70nt polA.

[0054] Meanwhile, the 5'-UTR sequence contains an Nhe1 restriction site (GCTAGC), and the 3' end polA sequence contains an Apal restriction site (GGGCCC).

[0055] The SP, IL15SA, and RBD(BA2) gene sequences were codon-optimized and synthesized by a third-party gene synthesis company. The IgG1FC gene was derived from the invivogen pFuse-IgG1FC plasmid and cloned into a vector via PCR. The GMCSF gene was cloned using conventional molecular cloning techniques, employing commercially available pEAX cDNA (normal human lymph node cDNA) as a template via PCR. These elements (SP, IL15SA, GMCSF, BA2-FC1) were cloned into the pUTR vector using common molecular cloning reactions such as enzyme digestion and ligation. Verification was performed using enzyme digestion, sequencing, and transient transfection, resulting in three plasmids for mRNA preparation: pUTR-SP-RBD(BA2)-FC1, pUTR-IL15SA-RBD(BA2)-FC1, and pUTR-GMCSF-RBD(BA2)-FC1 (see simplified sequence diagram for details). Figure 1 The nucleotide sequences of SP-RBD(BA2)-FC1, IL15SA-RBD(BA2)-FC1, and GMCSF-RBD(BA2)-FC1 are as follows (the underlined sequences are hinge structure sequences):

[0056] SP-RBD(BA2)-FC1(SEQ ID No.8):

[0057]

[0058]

[0059] L15SA-RBD(BA2)-FC1(SEQ ID No.9):

[0060]

[0061]

[0062] GMCSF-RBD(BA2)-FC1 (SEQ ID No.3):

[0063]

[0064]

[0065] Amino acid sequence of GMCSF-RBD(BA2)-FC1 fusion protein (SEQ ID No.1):

[0066] MWLQSLLLLGTVACSISAPARSPSPSTQPWEHVNAIQEARRLLNLSRDTAAEMNETVEVISEMFDLQEPTCLQTRLELYKQGLRGSLTKLKGPLTMMASHYKQHCPPTPETSCATQIITFESFKENLKDFLLVIPFDCWEPVQEEPKSCDKTHTCPPCPGSCTLKSFTVEKGIYQTSNFRVQPTESIVRFPNITNLCPFDEVFNATRFASVYAWNRKRISNCVADYSVLYNFAPFFAFKCYGVSPTKLNDLCFTNVYADSFVIRGNEVSQIAPGQTGNIADYNYKLPDDFTGCVIAWNSNKLDSKVGGNYNYLYRLFRKSNLKPFERDISTEIYQAGNKPCNGVAGFNCYFPLKSYGFRPTYGVGHQPYRVVVLSFELLHAPATVCGPKKSTNLVKNKCVNFNFNGLTGTGVLTESNKKFLPFQQFGRDIADTTDAVRDPQTLEILDITPCSFGGVSVITPLEEPKSCDKTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTISKAKGQPREPQVYTLPPSRDELTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGK*

[0067] 2. In vitro transcription preparation of SP-RBD(BA2)-FC1, IL15SA-RBD(BA2)-FC1, and GMCSF-RBD(BA2)-FC1 mRNA

[0068] (1) The three vectors were digested with Kpn1 enzyme for 2 h to obtain linear vectors. The linear vectors were recovered by agarose gel electrophoresis.

[0069] (2) Commercial in vitro reverse transcription kit T7 High Yield RNA Transcription Kit (N 1 The -Me-Pseudo UTP was purchased from Novizan. 1 μg of the linear plasmid was used for mRNA transcription according to the instructions. All uridine triphosphates in the sequence were replaced with pseudouridine triphosphates for modification.

[0070] (3) The commercially available capping kit Vaccinia Capping System and mRNA Cap 2'-O-Methyltransferase were purchased from Novizan. The cap1 modification was completed at the 5' end of the mRNA through two catalytic reactions according to the instructions.

[0071] (4) The size and integrity of the transcribed sequence were detected by agarose gel electrophoresis. The results showed that the obtained fusion protein mRNA band was single and there was no obvious degradation.

[0072] 3. Three types of mRNA loaded and modified with LNP

[0073] (1) Heptadecano-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((decoxy)hexyl)amino)octanoate), 1,2-distearate-sn-glycerol-3-phosphate choline, cholesterol and 1,2-dimyristic-rac-glycerol-3-methoxy polyethylene glycol were dissolved in ethanol and mixed in a ratio of 50:10:38.5:1.5 to prepare LNP.

[0074] (2) Mix LNP and fusion protein mRNA at a mass ratio of 40:1.

[0075] (3) The LNP particles loaded with fusion protein mRNA were obtained by dialysis and concentration with PBS solution.

[0076] (4) The particle size, uniformity and integrity of the particles were analyzed by a dynamic light scattering instrument.

[0077] 4. Mouse immunization

[0078] (1) Five-week-old female Balb / c mice were randomly divided into three groups: control group, 1 μg and 5 μg.

[0079] (2) The concentration of packaged mRNA LNP particles was determined. Mice in each group were immunized on day 0 and day 14 with PBS, 1 μg and 5 μg respectively. The vaccines were administered via intramuscular injection in the left and right hind limbs respectively.

[0080] (3) Serum, tissues and organs of mice in each group were collected at weeks 2, 6 and 15 after booster immunization to test the safety of humoral immunity, cellular immunity and vaccine immunization.

[0081] 5. Measurement of binding antibodies and neutralizing antibodies

[0082] Enzyme-linked immunosorbent assay (ELISA) plates were coated with commercially purified BA2 virus strain RBD protein, and the level of binding antibodies in mice was detected by ELISA. Results are as follows: Figure 2 As shown, compared to SP-RBD(BA2)-FC1 and IL15SA-RBD(BA2)-FC1, the GMCSF-RBD(BA2)-FC1 group induced the highest binding antibody levels at both low and high doses, exhibiting a clear dose-response relationship. Furthermore, 17 weeks after the initial immunization, the binding antibody level in the GMCSF-RBD(BA2)-FC1 5ug group remained at a very high level (serum dilution ratio greater than 1:2,000,000).

[0083] A commercially available pseudovirus kit for detecting SARS-CoV-2 RBD neutralizing antibodies was purchased from Novizan and used to detect the titer of neutralizing antibodies in serum. According to the instructions, 293 cells expressing ACE2 were infected with the pseudovirus, and the level of neutralizing antibodies produced in mice was detected using a fluorescence method. Results are as follows... Figure 3 As shown, among the three mRNAs designed for BA2, neutralization tests using BA2 pseudoviruses revealed that the GMCSF-RBD(BA2)-FC1 group still produced the highest levels of neutralizing antibodies, and even 17 weeks after the initial immunization, serum diluted 1:2000 still showed neutralizing activity. In contrast, the SP-RBD(BA2)-FC1 and IL15SA-RBD(BA2)-FC1 groups showed almost no neutralizing antibodies at 17 weeks. This data clearly demonstrates that different adjuvants have a significant impact on the immunization efficacy of mRNA vaccines.

[0084] On the other hand, neutralization tests were conducted using BA5 pseudoviruses on three mRNAs designed for BA2, and the results were as follows: Figure 4As shown, the GMCSF-RBD(BA2)-FC1 group produced the highest levels of neutralizing antibodies, and even 8 weeks after the initial immunization, the serum, diluted 1:4000, still exhibited neutralizing activity. In contrast, the SP-RBD(BA2)-FC1 and IL15SA-RBD(BA2)-FC1 groups showed almost no neutralizing antibodies at 8 weeks. This data clearly demonstrates that different adjuvants have a significant impact on the immunization efficacy of mRNA vaccines.

[0085] 6. T-cell immune response detection

[0086] (1) Two weeks after booster immunization, mice were dissected, and the spleen was obtained and isolated to obtain mouse spleen lymphocytes.

[0087] (2) According to 1×10 6 One cell / well was seeded in a 48-well plate, with one well for each sample. A polypeptide fragment of RBD BA2 protein (purchased from Genscript) was added to stimulate lymphocytes for 16 hours.

[0088] (3) Add a transport inhibitor and continue culturing for 5 hours.

[0089] (4) Cells were collected and intracellular and extracellular staining was performed using flow cytometry to detect the percentage of CD8+ T cells capable of secreting IFNγ. Results are as follows: Figure 5 As shown, peptide stimulation can significantly induce an immune response in T cells, leading to the secretion of corresponding stimulating factors.

[0090] (5) Six weeks after booster immunization, mice were dissected, and the spleen and isolated from the splenic lymphocytes were obtained.

[0091] (6) According to 1×10 6 One cell / well was seeded in a 48-well plate, with one well for each sample. A polypeptide fragment of RBD BA2 protein (purchased from Genscript) was added to stimulate lymphocytes for 16 hours.

[0092] (7) Collect 200 μL of supernatant for detection of IFN-γ secreted into the culture medium. The results are as follows: Figure 6 As shown, even 8 weeks after immunization, peptide stimulation can still significantly elicit an immune response in T cells, promoting their secretion of IFN-γ.

[0093] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. An mRNA molecule for preparing an mRNA vaccine, having a nucleotide sequence as shown in SEQ ID No. 3, the mRNA molecule encoding a GMCSF-antigen-FC1 fusion protein, an amino acid sequence of the GMCSF-antigen-FC1 fusion protein being shown in SEQ ID No. 1, comprising, in order from N-terminus to C-terminus, an amino acid sequence of GMCSF, an amino acid sequence of an antigen, and an amino acid sequence of FC1, wherein the antigen is an antigen from a virus; wherein the antigen is selected from an RBD antigen of a BA2 strain of a novel coronavirus, an amino acid sequence of the RBD antigen being shown in positions 160-463 of SEQ ID No. 1; the amino acid sequence of the GMCSF is shown in positions 1-144 of SEQ ID No. 1; the amino acid sequence of the FC1 is shown in positions 479-695 of SEQ ID No.

1.

2. The mRNA molecule of claim 1, which is unmodified or modified, the modification comprising: one or more of 5' end capping modification, pseudouridine triphosphate modification.

3. A fusion protein, an amino acid sequence of which is shown in SEQ ID No.

1.

4. A DNA molecule encoding the mRNA molecule of claim 1 or 2.

5. A recombinant plasmid containing the DNA molecule of claim 4.

6. A lipid nanoparticle loaded with the mRNA molecule of claim 1 or 2.

7. An mRNA vaccine comprising: the mRNA molecule of claim 1 or 2 or the lipid nanoparticle of claim 6.

Images