A METTL6 gene inhibitor and its application

Abstract

The present invention discloses a METTL6 gene inhibitor and its application, and relates to the field of molecular biology. The inhibitor is one of siRNA, shRNA or METTL6 gene interference lentivirus that inhibits the expression of the METTL6 gene; wherein the target sequence of the siRNA is as shown in SEQ ID NO.1 or SEQ ID NO.2; the shRNA nucleotide sequence sense chain is as shown in SEQ ID NO.3, and the antisense chain is as shown in SEQ ID NO.4; or the sense chain is as shown in SEQ ID NO.5, and the antisense chain is as shown in SEQ ID NO.6. The inhibitor of the present invention can effectively inhibit the expression of the METTL6 gene, has a high inhibitory efficiency on the cell proliferation, cell migration and invasion of cancer cells, and has a good prospect for drug development.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to a METTL6 gene inhibitor and application thereof. Background Art

[0002] Methyltransferase-like proteins (METTL) are a family of methyltransferases that use s-adenosylmethionine (SAM) as a substrate and transfer its methyl group to RNA, DNA or protein. It contains more than 30 methyltransferase proteins. Among them, METTL10, METTL11A / B, and METTL13 are protein methyltransferases, METTL4 and METTL9 are DNA methyltransferases, and METTL1, METTL2, METTL3, METTL6, METTL8, METTL14, and METTL16 are RNA methyltransferases.

[0003] Abnormal methylation has been shown to be closely related to a variety of diseases, including cancer. The complex composed of METTL3 and METTL14, which catalyzes the formation of N6-methyladenosine (m6A) in mRNA and noncoding RNA, can promote oncogene expression and cancer cell growth in leukemia. METTL1, which catalyzes the formation of 7-methylguanosine (m7G) in mRNA and tRNA, is upregulated and associated with poor prognosis in hepatocellular carcinoma (HCC). METTL13 regulates the translation process by catalyzing the methylation of eukaryotic elongation factor 1, promoting the progression of lung and pancreatic cancer. METTL6, as a methyltransferase that catalyzes the formation of 3-methylcytidine (m3C) in tRNA, has been less studied in relation to cancer. Summary of the invention

[0004] In order to overcome the deficiencies of the prior art, one of the objects of the present invention is to provide a METTL6 gene inhibitor that can effectively inhibit the expression of the METTL6 gene and has a high inhibitory efficiency on cell proliferation, cell migration and invasion of cancer cells.

[0005] The second purpose of the present invention is to provide the application of METTL6 gene inhibitor.

[0006] One of the purposes of the present invention is achieved by the following technical solution:

[0007] A METTL6 gene inhibitor, wherein the inhibitor is one of siRNA, shRNA or METTL6 gene interfering lentivirus that inhibits the expression of the METTL6 gene.

[0008] Furthermore, the target sequence of the siRNA is shown as SEQ ID NO.1 or SEQ ID NO.2.

[0009] Furthermore, the sense strand of the shRNA nucleotide sequence is shown in SEQ ID NO.3, and the antisense strand is shown in SEQ ID NO.4; or the sense strand is shown in SEQ ID NO.5, and the antisense strand is shown in SEQ ID NO.6.

[0010] Furthermore, the method for preparing the METTL6 gene interference lentivirus is as follows: the sense chain and the antisense chain of the shRNA nucleotide sequence are annealed to obtain double-stranded sticky end DNA, the double-stranded sticky end DNA is connected to the pLKO.1 vector to form a gene interference recombinant plasmid, and the virus is packaged with the assistance of the lentiviral helper plasmid and the host cell.

[0011] Furthermore, the lentiviral packaging helper plasmids are psPAX2 plasmid and pMD2.G plasmid.

[0012] Furthermore, the host cell is a HEK-293T cell.

[0013] The second object of the present invention is achieved by adopting the following technical solution:

[0014] An application of a METTL6 gene inhibitor, wherein the application is the application of the METTL6 gene inhibitor in the preparation of an anti-tumor drug.

[0015] Furthermore, the tumor is one of breast cancer, renal cancer, glioma, and melanoma.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention provides a METTL6 gene inhibitor, which is one of siRNA, shRNA or METTL6 gene interference lentivirus that inhibits the expression of the METTL6 gene; wherein the target sequence of the siRNA is as shown in SEQ ID NO.1 or SEQ ID NO.2; the shRNA nucleotide sequence sense strand is as shown in SEQ ID NO.3, and the antisense strand is as shown in SEQ ID NO.4; or the sense strand is as shown in SEQ ID NO.5, and the antisense strand is as shown in SEQ ID NO.6. The inhibitor of the present invention can effectively inhibit the expression of the METTL6 gene, has a high inhibitory efficiency on the cell proliferation, cell migration and invasion of cancer cells, and has a good prospect for drug development. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1The RT-PCR method was used to detect the expression level of the METTL6 gene in cancer cells infected with the lentivirus of Example 1;

[0019] Figure 2 The Western-blot method is used to detect the content of METTL6 protein in cancer cells after infection with the lentivirus of Example 1;

[0020] Figure 3 is the proliferation capacity of cancer cells after being infected with the lentivirus of Example 1;

[0021] Figure 4 is the colony-forming ability of cancer cells after being infected with the lentivirus of Example 1;

[0022] Figure 5 is the migration ability of cancer cells after being infected with the lentivirus of Example 1;

[0023] Figure 6 The invasive ability of cancer cells after being infected with the lentivirus of Example 1. DETAILED DESCRIPTION

[0024] The technical scheme of the present invention is further described below in conjunction with specific embodiments. However, it should be understood by those skilled in the art that the following examples are only used to illustrate the present invention and should not be regarded as limiting the present invention. The specific conditions not specified in the examples are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used, unless otherwise specified, are conventional products obtained through commercial channels.

[0025] Example 1

[0026] Construction of METTL6-shRNA lentivirus:

[0027] 1) shRNA sequence design:

[0028] Enter the NCBI accession number of METTL6 (Gene ID: 131965) or paste the nucleic acid sequence in the online shRNA design software provided by Thermo Fisher Life Technologies to design the small interfering RNA (siRNA) sequence corresponding to METTL6:

[0029] siRNA-1: GCGTGGATTCATATTATTTGG (SEQ ID NO.1)

[0030] siRNA-2: GGTTTAAAGCCAGCAGCAAAC (SEQ ID NO.2)

[0031] According to the order of restriction enzyme I recognition sequence + siRNA forward sequence + CTCGAG loop + siRNA reverse complementary sequence + polyT + restriction enzyme II recognition sequence, the small hairpin RNA (shRNA) sequence used for this silencing was designed, as shown in Table 1:

[0032] Table 1 Sequences of shRNA oligonucleotides of METTL6 gene

[0033]

[0034] 2) shRNA vector construction:

[0035] The sense strand and antisense strand of METTL6-shRNA-1 and METTL6-shRNA-2 (synthesized by Shanghai Shenggong Bioengineering Co., Ltd.) were dissolved in ddH2O to prepare a solution with a concentration of 10μM. The system was placed in a 100℃ environment for 4 minutes and then cooled naturally to allow the forward and reverse interference sequences to anneal to form double-stranded sticky-end DNA. The pLKO.1 vector (purchased from Addgene, catalog number 8453) was digested with AgeI and EcoRI, and a fragment of 7000bp was recovered after agarose gel electrophoresis. The recovered vector fragment was connected with the shRNA annealing product at 16℃ overnight, transferred into the prepared Escherichia coli competent cells, and the positive clone single colony was selected for sequencing identification. The results showed that the inserted fragment sequence in the recombinant vector was completely consistent with the SEQ ID NO.3~6 sequence, proving that the recombinant lentiviral vector was successfully constructed and named METTL6-shRNA-1 and METTL6-shRNA-2 plasmids.

[0036] 3) Lentiviral packaging:

[0037] HEK-293T cells were seeded in 6-well culture plates at a density of 7×105 cells / well and incubated overnight at 37°C and 5% CO2. METTL6-shRNA-1 and METTL6-shRNA-2 plasmids were mixed with psPAX2 auxiliary plasmid (purchased from Addgene, catalog number 12260) and pMD2.G auxiliary plasmid (purchased from Addgene, catalog number 12259) at a molar ratio of 1:1:1, and plasmid transfection was performed using Lipofectamine3000 (purchased from Thermofisher, catalog number L3000015, see product manual for usage), and the culture plates were incubated at 37°C and 5% CO2 for 6 hours. A blank pLKO.1 plasmid was packaged in the same way as a blank control. After 6 hours, it was replaced with DMEM complete medium containing 10% fetal bovine serum (purchased from Thermofisher, catalog number 12491015) and continued to be cultured. After 48 hours, the cell supernatant was sampled and added to a lentivirus rapid test card (purchased from Shanghai Jichun Industrial Co., Ltd., brand gelatins, item number JC-A78362), indicating that the METTL6-shRNA-1, METTL6-shRNA-2 plasmids, and blank control plasmid were successfully packaged by the lentivirus.

[0038] The remaining cell supernatant was centrifuged at 2000 rpm at room temperature and filtered through a 0.45 μm filter to obtain METTL6-shRNA-1, METTL6-shRNA-2 recombinant lentivirus and blank control lentivirus suspensions, which were stored in a -80°C refrigerator for later use.

[0039] Example 2

[0040] Recombinant lentivirus infected cells:

[0041] Human breast cancer cells BT-549, renal cell adenocarcinoma cells 769-P, glioma cells U251, and melanoma cells SK-MEL-1 (all purchased from Wuhan Punosai Life Science Technology Co., Ltd., introduced from ATCC) were seeded in 24-well plates at a density of 2×104 cells / well, each well containing 500 μL of DMEM medium with 10% fetal bovine serum, and incubated overnight at 37°C and 5% CO2. The METTL6-shRNA-1, METTL6-shRNA-2 recombinant lentivirus, and blank control lentivirus prepared in Example 1 were mixed with DMEM complete medium at a volume ratio of 1:1 to prepare a mixed medium, and the infection reagent polybrene (purchased from MCE China, CAS No. 28728-55-4) was added and cultured for 24 hours, and then replaced with fresh DMEM medium containing 10% fetal bovine serum, and cultured for 72 hours.

[0042] Test Example 1

[0043] Silencing effect of shRNA on METTL6 gene:

[0044] 1) Effect of interference plasmid on silencing of METTL6 (mRNA level)

[0045] BT-549, 769-P, U251, and SK-MEL-1 cells infected with the three lentiviruses in Example 2 for 72 hours were collected respectively, and RNA was extracted using a total RNA extraction kit (Beijing Solebow Technology Co., Ltd., item number R1200, see product instructions for use) and reverse transcribed to synthesize cDNA using a reverse transcription kit (purchased from Takara, item number RR037A, see product instructions for use). Real-Time PCR was performed to detect the expression level of the METTL6 gene, and the quantitative primers were as follows:

[0046] F:CAGGCAAGGATTCTCACCTCT (SEQ ID NO.7)

[0047] R:TGGTCCAGTGTCTGTCTTTGA (SEQ ID NO.8)

[0048] Real-Time PCR The relative expression analysis was performed by Figure 1 The results showed that the expression levels of METTL6 gene in BT-549, 769-P, U251, and SK-MEL-1 cells infected with METTL6-shRNA-1 and METTL6-shRNA-2 lentivirus were significantly reduced (P<0.001), confirming that METTL6-shRNA-1 and METTL6-shRNA-2 recombinant lentivirus infection can inhibit METTL6 gene expression.

[0049] 2) Effect of interference plasmid on METTL6 silencing (protein level)

[0050] After 72 hours of infection with the three lentiviruses in Example 2, the BT-549, 769-P, U251, and SK-MEL-1 cells were dried with the remaining culture medium, and the lysis solution was added and placed on ice for 1 hour. The cells were blown once every 20 minutes to fully lyse them, and the supernatant was taken by centrifugation. The protein concentration was determined by the BCA method, the loading volume was calculated, and the SDS-PAGE loading buffer was added to make the total volume of each sample consistent, and the cells were placed in 100°C hot water for denaturation for 10 minutes. Two portions of 30 μL of the above cell lysate were taken, respectively, and loaded onto 10% SDS-PAGE, and electrophoresis was completed at 120V for 90 minutes.

[0051] The electrotransfer sandwich structure was prepared in the order of black porous plastic clip, sponge, filter paper, separation gel, PVDF membrane, filter paper, sponge, and white porous plastic clip, and the protein in SDS-PAGE was transferred to the PVDF membrane in the electrotransfer buffer. The PVDF membrane was taken out, protein side down, blocked in 5% skim milk powder blocking solution at 4°C overnight, and the membrane was washed 3 times with TBST. The blocked PVDF membrane was cut into two parts, and 10mL mouse anti-human METTL6 antibody (purchased from Abcam, catalog number ab243710, 1:5000 dilution) and 10mL GAPDH antibody (purchased from Abcam, catalog number ab263962, 1:5000 dilution) were placed in each part, and incubated at 4°C overnight on a gently shaking shaker. The PVDF membrane was washed with TBST 4 times, 5 minutes each time, and then 10 mL of horseradish peroxidase-labeled goat anti-mouse IgG secondary antibody (purchased from Abcam, catalog number ab6708, 1:5000 dilution) was added and incubated at room temperature for 50 minutes. The PVDF membrane was washed with TBST 4 times, 5 minutes each time. ECL ultrasensitive colorimetric solution was added and the images were taken with the Tianneng imaging system of Shanghai Tianneng Technology Co., Ltd. The results are shown in Figure 2 .

[0052] The results showed that the content of METTL6 protein in BT-549, 769-P, U251, and SK-MEL-1 cells infected with human METTL6-shRNA-1 and METTL6-shRNA-2 lentiviruses was significantly reduced, indicating that METTL6-shRNA-1 and METTL6-shRNA-2 recombinant lentivirus infection has the effect of inhibiting METTL6 gene expression.

[0053] Test Example 2

[0054] Effects of silencing the METTL6 gene on cancer cell proliferation:

[0055] BT-549, 769-P, U251, and SK-MEL-1 cells infected with the METTL6-shRNA-1, METTL6-shRNA-2 recombinant lentivirus, and blank control lentivirus in Example 2 were inoculated in 96-well plates, respectively, with about 2,000 cells in each well. 200 μL of culture medium containing 10% fetal bovine serum was added, and the edge holes were filled with sterile PBS and placed in a 37°C incubator. 10 μL / well CCK-8 solution was added after 12 h, 24 h, and 48 h, respectively (CCK-8 was added to the culture medium without cells to adjust to zero), and the cells were incubated in the incubator for 2 h. The absorbance at 450 nm was recorded, and the ratio of the OD values ​​of the recombinant lentivirus-infected cells and the blank control lentivirus-infected cells was used to represent the cell proliferation ability. One-way analysis of variance was used to investigate the effect of METTL6 gene silencing on cell proliferation. The results are shown in Figure 3, indicating that METTL6-shRNA-1 and METTL6-shRNA-2 recombinant lentivirus infection can significantly inhibit the proliferation ability of cancer cells.

[0056] Test Example 3

[0057] Effect of silencing the METTL6 gene on the colony-forming ability of cancer cells:

[0058] BT-549, 769-P, U251, and SK-MEL-1 cells infected with the METTL6-shRNA-1, METTL6-shRNA-2 recombinant lentivirus, and blank control lentivirus in Example 2 were cultured to the logarithmic phase, digested into single cell suspensions, and 100 cells from each group were inoculated into a 12-well plate containing 1 mL of complete culture medium with 10% fetal bovine serum, placed in a 37°C, 5% CO2 incubator, and cultured for 2 weeks. After the culture, the culture medium was discarded and each well was washed 2-3 times with PBS. Add 1 mL / well of methanol to fix for 15 minutes at room temperature, and wash twice with PBS after fixation. Discard the methanol and add Giemsa staining for 15 minutes. Wash off the staining solution and let it stand to dry. Take pictures under a microscope and count the number of clones greater than 10 cells. The results are as follows Figure 4 As shown, it was shown that METTL6-shRNA-1 and METTL6-shRNA-2 recombinant lentivirus infection could significantly inhibit the colony-forming ability of cancer cells (P<0.001).

[0059] Test Example 4

[0060] Effects of silencing the METTL6 gene on the migration and invasion ability of cancer cells:

[0061] 1) Transwell migration assay

[0062] After the BT-549, 769-P, U251, and SK-MEL-1 cells infected with the METTL6-shRNA-1, METTL6-shRNA-2 recombinant lentivirus, and blank control lentivirus in Example 2 were serum starved for 12 hours, digested into single cell suspensions, and resuspended in serum-free culture medium containing 0.1% BSA to 2×105 cells / mL. 200ul of the cell suspension was inoculated into the upper chamber of the Transwell chamber, and 600μL of complete culture medium containing 10% FBS was added to the lower chamber of the 24-well culture plate. The Transwell chamber was placed in a 24-well plate. Cultured in a 37°C CO2 incubator for 48 hours, the chamber was removed, rinsed with PBS twice, and the cells in the upper layer of the microporous membrane of the chamber were wiped off with a cotton swab. The cells were fixed with 4% paraformaldehyde for 20 minutes, stained with 0.1% crystal violet stain for 15 minutes, and air-dried. Five fields of view were randomly selected from each group under an inverted microscope, photographed, and statistically analyzed. Transwell in vitro migration assay as shown in Figure 5 As shown, the migration ability of cells infected with METTL6-shRNA-1 and METTL6-shRNA-2 recombinant lentivirus was significantly decreased, and the difference was statistically significant (P<0.001).

[0063] 2) Transwell invasion assay

[0064] After serum starvation for 12 hours, the BT-549, 769-P, U251, and SK-MEL-1 cells infected with the METTL6-shRNA-1, METTL6-shRNA-2 recombinant lentivirus, and blank control lentivirus in Example 2 were digested into a single cell suspension and resuspended in a serum-free culture medium containing 0.1% BSA to 2×105 cells / mL. Matrigel matrix gel (purchased from Beijing Solebow Technology Co., Ltd., item number 356234) was diluted to 5 mg / mL with pre-cooled serum-free 1640 culture medium, added vertically to the Transwell chamber, evenly spread on the bottom, and incubated at 37°C for 2 hours. 600 μL of complete culture medium containing 10% FBS was added to the lower chamber of the 24-well culture plate, the Transwell chamber was placed in a 24-well plate, and 200 μL of cell suspension was added. The cells were placed in a CO2 incubator at 37°C for 60 hours, and the chambers were removed and rinsed twice with PBS. The cells on the upper layer of the microporous membrane of the chambers were wiped off with a cotton swab, fixed with 4% paraformaldehyde for 20 minutes, stained with 0.1% crystal violet stain for 15 minutes, and air-dried. Five fields of view were randomly selected from each group under an inverted microscope, photographed, and statistically analyzed. Figure 6 As shown in the figure, the invasion ability of cells infected with METTL6-shRNA-1 and METTL6-shRNA-2 recombinant lentivirus was significantly decreased, and the difference was statistically significant (P<0.001).

[0065] The above-mentioned embodiments are only preferred embodiments of the present invention and cannot be used to limit the scope of protection of the present invention. Any non-substantial changes and substitutions made by technicians in this field on the basis of the present invention shall fall within the scope of protection required by the present invention.

Claims

1. A METTL6 gene inhibitor, characterized in that: The inhibitor is siRNA or shRNA that inhibits the expression of METTL6 gene; The target sequence of the siRNA is shown in SEQ ID NO.2; the positive strand of the shRNA nucleotide sequence is shown in SEQ ID NO.5, and the antisense strand is shown in SEQ ID NO.

6.

2. A METTL6 gene inhibitor, characterized in that: The inhibitor is a METTL6 gene interference lentivirus, wherein the preparation method of the METTL6 gene interference lentivirus is: the sense chain and the antisense chain of the shRNA nucleotide sequence according to claim 1 are annealed to obtain double-stranded sticky end DNA, the double-stranded sticky end DNA is connected to the pLKO.1 vector to form a gene interference recombinant plasmid, and the virus is packaged with the assistance of a lentiviral helper plasmid and a host cell.

3. The METTL6 gene inhibitor according to claim 2, characterized in that: The lentiviral helper plasmids are psPAX2 plasmid and pMD2.G plasmid.

4. The METTL6 gene inhibitor according to claim 2, characterized in that: The host cell is HEK-293T cell.

5. The use of the METTL6 gene inhibitor according to any one of claims 1 to 4, characterized in that: The METTL6 gene inhibitor is used in the preparation of drugs for treating breast cancer, kidney cancer, glioma and melanoma.

Images