Animal model of conditional overexpression of Toll-like receptor 5 gene

Abstract

The present invention relates to a Toll-like receptor 5 gene conditional overexpression animal model. Specifically, the present invention provides a method for preparing a non-human model animal with conditional overexpression of the TLR5 gene, wherein Cas9mRNA and gRNA are obtained by in vitro transcription; a homologous recombination vector (donor vector) is constructed, wherein the vector comprises a 5' homology arm, a TLR5 gene expression cassette and a 3' homology arm, wherein the TLR5 gene expression cassette is a silent expression cassette, and under induction conditions, the silent expression cassette is converted into an activated TLR5 gene expression cassette. Cas9mRNA, gRNA and the homologous recombination vector are injected into a fertilized egg in vitro to obtain an injected fertilized egg. The injected fertilized egg is regenerated into a TLR5 gene conditional overexpression animal model. The animal model of the present invention has broad application prospects in antiviral, antibacterial immunity, antitumor immunity, diagnosis and treatment of inflammatory bowel disease, etc.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular relates to a Toll-like receptor 5 gene conditional overexpression animal model. Background Art

[0002] Toll-like receptors (TLRs) are type I transmembrane proteins that recognize invading microorganisms and activate immune cell responses, playing a key role in the innate immune system. Toll-like receptor 5 (TLR5), a member of the Toll-like receptor family, is prominently expressed in many immune cells, such as monocytes and macrophages, and tissue cells, such as intestinal epithelial cells. Current research has found that flagellin is the sole ligand for TLR5. Recent studies have linked TLR5 to the pathogenicity and host immunity of various infectious, autoimmune, and metabolic diseases in humans.

[0003] TLR5-deficient mice are currently a key tool in TLR5 research. However, many researchers also utilize mice that overexpress TLRs in other Toll-like receptor studies. For example, studies have found that TLR4-overexpressing mice are more susceptible to developing sporadic colon cancer after exposure to carcinogens than wild-type mice. However, there are currently no reports of TLR5-overexpressing mice, as this prevents researchers from conducting studies involving TLR5 and Salmonella enteritidis.

[0004] Therefore, there is an urgent need in this field to construct TLR5 conditional gene overexpression mice, so as to provide a new experimental tool for studying TLR5 function. Moreover, due to the wide range of functions of TLR5 receptors, TLR5 conditional gene overexpression mice may have application prospects in antiviral immunity, antibacterial immunity, antitumor immunity, diagnosis and treatment of inflammatory bowel disease, etc. Summary of the Invention

[0005] The purpose of the present invention is to provide a Toll-like receptor 5 gene conditional overexpression mouse.

[0006] Another object of the present invention is to provide a TLR5 conditionally overexpressed mouse for use in the research of antiviral, antibacterial immunity, antitumor immunity, and diagnosis and treatment of inflammatory bowel disease.

[0007] In a first aspect of the present invention, a method for preparing a non-human model animal with conditional overexpression of the TLR5 gene is provided, comprising the steps of:

[0008] (a) Obtain Cas9 mRNA and gRNA by in vitro transcription;

[0009] (b) constructing a homologous recombination vector (donor vector), wherein the vector comprises a 5' homology arm, a TLR5 gene expression cassette, and a 3' homology arm; wherein the TLR5 gene expression cassette is a silent expression cassette, and under induction conditions, the silent expression cassette is converted into an activated TLR5 gene expression cassette;

[0010] (c) injecting Cas9 mRNA, gRNA and the homologous recombination vector into a fertilized egg in vitro to obtain an injected fertilized egg;

[0011] (d) The injected fertilized eggs were regenerated into non-human model animals with conditional overexpression of the TLR5 gene.

[0012] In another preferred embodiment, the model animals include F0 and F1 generation silent TLR5 gene conditionally overexpressed non-human model animals.

[0013] In another preferred embodiment, step (d) further comprises: hybridizing a silent TLR5 gene conditionally overexpressed non-human model animal with a conditionally inducible animal to form an activated TLR5 gene conditionally overexpressed non-human model animal.

[0014] In another preferred embodiment, the conditionally induced animal is a Cre animal.

[0015] In another preferred embodiment, the Cre animal is a Dppa3-Cre animal.

[0016] In another preferred embodiment, the sequence of the gRNA is shown in SEQ ID NO:8.

[0017] In another preferred embodiment, the homologous recombination vector is constructed by In-Fusion cloning.

[0018] In another preferred embodiment, the silent TLR5 gene expression cassette has a structure from 5' to 3' as shown in formula (I):

[0019] Z0-Z1-Z2a-Z3-Z2b-Z4-Z5-Z6(I)

[0020] Where,

[0021] Z0 is none or 5′ homology arm;

[0022] Z1 is the promoter;

[0023] Z2a and Z2b are loxp elements;

[0024] Z3 is the stop codon;

[0025] Z4 is the Kozak sequence;

[0026] Z5 is the TLR5 coding sequence;

[0027] Z6 is none or a 3' homology arm.

[0028] In another preferred embodiment, the activated TLR5 gene expression cassette has a structure from 5' to 3' as shown in formula (II):

[0029] Z0-Z1-Z2-Z4-Z5-Z6(II)

[0030] Where,

[0031] Z0, Z1, Z4, Z5, and Z6 are as defined above;

[0032] Z2 is the loxP element after recombination of Z2a and Z2b.

[0033] In another preferred embodiment, the method further comprises: performing genotyping on the F0 generation silent animals.

[0034] In another preferred embodiment, the genotype identification includes performing PCR identification on the 5' homology arm and 3' homology arm genotypes of the F0 generation silent animals.

[0035] In another preferred embodiment, the primers for PCR identification of the 5' homology arm genotype of the F0 generation animal are shown as SEQ ID NOs: 9 and 10, and the primers for PCR identification of the 3' homology arm genotype of the F0 generation animal are shown as SEQ ID NOs: 11 and 12.

[0036] In another preferred embodiment, the method further comprises: performing genotyping on the F1 generation silent animals.

[0037] In another preferred embodiment, the genotype identification includes performing PCR identification on the 5' and 3' homology arm genotypes of the F1 generation silent animals.

[0038] In another preferred embodiment, the method further comprises: performing genotyping on the activated TLR5 gene conditionally overexpressed model animal.

[0039] In another preferred embodiment, the genotype identification primers are shown as SEQ ID NOs: 13 to 16.

[0040] In another preferred embodiment, the animals include rodents.

[0041] In another preferred embodiment, the rodent includes mice or rats.

[0042] In a second aspect of the present invention, a gene editing reagent is provided, comprising:

[0043] (i) a first reagent, wherein the first reagent is a gRNA having a sequence as shown in SEQ ID NO: 8, or a precursor of the gRNA, or a vector containing the gRNA coding sequence;

[0044] (ii) a second reagent, wherein the second reagent is a CRISPR / Cas9 gene editing enzyme or an expression cassette thereof, or a vector for expressing the gene editing enzyme.

[0045] In another preferred embodiment, the reagent further comprises:

[0046] (iii) a third reagent, wherein the third reagent is a TLR5 gene expression cassette, or a vector containing the expression cassette.

[0047] In another preferred embodiment, the reagent further comprises:

[0048] (iv) a fourth reagent, wherein the fourth reagent is a primer for identifying the genotype of the 3' homology arm of the F0 generation animal as shown in SEQ ID NOs: 9 and 10, and a primer for identifying the genotype of the 3' homology arm of the F0 generation animal as shown in SEQ ID NOs: 11 and 12;

[0049] (v) A fifth reagent, which is a primer for identifying the genotype of an animal model with conditional overexpression of the activated TLR5 gene, whose sequences are shown in SEQ ID NOs: 13 to 16.

[0050] In the third aspect of the present invention, a use of the gene editing reagent described in the second aspect of the present invention is provided for preparing the TLR5 gene conditional overexpression animal model described in the first aspect of the present invention.

[0051] In another preferred embodiment, the animal model is a non-human mammal, preferably a rodent, more preferably a mouse or a rat.

[0052] In another preferred embodiment, the gene editing reagent is introduced into cells by expressing the vector.

[0053] In another preferred embodiment, the expression vector is a viral vector or a mammalian cell vector.

[0054] In a fourth aspect of the present invention, a use of a model animal is provided, wherein the model animal is prepared using the method described in the first aspect of the present invention, wherein the model animal is used for:

[0055] (iii) screening candidate drugs or therapeutic agents for treating infectious diseases, tumor-related diseases and metabolic diseases; and / or

[0056] (iv) Evaluate the efficacy of candidate drugs or therapeutic agents for infectious diseases, autoimmune diseases, and metabolic diseases.

[0057] In another preferred embodiment, the infectious diseases include: cytomegalovirus (CMV), influenza virus (H1N1), rotavirus (RV) infection, human papillomavirus (HPV) infection, Salmonella infection, Pseudomonas aeruginosa infection, and Clostridium difficile infection.

[0058] In another preferred embodiment, the tumor-related diseases include: gastric cancer, breast cancer, colorectal cancer, cervical cancer, non-small cell lung cancer, and non-Hodgkin's lymphoma.

[0059] In another preferred embodiment, the metabolic diseases include: rheumatoid arthritis, rheumatic heart disease, rheumatoid arthritis, ulcerative colitis, and Crohn's disease.

[0060] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 A schematic diagram of the mouse construction strategy is shown.

[0062] Figure 2 The plasmid map of the homologous recombination vector is shown.

[0063] Figure 3 The electrophoresis diagram of homologous recombination vector enzyme digestion identification is shown, where B is the result of BglII enzyme digestion identification, with theoretical band sizes of 7976 bp, 5475 bp, 3236 bp, 1657 bp, 825 bp, and 474 bp; M is a 1 kb DNA ladder.

[0064] Figure 4 A schematic diagram of the F0 generation mouse identification strategy is shown.

[0065] Figure 5 The electrophoresis diagram of PCR identification of homologous recombination-positive F0 generation mice is shown, where the numbers are the F0 generation mouse numbers; M is a 1 kb DNA marker.

[0066] Figure 6 The electrophoresis diagram of PCR identification of the 5' homology arm (left side of the marker) and 3' homology arm (right side of the marker) of F1 generation mice is shown (number: F1 generation mouse number; M: 1 kb DNA ladder).

[0067] Figure 7The results of PCR identification and sequencing of the 5' homology arm of F1 mice are shown.

[0068] Figure 8 The results of PCR identification and sequencing of the 3' homology arm of F1 mice are shown.

[0069] Figure 9 The electropherogram of PCR identification of R26-(CAG-LSL-Kozak-Tlr5-3XFlag) mouse is shown.

[0070] Figure 10 Shown is the electropherogram of PCR identification of Dppa3-Cre mice.

[0071] Figure 11 Shown are the differences in serum TNF-α and IL-6 concentrations between TLR5-overexpressing mice and wild-type mice after intraperitoneal injection of flagellin.

[0072] Figure 12 Shown are the survival curves of TLR5-overexpressing mice and wild-type mice after infection with Salmonella.

[0073] Figure 13 Shown are fecal colony counts of TLR5-overexpressing and wild-type mice on the fifth day after Salmonella infection. DETAILED DESCRIPTION

[0074] After extensive and in-depth research and extensive screening, the inventors have developed the first immune-enhancing animal model and its construction method. This invention designs a specific silent TLR5 gene expression cassette that, under induction conditions, is converted into an activated TLR5 gene expression cassette. This TLR5 gene expression cassette is then infected into a specific non-human animal via an optimized vector, thereby creating a non-human animal model with conditional overexpression of the TLR5 gene. This animal model of conditional overexpression of the TLR5 gene demonstrates that overexpression of the TLR5 receptor has an immunoprotective effect, stimulating an inflammatory response in the host and promoting the release of pro-inflammatory factors.

[0075] Specifically, the inventors inserted the CAG-LSL-Kozak-Tlr5-3XFlag expression cassette into the Rosa26 gene locus by homologous recombination. The brief process is as follows: Cas9 mRNA and gRNA are obtained by in vitro transcription; a homologous recombination vector (donor vector) is constructed, which contains a 5' homology arm, a TLR5 gene expression cassette and a 3' homology arm. Cas9 mRNA, gRNA and donor vector are microinjected into fertilized eggs of C57BL / 6J mice to obtain F0 generation mice. F0 generation mice that are positive for PCR amplification and sequencing identification are mated with C57BL / 6J mice to obtain positive F1 generation mice. The F1 generation mice are mated with conditionally inducible Cre- mice to obtain TLR5 receptor overexpression animals. The present invention was completed on this basis.

[0076] the term

[0077] In order to more easily understand the present disclosure, some terms are first defined. As used in this application, unless otherwise expressly provided herein, each of the following terms should have the meaning given below. Other definitions are set forth throughout the application.

[0078] As used herein, the terms "comprising" or "including" may be open, semi-closed, or closed. In other words, the terms also include "consisting essentially of" or "consisting of."

[0079] Toll-like receptors

[0080] Toll-like receptors (TLRs) are type I transmembrane proteins that recognize invading microorganisms and activate immune cell responses, playing a key role in the innate immune system. Toll-like receptor 5 (TLR5) is a member of the Toll-like receptor family.

[0081] The nucleotide sequence of TLR5 is shown in SEQ ID NO:4.

[0082] Rosa26 gene

[0083] The Rosa26 gene, also known as Gt(ROSA)26S or (ENSMUSG00000086429), is located on chromosome 6:113,076,031 and is a long non-coding RNA (lncRNA). Rosa gene Ensembl website link: http: / / asia.ensembl.org / Mus_musculus / Gene / Summary?db=core;g=ENSMUSG00000086429;r=6:113067428-113077333.

[0084] Dppa3-Cre

[0085] Dppa3 is a maternal-effect gene specifically expressed in primordial germ cells, oocytes, preimplantation embryos, and ES cells, and plays a crucial role in early embryonic development. Dppa3-Cre, also known as Stella-Cre, involves inserting an IRES-Cre expression cassette into the 3'UTR region of the Dppa3 gene. The Dppa3 gene is expressed in early germ cells and during embryonic development. Dppa3-Cre effectively activates Cre recombinase activity in early embryos and germ cells and is commonly used to generate systemic overexpression / knockout mice.

[0086] TLR5 gene conditional overexpression animal model

[0087] The present invention provides a TLR5 gene conditional overexpression animal model.

[0088] As used herein, the terms "animal model of the present invention", "TLR5 gene conditional overexpression animal model of the present invention", "conditional overexpression animal model", "conditional overexpression animal model of the present invention", etc. are used interchangeably and all refer to animal models after the animal TLR5 gene is site-specifically inserted using gene editing technology.

[0089] Animal models of human disease refer to animals that have simulated manifestations of human disease and are established in various medical scientific research. They are classified into spontaneous animal models and induced or experimental animal models according to the causes of their occurrence.

[0090] Spontaneous animal models refer to diseases that occur naturally in experimental animals without any conscious manipulation. These include models of genetic diseases in mutant strains and tumors in inbred strains. The greatest advantage of using these animal disease models to study human diseases is that the onset and progression of the diseases closely resemble those of human counterparts, and since they occur under naturally occurring conditions, they have greater application value. However, these models can be difficult to obtain.

[0091] The present invention provides a TLR5 gene conditional overexpression model animal, and the model is as described in the first aspect of the invention.

[0092] CRISPR / Cas9 base editing

[0093] CRISPR / Cas9 is an adaptive immune defense developed by bacteria and archaea over a long period of evolution to combat invading viruses and foreign DNA. The CRISPR / Cas9 system provides immunity by integrating fragments of invading phage and plasmid DNA into CRISPR and using corresponding CRISPR RNAs (such as guide RNAs) to guide the degradation of homologous sequences.

[0094] The system works by combining crRNA (CRISPR-derived RNA) with tracrRNA (trans-activating RNA) through base pairing to form a tracrRNA / crRNA complex. This complex guides the nuclease Cas9 protein to cleave double-stranded DNA at the target sequence site paired with the crRNA. By artificially designing these two RNAs, a gRNA (single-guide RNA) can be engineered to guide Cas9 to specific DNA cuts.

[0095] As an RNA-guided, double-stranded DNA-binding protein, the Cas9 effector nuclease is the first known unifying factor, capable of colocalizing RNA, DNA, and proteins. By fusing the protein to a nuclease-free Cas9 (Cas9nuclease-null) and expressing an appropriate guide RNA (gRNA), any double-stranded DNA sequence can be targeted. The gRNA's end can be ligated to the target DNA without interfering with Cas9 binding. Consequently, Cas9 can introduce any fusion protein or RNA at any double-stranded DNA sequence. This technology is known as the CRISPR / Cas9 gene editing system.

[0096] The CRISPR / Cas9 technology vector design is relatively simple. Gene editing requires a 20-30bp guide RNA (sgRNA) to bind to the target sequence, recruit the Cas9 protein, and cleave genomic DNA. Cas9 cleaves genomic DNA, creating gaps. The resulting double-strand breaks trigger DNA repair mechanisms within the cell to maintain normal cell survival. The most common DNA repair mechanisms are homologous recombination repair (HDR) and non-homologous end joining (NHEJ). The latter is a non-fidelity repair method that can lead to incorrect repair of genomic DNA and even frameshift mutations, achieving the purpose of gene knockout.

[0097] The gene knock-in and gene knockout based on the CRISPR / Cas9 system of the present invention are composed of two parts. The first part is that the CRISPR / Cas9 system cuts at a determined target site to produce a double-strand break gap. In this process, the cutting efficiency of the CRISPR / Cas9 system has a huge impact on gene knock-in, and the type of double-strand break left after cutting is also extremely important. The second part is that the cell initiates a repair mechanism, using exogenous donor DNA as a homologous template, and performing homologous repair to insert the TLR5 expression cassette on the donor DNA into the target site gap to complete the gene knock-in process.

[0098] Animal models

[0099] The present invention provides a non-human mammalian model of conditional overexpression of the TLR5 gene.

[0100] In the present invention, examples of non-human mammals include, but are not limited to, rodents, more preferably mice or rats.

[0101] Taking an animal model as an example, it can be prepared according to the method described in the first aspect of the present invention.

[0102] Preferably, in the present invention, the TLR5 gene is site-specifically inserted using CRISPR-CAS9 or other technologies.

[0103] In a specific embodiment of the present invention, a construct containing an exogenous insert can be constructed, which contains a TLR5 gene expression cassette and homologous arms on both sides of the target gene (Rosa26) insertion site, so that the exogenous insert (or gene) can be inserted into the Rosa26 site (especially the exon region) at a high frequency through homologous recombination, thereby leading to TLR5 overexpression.

[0104] Candidate drugs or therapeutic agents

[0105] The present invention also provides a use of the animal model of the present invention, wherein the model animal is used for:

[0106] (iii) screening candidate drugs or therapeutic agents for treating infectious diseases, tumor-related diseases and metabolic diseases; and / or

[0107] (iv) Evaluate the efficacy of candidate drugs or therapeutic agents for infectious diseases, autoimmune diseases, and metabolic diseases.

[0108] The infectious diseases include: cytomegalovirus (CMV), influenza virus (H1N1), rotavirus (RV) infection, human papillomavirus (HPV) infection, Salmonella infection, Pseudomonas aeruginosa infection, Clostridium difficile infection, etc.

[0109] The tumor-related diseases include: gastric cancer, breast cancer, colorectal cancer, cervical cancer, non-small cell lung cancer, non-Hodgkin's lymphoma, etc.

[0110] The metabolic diseases include rheumatoid arthritis, rheumatic heart disease, rheumatoid arthritis, ulcerative colitis, Crohn's disease, etc.

[0111] The main advantages of the present invention include:

[0112] 1) The present invention is the first to construct an animal model of conditional overexpression of the TLR5 gene to study the interaction between the TLR5 receptor and its ligand, flagellin, of Salmonella typhi. It is confirmed that overexpression of the TLR5 receptor has an immunoprotective effect, stimulates the host's inflammatory response, promotes the release of proinflammatory factors, facilitates the clearance of bacteria, and prolongs survival time.

[0113] 2) The animal model of the present invention provides an important research tool for the clinical research of infectious diseases such as bacteria and viruses, tumors, and rheumatic diseases, and has broad application prospects.

[0114] 3) The animal model of the present invention can be applied to the study of the immune function of flagellin, and can provide an important research tool for the future clinical application of flagellin in anti-tumor and other fields, and may have expected clinical application value.

[0115] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally based on conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0116] Example 1 Homologous recombination plasmid construction

[0117] Cas9 mRNA and gRNA were obtained by in vitro transcription; a homologous recombination vector (donor vector) was constructed by seamless cloning. The vector contained a 3.3kb 5' homology arm, CAG-LSL-Kozak-Tlr5-3XFlag, and a 3.3kb 3' homology arm. The mouse construction strategy is as follows: Figure 1 shown.

[0118] gRNA Sequence(5'-3') gRNA GGGGACACACTAAGGGAGCT TGG(SEQ ID NO:8)

[0119] Example 2 Enzyme digestion and identification of homologous recombination plasmids

[0120] Homologous recombination plasmid map Figure 2 As shown. Agarose gel electrophoresis was used to identify the homologous recombinant vector enzyme digestion. The electrophoresis results are shown as follows. Figure 3 As shown, B is the result of BglII enzyme digestion identification, with theoretical band sizes of 7976 bp, 5475 bp, 3236 bp, 1657 bp, 825 bp, and 474 bp; M is a 1 kb DNA ladder.

[0121] Example 3 Construction and genotype identification of homologous recombination F0 generation mice

[0122] 3.1 Construction of F0 generation mice by homologous recombination

[0123] The homologous recombination vector plasmid was digested and microinjected into fertilized eggs of C57BL / 6J mice. The fertilized eggs were then transplanted into pseudopregnant female mice. The mice born around 20 days old were designated as F0 generation mice. Genotypes were identified by PCR amplification and sequencing. The identification strategy is described in [1]. Figure 4 .

[0124] 3.2 PCR identification of F0 generation mice positive for 5' homology arm recombination

[0125] The PCR primers and reaction system for identifying 5' homology arm recombination-positive F0 generation mice are shown in the following table:

[0126] Primers Sequence 5'-->3' Primer type I TTTGGTTGGCGTAAGGCG(SEQ ID NO:9) upstream II GCAGGACAGCAAGGGGGA(SEQ ID NO:10) downstream

[0127] Reaction system:

[0128] Reaction components Volume (μl) ddH2O 13.2 GXL PCR Buffer 2 2.5mM dNTP 2 Primer I (10 pmol / μl) 0.5 Primer II (10 pmol / μl) 0.5 GXL DNA Polymerase* 0.8 genomic DNA 1 total 20

[0129] *PrimeStar GXL (TaKaRa, No.: R050A)

[0130] Reaction conditions:

[0131] step# Temperature (℃) time Notes 1 94 3 minutes - 2 98 15 seconds - 3 60 15 seconds - 4 68 3 minutes Repeat steps 2-4 for 35 times 5 68 5 minutes - 6 12 - maintain

[0132] 3.3 PCR identification of F0 generation mice with positive 3' homology arm recombination

[0133] The primers and reaction system for PCR identification of F0 generation mice with positive 3' homology arm recombination are shown in the following table:

[0134] Primer information:

[0135] Primers Sequence 5'-->3' Primer type III GAAGCAGAACGTGGGGCTC(SEQ ID NO:11) upstream IV GGATGGTTTTTGCATCAGGATAA(SEQ ID NO:12) downstream

[0136] Reaction system:

[0137] Reaction components Volume (μl) ddH2O 13.2 GXL PCR Buffer 2 2.5mM dNTP 2 Primer III (10 pmol / μl) 0.5 Primer IV (10 pmol / μl) 0.5 GXL DNA Polymerase* 0.8 genomic DNA 1 total 20

[0138] *PrimeStar GXL (TaKaRa, No.: R050A)

[0139] Reaction conditions:

[0140] step# Temperature (℃) time Notes 1 94 3 minutes - 2 98 15 seconds - 3 61 15 seconds - 4 68 3 minutes Repeat steps 2-4 for 35 times 5 68 5 minutes - 6 12 - maintain

[0141] result

[0142] The electrophoresis results of long fragment PCR identification are as follows Figure 5 As shown, numbers 1 and 2 represent the F0 generation mouse numbers, and M represents a 1 kb DNA marker. A 3.7 kb fragment should be amplified from a genome that is positive for homologous recombination on the 5' arm, while no product should be amplified from a genome that is negative for homologous recombination on the 3' arm. A 4.0 kb fragment should be amplified from a genome that is positive for homologous recombination on the 3' arm, while no product should be amplified from a genome that is negative for homologous recombination on the 3' arm.

[0143] The sequencing results are as follows Figure 7 As shown in the figure, Query is the target sequence (R26-e(CAG-LSL-Kozak-Tlr5-3XFlag)1 recombined genomic DNA sequence), Subject is the sequencing result, and the red underlined bases are the 5arm homology arm sequence. The results show that homologous recombination F0 generation mice were successfully constructed.

[0144] Example 4 Construction and genotype identification of homologous recombination F1 generation mice

[0145] 4.1 Construction of F1 generation mice by homologous recombination

[0146] Because fertilized eggs cleave rapidly in the early stages, the resulting F0 generation mice are chimeric and may not be genetically stable. Further passages are required to obtain stable F1 generation mice. F0 generation positive mice are mated with wild-type C57BL / 6 mice to obtain F1 generation mice. Their genotypes are then identified by PCR and sequencing. The PCR identification strategy and method for F1 generation mice are the same as for F0 generation mice.

[0147] 4.2 PCR identification and sequencing results of F1 generation mice

[0148] The PCR identification products of F1 generation positive mice were sequenced, and a total of 4 sequencing reactions were performed. The corresponding regions of the sequencing reactions are as follows Figure 4 Among them, 5' homology arm identification and PCR product sequencing were performed in two sequencing reactions, labeled as 1 and 2 respectively; 3' homology arm identification and PCR product sequencing were performed in two sequencing reactions, labeled as 3 and 4 respectively.

[0149] result

[0150] The results of PCR electrophoresis for the 5' and 3' homology arms of F1 mice were as follows: Figure 6 After identification, the sequencing results of mice No. 3, 4, 11, 13, 15, 24, 28, and 29 were positive.

[0151] The sequencing results are as follows Figure 8 As shown in the figure, Query is the target sequence (R26-e(CAG-LSL-Kozak-Tlr5-3XFlag)1 recombinant genomic DNA sequence), Subject is the sequencing result, and the red underlined bases are the 5'arm homology arm sequences.

[0152] The results showed that homologous recombination F1 generation mice were successfully constructed.

[0153] Example 5 Obtaining mice with systemic overexpression of TLR5

[0154] The steps for R26-(CAG-LSL-Kozak-Tlr5-3XFlag)1*Dppa3-Cre mice are as follows:

[0155] (1) R26-Tlr5 heterozygous mice were selected and mated with constructed Dppa3-Cre heterozygous mice;

[0156] (2) The genotype of the obtained offspring mice was identified by PCR, and R26-Tlr5*Dppa3-Cre double-positive mice were obtained.

[0157] Example 6 Genotyping of mice with systemic overexpression of TLR5

[0158] During subsequent mouse mating and breeding, mouse genotypes can be identified using short-range PCR. The following table lists the primers and conditions required for mouse genotype identification during each subsequent breeding step. There are no special requirements for primer design software; standard software such as the PrimerSelect program in DNASTAR software can meet these requirements (relevant software can be downloaded online).

[0159]

[0160] result

[0161] The results are as follows Figure 9 As shown, only the 994bp band was amplified in the wild-type mice (P1, P2), and no band was amplified in (P3, P4); the 994bp band was amplified in the heterozygous mice (P1, P2), and a small band of 450bp was also amplified in (P3, P4); while the homozygous mice (P1, P2) had no band, and a small band of 450bp could be amplified in (P3, P4).

[0162] The results of PCR electrophoresis for Dppa3-Cre mouse identification are as follows Figure 10 As shown, wild-type mice only amplified an 828 bp band, while mutant mice could amplify a small 450 bp band.

[0163] Example 7 Application of TLR5 gene conditional overexpression mouse model - application to the study of Salmonella typhi infection

[0164] The successful TLR5 conditional overexpression mice were used to study the interaction between the TLR5 receptor and its ligand, flagellin, from Salmonella typhi, and the role of the TLR5 receptor in intestinal infection caused by Salmonella typhi. The methods are as follows:

[0165] 1. Five mice with conditional TLR5 overexpression and five wild-type control mice were intraperitoneally injected with the TLR5 receptor ligand flagellin. Blood was drawn from the mice at 0, 1, 3, and 6 hours after injection. Serum was centrifuged and assayed for pro-inflammatory cytokines such as IL-6 and TNF-α using ELISA. The differences between the two groups were compared to verify whether TLR5 overexpression promotes inflammation and induces cytokine expression.

[0166] 2. Ten TLR5 conditional overexpression mice and ten wild-type control mice were intraperitoneally injected with Salmonella typhi. The mortality rates of the two groups were observed from day 0 to day 30 to study the effect of TLR5 receptor overexpression on the mortality rate of mice after Salmonella typhi infection and the effect on the Salmonella colony count in feces.

[0167] result

[0168] Effects of TLR5 receptor overexpression on cytokine expression Figure 1 The results showed that 1 hour and 3 hours after intraperitoneal injection of flagellin, the TNF-α level in the serum of TLR5-overexpressing mice was significantly higher than that of wild-type mice (P<0.01); at 1 hour, 3 hours, and 6 hours, the IL-6 level in the serum of TLR5-overexpressing mice was significantly higher than that of wild-type mice (P<0.01).

[0169] The above results suggest that overexpression of TLR5 receptor can promote flagellin-induced inflammatory response and induce the expression of proinflammatory factors.

[0170] in conclusion

[0171] 1. In the acute inflammatory response induced by flagellin in mice, overexpression of TLR5 receptor can promote the release of proinflammatory cytokines, thereby stimulating a stronger inflammatory response.

[0172] 2. TLR5 receptor-overexpressing mice had prolonged survival time after infection with Salmonella typhi, and the Salmonella colony count in their feces was lower than that of wild-type mice, suggesting that TLR5 receptor overexpression after Salmonella infection may stimulate the host's inflammatory response, which is beneficial for clearing bacteria, prolonging survival time, and having an immune protective effect on the host.

[0173] 3. The construction of TLR5 receptor-overexpressing mice and their successful application in experiments on intestinal infection caused by Salmonella typhi have confirmed that TLR5 receptor overexpression has an immune protective effect, stimulates the host's inflammatory response, promotes the release of pro-inflammatory factors, facilitates the elimination of bacteria, and prolongs survival time.

[0174] discuss

[0175] 1. Application in infectious diseases

[0176] Research has shown that after orally instilling rotavirus (RV) into Rag1- / - transgenic mice (acquired immunodeficient mice) to establish a chronic rotavirus (RV) infection model, intraperitoneal injection of 20 μg of flagellin significantly reduced RV viral load in the mice's feces. Further studies have confirmed that this antiviral effect is mediated by the production of IL-18 and IL-22 following TLR5 activation. Based on this finding, if these TLR5-overexpressing mice were used to establish an RV infection model and then stimulated with flagellin, would the flagellin-induced inflammatory response in the mice be more robust, with higher serum IL-18 and IL-22 titers? However, does TLR5 overexpression promote faster RV clearance in mice or increase their mortality? What are the underlying mechanisms? TLR5-overexpressing mice will provide a better tool for studying flagellin and the TLR5 receptor, and the results will further shed light on the mechanisms of flagellin-mediated antiviral effects. Furthermore, international studies have shown that flagellin stimulation significantly reduces viral load in mice infected with viruses such as cytomegalovirus (CMV) and influenza virus (H1N1). Currently, these experiments can only be verified using TLR5 gene knockout mice. If TLR5 overexpression mice can be used at the same time, the experimental results will be further verified and the mechanism of flagellin immune protection will be explored in more depth.

[0177] 2. Application in clinical tumor research

[0178] Related studies have shown that high expression of TLR5 in gastric tissue indicates a good prognosis for gastric cancer, especially in patients with stage II or intestinal gastric cancer. Furthermore, flagellin can affect the proliferation of all tested gastric cancer cells. Chen et al., using tissue microarrays to jointly screen the epidemiology and TLR5 expression in breast cancer tissue, found that TLR5 is overexpressed in breast cancer tissue, and that TLR5 overexpression is correlated with lymph node metastasis and breast cancer grade. Furthermore, studies have shown that TLR5 overexpression is closely associated with the survival of patients with colorectal cancer and is overexpressed in patients with cervical cancer. However, most of these observations are based on clinical observations and lack validation from relevant animal experiments. If the above animal experiments can be conducted using the animal model of the present invention, with tumor cells inoculated simultaneously in normal mice and mice overexpressing TLR5, and the tumor prevalence and related pathological manifestations observed in the mice, this will provide reliable and clear laboratory evidence for studying the pathogenic mechanisms of TLR5 overexpression in gastric, breast, and colorectal cancers, offer new targets for tumor treatment, and provide an experimental foundation for the future application of TLR5 in tumor immunotherapy.

[0179] 3. Application in clinical research of rheumatic diseases

[0180] TLR5 is also highly expressed in rheumatic diseases such as rheumatoid arthritis and may become a new target for rheumatoid arthritis treatment in the future. In addition, TLR5 receptors are often highly expressed in inflammatory bowel diseases such as ulcerative colitis and Crohn's disease. Therefore, TLR5 receptor-overexpressing mice are also expected to play an important role in the study of rheumatic diseases.

[0181] In summary, the animal model constructed in the present invention is expected to become an important research tool in the research of infectious diseases such as bacteria and viruses, clinical research on tumors, and research on rheumatic diseases, and has broad application prospects as a basic research platform.

[0182] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.

Claims

1. A method for preparing a non-human model animal with conditional overexpression of the TLR5 gene, characterized in that: Including steps: (a) Obtain Cas9 mRNA and gRNA by in vitro transcription; (b) constructing a homologous recombination vector, the vector comprising a 5' homology arm, a TLR5 gene expression cassette, and a 3' homology arm; wherein the TLR5 gene expression cassette is a silent TLR5 gene expression cassette, and under induction conditions, the silent TLR5 gene expression cassette is converted into an activated TLR5 gene expression cassette; (c) injecting Cas9 mRNA, gRNA and the homologous recombination vector into a fertilized egg in vitro to obtain an injected fertilized egg; (d) regenerating the injected fertilized eggs into non-human model animals with conditional overexpression of the silent TLR5 gene; Step (d) further comprises: hybridizing the silent TLR5 gene conditionally overexpressed non-human model animal with the conditionally inducible animal to form an activated TLR5 gene conditionally overexpressed non-human model animal.

2. The preparation method according to claim 1, wherein The sequence of the gRNA is shown in SEQ ID NO:

8.

3. The preparation method according to claim 1, wherein The conditionally inducible animal is a Cre animal.

4. The preparation method according to claim 1, wherein The silent TLR5 gene expression cassette has a structure from 5' to 3' as shown in formula (I): Z0-Z1-Z2a-Z3-Z2b-Z4-Z5-Z6 (I) Where, Z0 is none or 5′ homology arm; Z1 is the promoter; Z2a and Z2b are loxp elements; Z is a stop codon; Z4 is the Kozak sequence; Z5 is the TLR5 coding sequence; Z6 is none or a 3' homology arm.

5. The preparation method according to claim 1, wherein The activated TLR5 gene expression cassette has a structure from 5' to 3' as shown in formula (II): Z0-Z1-Z2-Z4-Z5-Z6 (II) Where, Z0, Z1, Z4, Z5, and Z6 are as defined above; Z2 is the loxP element after recombination of Z2a and Z2b.

6. The preparation method according to claim 1, wherein The animal is a mouse or a rat.

7. A gene editing reagent for use in the preparation method according to any one of claims 1 to 6, characterized in that: The reagents include: (i) a first reagent, wherein the first reagent is a gRNA having a sequence as shown in SEQ ID NO: 8, or a precursor of the gRNA, or a vector containing the gRNA coding sequence; (ii) a second reagent, wherein the second reagent is a CRISPR / Cas9 gene editing enzyme or an expression cassette thereof, or a vector for expressing the gene editing enzyme; (iii) a third reagent, wherein the third reagent is a TLR5 gene expression cassette, or a vector containing the expression cassette; wherein the TLR5 gene expression cassette is a silent TLR5 gene expression cassette, and under induction conditions, the silent TLR5 gene expression cassette is converted into an activated TLR5 gene expression cassette.

8. The gene editing reagent according to claim 7, wherein The silent TLR5 gene expression cassette has a structure from 5' to 3' as shown in formula (I): Z0-Z1-Z2a-Z3-Z2b-Z4-Z5-Z6 (I) Where, Z0 is none or 5′ homology arm; Z1 is the promoter; Z2a and Z2b are loxp elements; Z is a stop codon; Z4 is the Kozak sequence; Z5 is the TLR5 coding sequence; Z6 is none or a 3' homology arm.

9. The gene editing reagent according to claim 7, wherein The activated TLR5 gene expression cassette has a structure from 5' to 3' as shown in formula (II): Z0-Z1-Z2-Z4-Z5-Z6 (II) Where, Z0, Z1, Z4, Z5, and Z6 are as defined above; Z2 is the loxP element after recombination of Z2a and Z2b.

10. Use of a model animal, wherein the model animal is prepared by the method according to claim 1, characterized in that: The model animals are used for: Screening of candidate drugs or therapeutic agents for the treatment of infectious diseases, tumor-related diseases, and metabolic diseases.

11. The use according to claim 10, wherein The infectious diseases include: cytomegalovirus infection, influenza virus infection, rotavirus infection, human papillomavirus infection, Salmonella infection, Pseudomonas aeruginosa infection, and Clostridium difficile infection.

12. The use according to claim 10, characterized in that The tumor-related diseases include: gastric cancer, breast cancer, colorectal cancer, cervical cancer, non-small cell lung cancer, and non-Hodgkin's lymphoma.

13. The use according to claim 10, characterized in that The metabolic diseases include: rheumatoid arthritis, rheumatic heart disease, rheumatoid arthritis, ulcerative colitis, and Crohn's disease.

Images