SNP molecular marker on pig chromosome 1 associated with pig backfat thickness and lean percentage and application thereof
By identifying SNP molecular markers and primer pairs on pig chromosome 1, the challenges of improving lean meat percentage and backfat thickness in pigs have been solved, enabling rapid breeding progress and improved carcass quality, meeting market demands and increasing economic benefits.
Patent Information
- Application Number
- CN202311646236.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-04
- Publication Date
- 2026-06-09
- Estimated Expiration
- 2043-12-04
AI Technical Summary
Existing technologies are insufficient to quickly and effectively improve the lean meat percentage and backfat thickness traits of pigs, resulting in slow genetic progress that fails to meet consumer demand and improve the economic benefits of pig farming enterprises.
We provided SNP molecular markers and their primer pairs located on chromosome 1 of pigs that are associated with backfat thickness and lean meat percentage. We identified the key SNP site g.389G>A through genome-wide association analysis and used the primer pairs for marker-assisted selection to increase the frequency of dominant alleles generation by generation, thereby reducing backfat thickness and increasing lean meat percentage.
This enables rapid and accurate molecular marker-assisted breeding, improving the carcass quality of pigs, meeting consumer market demands, and enhancing the economic benefits of breeding enterprises.
Smart Images

Figure CN117904306B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of molecular biotechnology and molecular marker technology, specifically relating to a SNP molecular marker located on chromosome 1 of pigs that is related to backfat thickness and lean meat percentage, and its application. Background Technology
[0002] With the improvement of people's living standards, the demand for pork is gradually shifting from fat-type pigs to lean-type pigs, making the breeding of high-quality lean-type pigs an important goal of pig breeding. Lean meat percentage is one of the important indicators for measuring carcass quality. In breeding work, backfat thickness is commonly used as an informative trait for lean meat percentage selection and is an important component in the lean meat percentage estimation equation.
[0003] For a long time, lean meat percentage has been a complex quantitative trait regulated by multiple genes, and its phenotype is not easily observed directly, resulting in slow genetic progress. With the development of high-throughput sequencing technology, genome-wide association study (GWAS) has become an important method for studying the genetic mechanisms of complex traits, breaking through the bottleneck of screening molecular markers for important economic traits. Combining GWAS with marker-assisted selection (MAS) technology to simultaneously improve backfat thickness and lean meat percentage in pigs can effectively accelerate the genetic progress of these two traits.
[0004] Duroc × Landrace × Large White (Duroc × Landrace × Large White) is the world's most popular commercial pig breed due to its outstanding growth rate and carcass performance. Duroc pigs, as the terminal sire, directly influence the production performance and carcass quality of the Duroc × Landrace × Large White. Selective breeding of backfat thickness and lean meat percentage in the core Duroc herd can transfer the genetic potential of high-quality Duroc pigs to the commercial pig population, significantly improving the production performance of commercial pigs and increasing the economic benefits of pig farming enterprises. Summary of the Invention
[0005] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide an SNP molecular marker located on chromosome 1 of pigs that is related to backfat thickness and lean meat percentage.
[0006] Another object of the present invention is to provide the application of the above-mentioned SNP molecular markers located on chromosome 1 of pigs that are associated with backfat thickness and lean meat percentage.
[0007] Another object of the present invention is to provide a primer pair for identifying the aforementioned SNP molecular markers located on chromosome 1 of pigs that are associated with backfat thickness and lean meat percentage.
[0008] A fourth objective of this invention is to provide applications of the aforementioned primer pairs.
[0009] The fifth objective of this invention is to provide a method for genetic improvement of pigs.
[0010] The objective of this invention is achieved through the following technical solution:
[0011] A molecular marker of a SNP located on chromosome 1 of pigs that is associated with backfat thickness and lean meat percentage. The SNP site corresponds to the G>A mutation at position 36331868 on chromosome 1 of the international pig reference genome version 11.1 reference sequence.
[0012] The nucleotide sequence of the SNP molecular marker located on chromosome 1 of pigs that is associated with backfat thickness and lean meat percentage is shown in SEQ ID NO.1, where M in the sequence is G or A, which leads to differences in backfat thickness and lean meat percentage traits in pigs;
[0013] The SNP site of the SNP molecular marker located on chromosome 1 of pigs that is associated with lean meat percentage and backfat thickness is the G389-A389 nucleotide mutation at position 389 of the sequence marked in SEQ ID NO.1 (a single base mutation at the 389th nucleotide of this sequence fragment, named: g.389G>A);
[0014] The application of the SNP molecular markers located on chromosome 1 of pigs that are associated with lean meat percentage and backfat thickness in identifying backfat thickness and lean meat percentage traits in Duroc pigs and in genetic breeding;
[0015] A method for detecting backfat thickness and lean meat percentage in pigs includes the following steps:
[0016] The above-mentioned SNP molecular markers located on pig chromosome 1 that are associated with lean meat percentage and backfat thickness were tested, and it was determined whether the single nucleotide at position 389 of the 5' end of the SNP molecular marker was G or A.
[0017] The preferred pigs are the Canadian Duroc strain and its synthetic strains;
[0018] A primer pair for identifying the aforementioned SNP molecular markers located on pig chromosome 16 that are associated with lean meat percentage and backfat thickness in pigs, comprising primers primer-F and primer-R, has the following nucleotide sequence:
[0019] Upstream primer-F: 5'-GCCCTCTTTTGTTGATCTGCT-3';
[0020] Downstream primer-R: 5'-TGATGAGCTCAATGCCTCCT-3';
[0021] Application of the primer pairs in identifying backfat thickness and lean meat percentage in pigs;
[0022] Application of the primer pairs in marker-assisted breeding of pigs;
[0023] The application of the primer pairs in reducing backfat thickness and increasing lean meat percentage in pigs;
[0024] A method for genetic improvement of pigs, comprising the following steps:
[0025] Identify the SNP molecular markers on chromosome 1 of pigs in the core breeding pig population that are associated with lean meat percentage and backfat thickness, and make corresponding selections based on these molecular markers: select breeding pigs with the AA genotype at 36331868 bp on chromosome 1 of the International Pig Reference Genome 11.1 in the core breeding pig population, and cull breeding pigs with the GG and AG genotypes at this point, so as to increase the frequency of allele A at this locus generation by generation, thereby reducing backfat thickness and increasing lean meat percentage in offspring pigs;
[0026] The preferred pigs are the Canadian Duroc strain and its synthetic strains;
[0027] The present invention has the following advantages and effects compared with the prior art:
[0028] (1) This invention studies and identifies molecular markers related to backfat thickness and lean meat percentage in pigs, which are located on the nucleotide sequence of chromosome 1 of pigs. It verifies their effects on backfat thickness and lean meat percentage traits in pigs, and finally establishes a molecular marker-assisted selection breeding technology for rapid improvement of backfat thickness and lean meat percentage traits in pigs. This technology is applied to the genetic improvement of breeding pigs to reduce backfat thickness and increase lean meat percentage, thereby improving the carcass quality of offspring pigs, meeting the needs of the consumer market, and increasing the economic profits of breeding enterprises.
[0029] (2) This invention provides a primer pair for identifying SNP molecular markers located on chromosome 1 of pigs that are related to lean meat percentage and backfat thickness. Through this primer pair, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select for lean meat percentage and backfat thickness traits, thereby accelerating the breeding process.
[0030] (3) By selecting the dominant allele of the molecular marker, the present invention provides a method for pig breeding, which can increase the frequency of dominant alleles generation by generation, reduce the backfat thickness of breeding pigs, increase the lean meat rate of breeding pigs, accelerate the progress of pig genetic improvement, and thus effectively improve the economic benefits of pig breeding. Attached Figure Description
[0031] Figure 1 This is a genome-wide association (GWAS) diagram of the backfat thickness trait in Canadian Duroc pigs on chromosome 1 at a body weight of 100 kg; where: the horizontal axis represents the chromosome number of the pig; the vertical axis represents the -logP value;
[0032] Figure 2 This is a genome-wide association (GWAS) diagram of the lean meat percentage trait in Canadian Duroc pigs on chromosome 1 at a body weight of 100 kg.
[0033] Figure 3 This is an analysis chart showing the backfat thickness of pigs with different genotypes at a weight of 100kg.
[0034] Figure 4 This is a graph showing the lean meat percentage of pigs with different genotypes at a weight of 100kg. Detailed Implementation
[0035] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.
[0036] Experimental pig herd: A total of 2090 Canadian Duroc pigs were used in this experiment.
[0037] Example 1 explains in detail the process of determining the effect of lean meat percentage in this invention.
[0038] The backfat thickness of all experimental pigs was finally measured using an Aloka SSD 500V live ultrasound scanner at the 10th-11th intercostal space. The final weight was corrected to 100 kg using a calibration formula. The lean meat percentage of the Duroc pigs after slaughter was determined using the New Zealand HGS (Hennessy Grading System), and their pre-slaughter live weight was corrected to 100 kg using a calibration formula.
[0039] The experimental pig herd used in this invention consisted of 2090 purebred Canadian Duroc pigs from the breeding pig division of Guangdong Wens Foodstuff Group Co., Ltd. This herd was the core group of the breeding pig division, and the herd's pedigree was recorded in detail. This experiment selected Canadian Duroc pigs from this resource group. The pigs were fed and watered freely under uniform feeding standards until they reached a body weight of 100±5 kg.
[0040] Example 2 provides a detailed explanation of the invention process of the gene marker in this invention.
[0041] (1) DNA was extracted from ear-like tissue of Canadian Duroc pigs using the phenol-chloroform method as described in the standard. The DNA from the purebred Canadian Duroc population was analyzed for quality and concentration using a Nanodrop-ND1000 spectrophotometer. An A260 / 280 ratio of 1.8–2.0 and an A260 / 230 ratio of 1.7–1.9 were considered acceptable. Finally, the acceptable DNA samples were uniformly diluted to 50 nanograms per microliter.
[0042] (2) 50K SNP genotyping and imputation of the whole porcine genome: GeneSeek Genomic Profiler Porcine 50K SNP genotyping platform was used. Microarray hybridization and result scanning were performed using the Illumina Infinium user manual and standard procedures. Genotype data were then read using GenomeStudio software. To increase marker density and thus improve the success rate of identifying key mutation sites affecting the target trait, the SWIM database website was used to imput the genotype data. The obtained genotype imputation data were quality controlled using PLINK v1.9, and data with a detection rate <90%, mimor allel frequency (MAF) <1%, or deviation from Hardy-Weinberg equilibrium (HWE) P≤10 were removed. -6 SNP markers were excluded, with a detection rate <95%, and SNPs located at unknown locations and on sex chromosomes were excluded. The remaining 11,388,559 SNP markers and 2,080 samples from the 100kg lean meat percentage quality control were used for subsequent data analysis; the remaining 11,388,559 SNP markers and 2,080 samples from the 100kg backfat thickness quality control were also used for subsequent data analysis.
[0043] (3) Genome-wide association analysis (GWAS): Due to the potential for false positives caused by kinship and population stratification effects, a kinship matrix needs to be constructed using GEMMA software before association analysis. Principal component analysis is then performed using GCTA software, with the first five principal components used as covariates to correct for population structure. Finally, GWAS analysis is conducted using a univariate mixture model in GEMMA software. This invention references the human genome significance threshold, setting the genome significance and chromosome significance thresholds to 5.00E-08 and 1.00E-06, respectively.
[0044] GWAS analysis results are as follows Figure 1 and Figure 2 As shown. From Figure 1 and Figure 2 It was found that in Duroc, there is a locus on chromosome 1 that significantly affects backfat thickness at 100kg and lean meat percentage at 100kg, with the strongest association SNP being g.389G>A (P values were 3.61×10⁻⁶). -8 and 1.92×10 -7 (The 389th nucleotide in SEQ NO.1 corresponds to the G>A mutation at 36331868 bp on chromosome 1 in International Pig Reference Genome Version 11.1).
[0045] (4) Association analysis of different genotypes with backfat thickness and lean meat percentage phenotypes in breeding pigs at 100kg body weight: According to Table 1, the SNP site g.389G>A (nucleotide 389 in SEQ NO.1, corresponding to the G>A mutation at 36331868bp on chromosome 1 of the International Swine Reference Genome 11.1) was significantly associated with backfat thickness and lean meat percentage (P<0.01), indicating that this molecular marker significantly affects backfat thickness and lean meat percentage in pigs. Assisted selection at this SNP site in pigs can reduce backfat thickness and increase lean meat percentage, thereby accelerating the breeding process of lean-type breeding pigs. Furthermore, according to Table 1, Figure 3 and Figure 4 It is also known that GG and AG types have thicker backfat and lower lean meat percentage than AA types, indicating that GG and AG genotypes are less favorable for carcass quality in pigs. In the process of breeding, we need to gradually eliminate GG and AG types and retain AA type breeding pigs in order to increase the frequency of allele A at this locus in each generation.
[0046] Table 1. Correlation analysis of SNP sites g.389G>A of molecular markers with traits.
[0047]
[0048] Example 3 explains in detail the invention process of detecting SNP markers.
[0049] (1) The target fragment containing SNP loci that are significantly associated with backfat thickness and lean meat percentage at 100kg body weight in the Canadian Duroc strain is a 684bp nucleotide sequence from chromosome 1. The upstream and downstream primers for sequence amplification are primer-F and primer-R, and their nucleotide sequences are as follows:
[0050] Upstream primer-F: 5'-GCCCTCTTTTGTTGATCTGCT-3';
[0051] Downstream primer primer-R: 5'-TGATGAGCTCAATGCCTCCT-3'.
[0052] (2) PCR amplification system and conditions
[0053] Prepare a 10 μL system, including 1 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O. The PCR conditions are: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, and a final extension at 72℃ for 5 min.
[0054] (3) DNA Sequence Sequencing Identification: Sequencing was performed at BGI Genomics Co., Ltd. in Shenzhen, with two sequencing reactions for each gene fragment. The obtained sequences were compared with the NCBI genome sequence to identify mutations at corresponding SNP sites. The sequencing results are shown below:
[0055] GCCCTCTTTTGTTGATCTGCTGCAGCAAGTGGGGTTGGTAATAATTGCACCTTACAAT
[0056] TCCAACTGGAAGATAGGTCTTTAGGATTATGGATATTTGTACAATCAACTATATTCTATTT
[0057] CAAGGATCACAAATATTCTATAGGTAGGAGGTTTGATGGTACTACCTAATTATGTTTCTTAT
[0058] CTTTTCTCACCTATAACTTCTTCTCCCTTATTTTTATCTGCTGTGAAACTTCAAAATGTT
[0059] ATCAAAAAGTATTTTCATAAGTAATATAGTCATTCAGCACTGAAGGAGAAAAAGTGCTT
[0060] CATATTTTATTTCTAGAATGTGATTTGCTGAGAAATCATAACCTTGATCATTTCTTTATACTTTGTTCATAGACTAGAAGAGAGAGAG M(G / A) CAAGAGTGTTGGCAAAATCACCTATA GCTAAATGTTCAGCAGAAATGGGATCATCACAACACTGTAAATCAACTTACATCAATAAAACTTAAAAAATTAAAATTAAATGTATAATTCTTCTATGTATGAATTTATTCATTATACCTAGTACATAAACTT ACCATTAAATATTGTTAAATTGAAAATTTTTTAAGCAAATAGTTTACAAAGCAAGTATTCAGGACTATTTATGATGTGTTTAAAAGTCAGAGAACTGCAAAATTTTATATGGGGAAGGAGGCATTGAGCTCATCA
[0061] Note: M marked in the sequence is the mutation site, indicated by an underline (the mutated base in parentheses represents the allele mutation). The beginning and end of the sequence are bolded to indicate the primer binding position.
[0062] Example 4: Analysis of the g.389G>A effect of SNP sites on molecular markers
[0063] As shown in Table 1, the dominant allele (AA) at the SNP locus g.389G>A resulted in a 0.76 cm decrease in average backfat thickness and a 0.77% increase in average lean meat percentage compared to the GG allele. Therefore, by using marker-assisted selection to gradually cull pigs with genotypes GG and AG within the population, the allele frequency of allele A can be significantly increased, leading to a decrease in backfat thickness and an increase in lean meat percentage. This improves carcass quality, resulting in more high-quality lean pork to meet consumer demand and drive pork sales growth, ultimately bringing significant economic benefits to businesses.
[0064] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. The application of a SNP molecular marker located on chromosome 1 of pigs, associated with backfat thickness and lean meat percentage, in the identification of backfat thickness and lean meat percentage traits and in the genetic improvement of backfat thickness and lean meat percentage in pigs, characterized in that, The nucleotide sequence of the SNP molecular marker located on chromosome 1 of pigs that is associated with backfat thickness and lean meat percentage is shown in SEQ ID NO.1, where M in the sequence is G or A, which leads to differences in backfat thickness and lean meat percentage traits in pigs. The GG and AG genotypes have lower backfat thickness and lean meat percentage than the AA genotype. The pigs mentioned are the Canadian Duroc strain and its synthetic strains.
2. A method for detecting backfat thickness and lean meat percentage in pigs, characterized in that, It includes the following steps: The method involves detecting the SNP molecular markers on chromosome 1 of pigs as described in claim 1, which are associated with backfat thickness and lean meat percentage. The nucleotides of the SNP molecular markers are either G or A. The GG and AG genotypes have lower backfat thickness and lean meat percentage than the AA genotype. The pigs mentioned are the Canadian Duroc strain and its synthetic strains.
3. The application of a primer pair in identifying backfat thickness and lean meat percentage traits in breeding pigs, characterized in that: The primer pair is for identifying the SNP molecular marker of claim 1, and includes primers primer-F and primer-R, whose nucleotide sequences are as follows: Upstream primer-F: 5'- GCCCTCTTTTGTTGATCTGCT -3'; Downstream primer-R: 5'-TGATGAGCTCAATGCCTCCT-3'; The GG and AG genotypes of the SNP molecular markers have thicker back fat and lower lean meat percentage than the AA genotype; The pigs mentioned are the Canadian Duroc strain and its synthetic strains.
4. The application of a primer pair in marker-assisted breeding of pigs, characterized in that: The primer pair is for identifying the SNP molecular marker of claim 1, and includes primers primer-F and primer-R, whose nucleotide sequences are as follows: Upstream primer-F: 5'- GCCCTCTTTTGTTGATCTGCT -3'; Downstream primer-R: 5'-TGATGAGCTCAATGCCTCCT-3'; The GG and AG genotypes of the SNP molecular markers have thicker back fat and lower lean meat percentage than the AA genotype; The pigs mentioned are the Canadian Duroc strain and its synthetic strains.
5. A method for genetic improvement of pigs, characterized in that... It includes the following steps: Identify the SNP molecular markers on chromosome 1 of pigs in the core breeding herd that are associated with backfat thickness and lean meat percentage, as described in claim 1, and make corresponding selections based on the molecular markers: select breeding pigs with the AA genotype of the SNP molecular markers described in claim 1 for successive generations, and eliminate breeding pigs with the GG and AG genotypes, in order to increase the frequency of allele A at this locus generation by generation, thereby reducing backfat thickness and increasing lean meat percentage in offspring pigs; The pigs mentioned are the Canadian Duroc strain and its synthetic strains.