An orphan gene for regulating the bolting and flowering time of Chinese cabbage and its application

Abstract

The present invention discloses an orphan gene for regulating the bolting and flowering time of Chinese cabbage and its application, and relates to the field of biotechnology. The orphan gene is the BrOG37 gene, and the nucleotide sequence of the BrOG37 gene is shown in SEQ ID NO.1. The present invention also provides the application of the orphan gene in delaying the bolting and flowering time of Chinese cabbage. The present invention has found that the BrOG37 protein is located in the cell membrane, which can regulate the bolting and flowering time of Chinese cabbage. The present invention clarifies the specific way in which BrOG37 participates in regulating the flowering of Chinese cabbage, and the molecular mechanism of BrOG37 regulating BrFLC, a key gene for flowering from vegetative growth to reproductive growth, which opens up new ideas and new genes for the regulation of flowering of Chinese cabbage, and is conducive to the cultivation of new varieties of Chinese cabbage resistant to bolting resources.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to an orphan gene for regulating the bolting and flowering time of Chinese cabbage and an application thereof. Background Art

[0002] Brassica rapa, a Brassica rapa crop in the genus Brassica of the family Cruciferae, is the leafy vegetable with the widest cultivation area, the largest area and the highest total yield in my country. It includes multiple cultivated species such as Chinese cabbage, non-heading cabbage, Chinese cabbage, turnip and Chinese cabbage, whose vegetative bodies are commercial organs. The early bolting and flowering of Brassica crops shortens the vegetative growth cycle, which in turn greatly reduces their commercial value and edible value. Unripe bolting is also the main limiting factor for the production of Chinese cabbage in summer at high altitudes and in spring in northern my country. Therefore, in order to meet market demand, enrich the variety of off-season vegetables, and enable producers to obtain higher economic benefits, the cultivation of bolting-resistant varieties has become an important goal of Chinese cabbage breeding. Studying the molecular mechanism of Chinese cabbage bolting and flowering has important guiding significance for the cultivation of bolting-resistant Chinese cabbage varieties.

[0003] Orphan genes (OGs) are species- or lineage-specific genes that are dissimilar in sequence to known genes expressed in other species, often arising as a result of rapid evolutionary activity. To date, orphan genes have been identified in the genomes of many species, including Gnetum, Arabidopsis, Brassica, eight Cucurbitaceae species, rice, and Cowpea. As OGs do not contain identifiable domains, functional motifs, or folding patterns, their functions are often unclear, thus ultimately requiring detailed functional analysis. Several studies have successfully demonstrated distinct roles for specific orphan genes as mediators of metabolite synthesis. These properties make OGs an important genetic resource for plant breeding aimed at improving specific traits and enhancing plant stress resistance and quality. However, to date, the study of specific OGs regulating flowering time has been largely overlooked.

[0004] Flowering time is an important agronomic trait that determines reproductive success and crop yield. Plants can adjust flowering time through complex regulatory networks to maintain reproductive success. So far, five flowering regulatory pathways have been identified, including age, photoperiod, hormone, autonomous and vernalization pathways, which are important regulators of the floral transition. These pathways integrate the input of multiple flowering-related signals and ultimately regulate the expression of important genes that control flowering time, including APETALA1 (AP1, AT1G69120), SUPPRESSOR OF OVEREXPRESSION OF CO1 (SOC1, AT2G45660), FLOWERINGLOCUST (FT, AT1G65480) and plant-specific transcription factor TF (LFY, AT5G61850). FLOWERINGLOCUS C (FLC, AT5G10140) is a central repressor of flowering and vernalization, which can inhibit the expression of TFs related to floral transition in the shoot apical meristem (SAM). The autonomous pathway can promote flowering in a manner independent of flowering duration by repressing FLC. In the photoperiod pathway, the diurnal expression patterns of CONSTANS (CO, AT5G15840) and FT are regulated by a series of positive and negative regulators, which affect protein-protein interactions, chromatin structural properties, protein stability and transcriptional activity. Circadian rhythms are closely related to the photoperiod regulation of the transition from vegetative to reproductive growth in plants. Although other hormones including jasmonic acid, brassinosteroids, abscisic acid, cytokinin and ethylene also play regulatory roles in this environment, gibberellin (GA) pathway signaling is the main hormonal mechanism regulating flowering activity. The miR156-SPL (SQUAMOSA PROMOTER BINDINGPROTEIN-LIKE) and miR172-AP2 (APETALA2, AT4G36920) modules have been proposed as key regulatory hubs in the age pathway, promoting flowering in plants under non-inducing conditions. Although these results provide important insights into the mechanisms controlling flowering time, the mechanistic connections between these pathways and the regulation between them have not been reported in detail.

[0005] Heading is one of the most important agronomic traits of Chinese cabbage and Brassica oleracea, and has always attracted the attention of researchers. Precocious bolting has a serious adverse effect on the yield and quality of cabbage crops such as Chinese cabbage, limiting their planting areas and planting seasons. Therefore, it is urgent to cultivate new varieties with strong bolting resistance. Histone H4 encoded by BrHIS4.A04 (Bra035673) inhibits the expression of photoperiodic flowering genes in Chinese cabbage under drought conditions through the ABA signaling pathway, thereby preventing premature bolting. SETDOMAIN GROUP 8 (BrSDG8, BraA07g040740.3C) is an additional regulator of early bolting in Chinese cabbage. When the function of this gene is destroyed, the methylation activity of FLCH3K6 increases. The expression level of BrFLC5 (Bra022771) in cabbage is lower than that of the other two BrFLC genes, providing a basis for the breeding of bolting-resistant cabbage varieties.

[0006] The present invention intends to screen out the key regulatory factors that cause delayed flowering of Chinese cabbage by verifying 128 orphan genes discovered in the early stage, thereby exploring new ideas and gene sources for the cultivation of new varieties of Chinese cabbage resistant to bolting. Summary of the invention

[0007] The purpose of the present invention is to provide an orphan gene for regulating the bolting and flowering time of Chinese cabbage and its application, so as to solve the problems existing in the above-mentioned prior art. The present invention has found that the orphan gene can regulate the bolting and flowering time of Chinese cabbage, thereby opening up new ideas and new genes for the regulation of flowering of Chinese cabbage, which is conducive to the cultivation of new varieties of Chinese cabbage resources that are resistant to bolting.

[0008] To achieve the above object, the present invention provides the following solutions:

[0009] The present invention provides an orphan gene for regulating the bolting and flowering time of Chinese cabbage. The orphan gene is the BrOG37 gene, and the nucleotide sequence of the BrOG37 gene is shown in SEQ ID NO.1.

[0010] The present invention also provides a recombinant expression vector, comprising the above-mentioned orphan gene.

[0011] Furthermore, the recombinant expression vector is a pCAMBIA 1305 recombinant expression vector.

[0012] The present invention also provides a recombinant microbial strain, comprising the above-mentioned recombinant expression vector.

[0013] Furthermore, the recombinant microbial strain is a recombinant Agrobacterium.

[0014] The present invention also provides the use of the above-mentioned orphan gene, recombinant expression vector or recombinant microbial strain in delaying the bolting and flowering time of Chinese cabbage.

[0015] Furthermore, when the expression level of the orphan gene increases, the bolting and flowering time of the Chinese cabbage is delayed.

[0016] The present invention also provides a method for delaying the bolting and flowering time of Chinese cabbage, comprising the steps of introducing the above-mentioned orphan gene into Chinese cabbage plants to construct a transgenic plant that overexpresses the orphan gene.

[0017] The present invention discloses the following technical effects:

[0018] The present invention has found that the BrOG37 gene can regulate the bolting and flowering time of Chinese cabbage. Preliminary experiments have found that the overexpressed transgenic Arabidopsis BrOG37OE has the most significant bolting tolerance phenotype. The effect of this gene on bolting and flowering has also been verified in Chinese cabbage, and Chinese cabbage overexpressing BrOG37 plants show an obvious late bolting phenotype. Arabidopsis BrOG37 overexpression strains bloom late under long and short day conditions, and vernalization and gibberellins can promote their flowering. The present invention observed that compared with the leaves of the wild type, the leaves of the Arabidopsis BrOG37OE plants all curled inward. At the silique maturity stage, the stamens of the flower organs of the BrOG37OE plants are much larger than those of the wild type. It is also found that the anthers at the top of the wild-type pistil filaments are usually higher than the stigma, while the anthers at the top of the filaments of the BrOG37OE plants are flush with the stigma or below the stigma. BrOG37 is widely expressed in Arabidopsis tissues. BrOG37 protein is localized in the cell membrane.

[0019] The present invention clarifies the specific pathway of BrOG37's involvement in regulating the flowering of Chinese cabbage, and the molecular mechanism by which BrOG37 regulates BrFLC, a key gene in flowering from vegetative growth to reproductive growth, which opens up new ideas and new genes for regulating the flowering of Chinese cabbage and is beneficial to the cultivation of new varieties of Chinese cabbage resources that are resistant to bolting. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 1 The leaf and plant phenotypes of transgenic Arabidopsis BrOG37OE overexpressing plants and wild-type Arabidopsis WT;

[0022] Figure 2 The phenotypes of floral organs and the lengths of stamens and pistils of transgenic Arabidopsis BrOG37OE-overexpressing plants and wild-type Arabidopsis WT, scale bar = 1 mm, data are mean ± SE (n = 10);

[0023] Figure 3 The phenotypes of leaf epidermal hairs under a microscope of transgenic Arabidopsis BrOG37OE-overexpressing plants and wild-type Arabidopsis WT, scale bar = 2000 μm;

[0024] Figure 4 The expression results of key genes in the flowering pathway of Arabidopsis BrOG37OE plants are shown in Figure 2. WT is wild-type Arabidopsis, WTL and BrOG37OEL represent wild-type and mutant leaves (Leaf, L), WTSA and BrOG37OESA represent wild-type and mutant shoot apex (ShootApex, SA), and asterisks represent significant differences in t-tests (*, p<0.05, ***, p<0.01, ***, p<0.001).

[0025] Figure 5 The phenotypes and data analysis results of BrOG37OE on the 46th day after sowing under vernalization (+Vrn) and non-vernalization (-Vrn) treatments; (A) is a phenotypic diagram; (B) is a statistical diagram; the asterisk (*) indicates a significant difference in the t-test (*, p<0.05), and the experiment was repeated at least three times (n≥30);

[0026] Figure 6 The phenotypes and data analysis results of BrOG37OE on the 46th day after sowing under GA treatment (+GA) and non-GA treatment (-GA); (A) is a phenotypic diagram; (B) is a statistical diagram; the asterisk (*) indicates a significant difference in the t-test (*, p<0.05), and the experiment was repeated at least three times (n≥30);

[0027] Figure 7 The phenotypes and data analysis results of BrOG37OE on the 46th day after sowing under long-day (LD) and short-day (SD) treatments; (A) is a phenotypic diagram; (B) is a statistical diagram; the asterisk (*) indicates a significant difference in the t-test (*, p<0.05), and the experiment was repeated at least three times (n≥30);

[0028] Figure 8 The results of subcellular localization and expression characteristics detection of BrOG37 gene; (A) is the result of subcellular localization, p35S::GFP is the empty control, and YFP is the plasma membrane marker; (B) is the expression analysis result of promoter fusion GUS; the scale bars in (A) are 20 μm;

[0029] Fig. 9The results of BrOG37 expression analysis in different Chinese cabbage tissues; (a) is an example of bolting-resistant Chinese cabbage varieties (BR type) and bolting-intolerant Chinese cabbage varieties (BN type); (b) is the qRT-PCR analysis of the expression pattern of BrOG37 in BR type and BN type during the bolting period; GP represents the short stem tip, TP represents the inner leaf tip, and TP is used as the control; the data are the mean ± SE of three biological replicates; (c) The expression of BrOG37 in Chinese cabbage under low temperature treatment. The Chinese cabbage inbred line 'BR9' was used as the material, and the asterisks in the chart represent significant differences found by t-test (*, p<0.05, **, p<0.01, ***, p<0.001);

[0030] Fig.10 Figure 2 shows the phenotypic identification results of transgenic Chinese cabbage GTOG37OE overexpressing plants; (A) shows the PCR identification analysis of GTOG37OE plants for hygromycin resistance, 1-19 represent 19 plants overexpressing BrOG37, and WT represents the wild-type non-transgenic Chinese cabbage plant GT-24; (B) shows the expression analysis results of BrOG37 in GT-24 and GTOG37OE plants; (C) shows the phenotypes of GT-24 and GTOG37OE under vernalization and non-vernalization conditions; (D) shows the phenotypic data analysis of GT-24 and GTOG37OE plants under vernalization and non-vernalization treatments, and asterisks indicate significant differences in t-test (*, p<0.05, **, p<0.01, ***, p<0.001); data are mean ± SE (n=18). DETAILED DESCRIPTION

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0033] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0034] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0035] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0036] The primer information used in the present invention is shown in Table 1:

[0037] Table 1 Primer information

[0038]

[0039] Example 1

[0040] 1. Materials and Methods

[0041] 1.1 Plant materials and growth conditions

[0042] Plant materials included Chinese cabbage inbred line 'GT-24', wild-type Arabidopsis thaliana 'Col-0', Arabidopsis thaliana BrOG37 overexpressing transgenic plant 'BrOG37OE', Chinese cabbage BrOG37 overexpressing transgenic plant 'GTOG37OE' and Nicotiana benthamiana.

[0043] The wild-type Arabidopsis thaliana 'Col-0' used in the present invention was obtained from the Nottingham Arabidopsis Stock Center (NASC) in the United Kingdom and belongs to the accession variety of Col-0. Arabidopsis thaliana was grown on a nutrient soil containing 3% sucrose and 0.7% agar (2:1) at 22±2°C and a relative humidity of 60%. Long day (LD) was defined as 16 hours of light and 8 hours of darkness, and short day (SD) was defined as 8 hours of light and 16 hours of darkness.

[0044] The Chinese cabbage inbred line 'GT-24' has been disclosed in the document “Jiang M, Zhan Z, Li H, Dong X, Cheng F, Piao Z*. 2020. Brassica rapa orphan genes largely affect soluble sugar metabolism. Horticulture Research, 7: 181.”

[0045] 1.2 BrOG37 sequence analysis

[0046] The conserved domains in BrOG37 were searched in the NCBI Conserved Domain Database (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi) using the CD-Search tool.

[0047] SignalP 5.0 server (https: / / services.healthtech.dtu.dk / service.php?SignalP-5.0) was used to identify the predicted signal peptide sequence in BrOG37. The plant transcription factor PlantTFDB database (PlantTFDB v5.0, http: / / planttfdb.gao-lab.org / ) and GPS (Group-based Prediction System) online server were used to predict the orphan gene BrOG37. The Chinese cabbage genome version 1.5 was used for structural variation analysis (http: / / brassicadb.cn / ).

[0048] 1.3 Plasmid construction and genetic transformation of plants

[0049] according to HD Cloning Kit (Clontech, Dalian, China) vector construction kit instructions were used to amplify the BrOG37 gene (435 bp) fragment from cabbage DNA and cloned into the 35S red vector for overexpression in Arabidopsis. Agrobacterium strain GV3101 was used, and Arabidopsis wild type 'Col-0' was used as genetic transformation material, and genetic transformation was carried out by Arabidopsis floral staining method. T0 generation transgenic plants were screened on kanamycin culture plates. DNA of transgenic positive plants was amplified by PCR using hygromycin-specific primers (hyg-F / R in Table 1), and qRT-PCR was used to detect the expression of BrOG37 in transgenic plants. Primers are shown in BrOG37-F / R in Table 1. T3 generation homozygotes were used for subsequent experiments.

[0050] The wild type of Chinese cabbage 'GT-24' was used as the genetic transformation material, and the established mature and stable Chinese cabbage transgenic technology system was used for genetic transformation of the BrOG37 gene. The target gene was cloned into the pCAMBIA 1305 vector for Chinese cabbage overexpression transgenic experiments. The Agrobacterium-mediated method was used for genetic transformation in the wild type of Chinese cabbage 'GT-24'. PCR and Sanger sequencing were used to molecularly identify the transgenic plants, and the BrOG37 homozygous transgenic plant 'GTOG37OE' was screened out. The expression level of the BrOG37 target gene in the above transgenic plants was detected by qRT-PCR to ensure that the overexpressed 'GTOG37OE' transgenic plants were screened out.

[0051] The nucleotide sequence of the BrOG37 gene (SEQ ID NO.1) is as follows:

[0052] ATGTTCACAAGAGCGTACACATGGGCACTCACCGGAGTGTACACAAGCGCATACACTGGAGCGTACACTACAGTGTACACTAGAGTGTACACGGTTGTACACCATATTGTACACCATAGTGTACACCATAGCGTACATTATGGTGTACATCGGAGTGTACACTGTAATGTACATGTGAGCGTACACTGGAGCGTCACATGTGCGTACACGTCGTACAC CTTAGCGTACACTAGGGTGTACACTATAGCGTACACTAGGGTGTACACTATAGCGTACACTAGGGTGTACACTATAGCATACACTAGGTTGTACATCAGAGCGTACACGTTAGCGTACACTAGAGCATACACGGCGAACACCGGCGTACACATGGCATACATTTGGGCGTACATAGGAGTGCACACCAGACGTATATTACAATGTACAACACCATAG.

[0053] 1.4 Flowering time measurement

[0054] The number of rosette leaves, the time of bolting, and the number of days until the first flower is visible (i.e., flowering time) were recorded. The length of the stalk and the stem were measured on the day of flowering. Phenotypic observations were performed using stable homozygous T2 transgenic plants, and three lines of transgenic plants were investigated. These plants were grown under long-day or short-day conditions. The size of leaves, flowers, and seeds of mutants and wild-type plants was measured when the organs being compared were at the same developmental stage. At least 30-50 plants per line were measured for each measurement and statistical treatment and the average value was taken.

[0055] 1.5 Vernalization and GA treatment

[0056] For GA treatment, long-day plants were sprayed with 20 μM GA twice a week until the first flower appeared. For vernalization treatment, Arabidopsis seeds were treated with 4 °C darkness for 6 weeks and then transferred to long-day growth conditions. At least 20 plants were measured for each measurement and statistical analysis and the average was taken. Statistical analysis was performed using one-way ANOVA ( * p<0.05; ** p<0.01; *** p<0.001).

[0057] 1.6 Total RNA extraction and qRT-PCR

[0058] In order to study the expression level of flowering-related genes, the present invention collected plants of 3 weeks and 4 weeks old. Plants were sampled only once, and plant tissues were collected after 4 hours of light exposure in the growth chamber. Total RNA was extracted with Trizol reagent and treated with RNase-free DNase I. qRT-PCR and semi-quantitative RT-PCR were performed using 500 ng of RNA synthesized from the first-strand cDNA as a template. The thermal cycle conditions were: 95°C 30s; 95°C 5s, 60°C 20s, 40 cycles; 95°C 15s, 65°C 15s, and the melting curve was detected. According to 2 -ΔΔCt Methods, Actin gene was used to normalize the relative transcription level. All primers used in qRT-PCR (AtFLC-F / R, AtFT-F / R, AtSOC1-F / R, AtLFY-F / R, AtVIN3-F / R, AtFRI-F / R, Actin-F / R) are listed in Table 1.

[0059] 1.7 Tissue-specific expression of BrOG37

[0060] The BrOG37 promoter sequence (2 kb) was cloned and constructed into the upstream of the GUS gene of the pCAMBIA 1305.1 vector. Arabidopsis was transformed by the floral dip method to obtain homozygous plants for GUS staining. The samples were collected in centrifuge tubes and placed in 90% acetone on ice for 15 minutes, then washed twice with staining buffer (50 mM sodium phosphate, pH 7.2, 0.2 mM K3Fe(CN)6, 0.2 mM K4Fe(CN)6 and 0.2% Triton X-100), then added with staining buffer containing a final concentration of 2 mM X-Gluc and cultured overnight at 37°C, then washed in 70% ethanol for 30 minutes, and finally observed under a laser confocal microscope.

[0061] 1.8 Cellular localization analysis of GFP fusion protein

[0062] The 35S-BrOG37-GFP transient expression vector was constructed using the GFP-containing pCAMBIA1302-GFP vector and the BrOG37 gene sequence. The vector construction primers BrOG37OE-F / R are shown in Table 1. The constructed plasmid was transformed into Agrobacterium competent GV3101 for subcellular localization experiments. Agrobacterium carrying 35S-BrOG37-GFP and YFP Marker plasmids were mixed into tobacco leaves by manual injection, and fluorescence was observed using a laser confocal microscope.

[0063] 1.9 Statistical analysis

[0064] The experiment was repeated at least 3 times. SPSS 19.0 software was used to analyze the data by t-test or one-way analysis of variance. The data are expressed as mean ± SE.

[0065] 2. Results

[0066] 2.1 BrOG37 sequence analysis results

[0067] BrOG37 is an intronless gene with a total length of 435 bp. After searching the NCBI-CDD (Conserved Domain Database) and Pfam databases, it was found that this gene has no structural domains; searching using the SignalP online website found that the BrOG37 protein has no signal peptides and splicing sites; the PlantTFDB database of plant transcription factors predicted that this gene does not belong to a transcription factor; and using the GPS (Group-based Prediction System) online server for prediction, it was found that this gene does not have kinase activity. The prediction results show that BrOG37 is a new gene with unknown function, which may act as a membrane receptor protein to transmit signals or substances, and its specific function needs to be further studied.

[0068] 2.2 BrOG37 delays bolting and flowering in Arabidopsis and expression analysis of key flowering genes

[0069] The results showed that the transgenic Arabidopsis thaliana plants BrOG37OE overexpressing BrOG37 under long-day conditions significantly delayed flowering time, with an average delay of 33 days (Table 2).

[0070] Table 2 Phenotypic data of BrOG37OE Arabidopsis plants

[0071] Phenotype WT B0G37OE Flowering time (days) 30.6±0.6 <![CDATA[63.3±1.5 *** ]]> Flowering time (number of rosette leaves) 16.2±0.5 <![CDATA[31.7±0.7 *** ]]> Rosette radius (mm) 89.9±2.1 <![CDATA[63.2±1.8 *** ]]> Stem height (cm) 48.3±3.0 49.8±3.7 Silique length (mm) 12.6±0.2 <![CDATA[5.4±0.2 *** ]]> Seeds / Siliques (pcs) 53.7±0.7 <![CDATA[14.1±1.0 *** ]]> Leaf length (mm) 30.6±3.1 <![CDATA[20.6±1.7 ** ]]>

[0072] Note: Measurements are mean ± SE of 18 plants per sample.

[0073] All leaves of BrOG37OE plants curled inwards. At the silique maturity stage, BrOG37OE plants were shorter than wild-type (WT) plants. Figure 1 The size of the flowers of BrOG37OE plants is not much different from that of WT, but the stamens of BrOG37OE plants are much larger than those of WT. The anthers at the top of the filaments of WT pistils are usually higher than the stigma, while the anthers at the top of the filaments of BrOG37OE plants are flush with the stigma or below the stigma. The number of floral organs (petals, stamens, and pistils) is the same as that of WT, see Figure 2 Further observation of the development of epidermal hairs on the rosette leaves of WT and BrOG37OE plants revealed no significant difference compared with WT, with 3-4 branches being the main features. Figure 3 .

[0074] To investigate whether delayed flowering time is associated with changes in the expression of flowering regulatory factors, qRT-PCR was used to compare the expression levels of flowering-related genes in leaves and shoot tips of Arabidopsis BrOG37OE-overexpressing plants and WT plants. Figure 4 . The analysis showed that the expression levels of key genes in the flowering pathway were consistent with the delayed flowering phenotype. In the leaves and stem tips of BrOG37OE plants, the expression of AtFT and AtSOC1 was significantly downregulated, and the expression of AtLFY in the mutant stem tips was similar to AtFT and AtSOC1, while the expression of AtLFY in BrOG37OE and WT leaves was not detected. In addition, AtFLC increased significantly by nearly 58 times and 13 times in leaves and stem tips compared with WT, respectively, and AtFRI and AtVIN3 of the vernalization pathway were significantly downregulated in the stem tips. It is speculated that BrOG37 may delay flowering by activating AtFLC transcription through the vernalization pathway.

[0075] 2.3 Response of BrOG37OE plants to vernalization and GA treatment

[0076] To test the response of BrOG37OE to vernalization, BrOG37OE seeds were germinated and grown at 4°C for 6 weeks before being transferred to normal temperature conditions. Vernalized BrOG37OE plants flowered much earlier than unvernalized plants, at about 34 days, with an average total rosette number of 10 leaves; unvernalized plants flowered at about 52 days. Unvernalized BrOG37OE plants had an average rosette number of 18 leaves, and vernalization also shortened the mutant's flowering time ( Figure 5 The inability of vernalization to fully restore flowering time may be due to two mechanisms by which vernalization promotes flowering: a FLC-dependent pathway and a FLC-independent pathway.

[0077] To analyze the effect of GA on flowering of mutants, plants were sprayed with 20 μM GA solution twice a week until flowering. Under GA treatment, WT and BrOG37OE plants flowered at 10-13 rosette leaves. The average number of days to flowering for BrOG37OE and WT plants was 41 and 30 days, respectively. The number of days to flowering for BrOG37OE plants and WT plants without GA treatment was 50 and 37 days, respectively, and the average number of rosette leaves was 18 and 13, respectively. Figure 6 ). The results showed that GA greatly stimulated flowering of BrOG37OE plants.

[0078] These observations suggest that BrOG37OE plants respond positively to both vernalization and GA. Because flowering of autonomous pathway mutants can be reversed by vernalization or GA, we speculate that BrOG37 may be involved in either the autonomous or vernalization pathway.

[0079] 2.4 Analysis of flowering time of BrOG37OE in LD and SD treatments

[0080] To determine whether the late flowering phenotype of Arabidopsis BrOG37OE plants is related to the photoperiod pathway, the flowering time of WT and BrOG37OE plants was measured under LD and SD conditions ( Figure 7 ). Under LD conditions, WT plants began to produce inflorescences around 34 days after sowing, while BrOG37OE plants began to produce inflorescences around 73 days after sowing. Under SD conditions, BrOG37OE plants flowered much later than WT plants. It is well known that delayed flowering plants form more rosette leaves when flowering. Whether under LD or SD conditions, the number of rosette leaves in BrOG37OE plants was about 23, and the number of rosette leaves in WT was about 16. Therefore, under both LD and SD conditions, BrOG37OE plants bolted and flowered later than WT, and had more total rosette leaves. This suggests that BrOG37OE is not involved in the photoperiod pathway of flowering control.

[0081] 2.5 Subcellular localization of BrOG37

[0082] In order to determine the subcellular localization of BrOG37, Agrobacterium carrying 35S-BrOG37-GFP and YFP Marker plasmids were mixed and injected into tobacco leaves, and fluorescence was observed using a laser confocal microscope. The distribution of fluorescence signals of the transiently expressed fusion protein in the cells showed that BrOG37 was localized on the cell membrane, as shown in Figure 2. Figure 8 Middle (A).

[0083] 2.6 Analysis of BrOG37 expression pattern

[0084] The BrOG37 promoter sequence (2 kb) was cloned and constructed into the upstream of the GUS gene of the pCAMBIA1305.1 vector, and the floral dipping method was used to transform Arabidopsis thaliana to obtain homozygous plants for GUS staining. The results showed that under the drive of the BrOG37 promoter, the GUS reporter gene was highly expressed in the stem tip, leaf veins, stamens, pistils and seeds, as shown in Figure 2. Figure 8 Middle (B).

[0085] 2.7 Expression analysis of BrOG37 in Chinese cabbage

[0086] Since the orphan gene BrOG37 showed obvious late bolting phenomenon in Arabidopsis, the present invention then observed the expression of BrOG37 in Chinese cabbage. The expression level of BrOG37 in bolting-resistant and bolting-intolerant Chinese cabbage varieties was analyzed. The Chinese cabbage inbred lines cultivated in the laboratory of the present invention are divided into two categories: bolting-resistant type (BR type) and bolting-intolerant type (BN type). The growing point of the Chinese cabbage of the bolting-resistant variety is a short stem dome, while the growing point of the Chinese cabbage of the bolting-intolerant variety is a long stem pointed top. 10 BR-type varieties and 10 BN-type varieties were selected, and the expression pattern of BrOG37 during the heading period was analyzed. The top of the growing point (GP) and the top of the inner leaf (TP) were compared, and TP was used as a control. Fig. 9 As shown in (a), the expression of BrOG37 was significantly increased in all materials of BR type, but was significantly downregulated in BN type. Fig. 9 These results further confirmed that BrOG37 is associated with the bolting resistance of Chinese cabbage.

[0087] The Chinese cabbage inbred line 'GT-24' was used as the material and treated with low temperature (4℃) to analyze the expression pattern of BrOG37. After treatment, the expression of BrOG37 was significantly downregulated compared with the control. The expression of BrFLC was also inhibited after vernalization of Chinese cabbage, which promoted the transition of Chinese cabbage from vegetative growth to reproductive growth. Fig. 9 Middle (c).

[0088] 2.8 Phenotypic identification and analysis of Chinese cabbage plants overexpressing GTOG37OE

[0089] PCR verification was performed on the T2 generation of Chinese cabbage GTOG37OE plants with BrOG37 overexpression, and 19 plants were found to be positive. Fig.10 (A); the expression level of BrOG37 gene in GT-24 and GTOG37OE plants was verified, and it was found that the expression level of BrOG37 gene in GTOG37OE plants was significantly increased, further verifying that GTOG37OE was a positive strain, see Fig.10 Middle (B).

[0090] To further understand the effect of the orphan gene BrOG37 on the phenotype of Chinese cabbage, the phenotypes of wild-type (GT-24) and GTOG37OE Chinese cabbage plants were investigated under vernalization and non-vernalization conditions. Fig.10 Middle (C). Regardless of vernalization or non-vernalization treatment, the bolting time and flowering time of GTOG37OE plants were later than those of GT-24 plants. The number of rosette leaves of GT-24 plants at flowering was more than that of GTOG37OE plants. The stem length and stalk length of GT-24 plants were longer than those of GTOG37OE plants, as shown in Figure 2. Fig.10 Middle (D).

[0091] In summary, the present invention has found that the BrOG37 gene can regulate the flowering time of Chinese cabbage. Preliminary experiments have found that the overexpressed transgenic Arabidopsis BrOG37OE plants have the most significant bolting resistance phenotype. The effect of this gene on bolting and flowering has also been verified in Chinese cabbage, and the Chinese cabbage overexpressing BrOG37 plant GTOG37OE also has a phenotype of delayed bolting and flowering. Arabidopsis BrOG37 overexpressing plants bloom late under long and short day conditions, and vernalization and gibberellins can promote their flowering. The present invention observed that compared with the leaves of the wild type, the leaves of the Arabidopsis BrOG37OE plants all curled inward. At the mature stage of the silique, the stamens of the flower organs of the BrOG37OE plants are much larger than those of the wild type. It is also found that the anthers at the top of the wild-type pistil filaments are usually higher than the stigma, while the anthers at the top of the filaments of the BrOG37OE plants are flush with the stigma or below the stigma. BrOG37 is ubiquitously expressed in Arabidopsis tissues and localized in the cell membrane.

[0092] The present invention clarifies the specific pathway of BrOG37's involvement in regulating the flowering of Chinese cabbage, opens up new ideas and new genes for regulating the flowering of Chinese cabbage, and is beneficial to the cultivation of new varieties of Chinese cabbage resources resistant to bolting.

[0093] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. An orphan gene for regulating the bolting and flowering time of Chinese cabbage, characterized in that: The orphan gene is the BrOG37 gene, and the nucleotide sequence of the BrOG37 gene is shown in SEQ ID NO.

1.

2. A recombinant expression vector, characterized in that: Comprising the orphan gene according to claim 1.

3. The recombinant expression vector according to claim 2, characterized in that The recombinant expression vector is the pCAMBIA1305 recombinant expression vector.

4. A recombinant microbial strain, characterized in that: Comprising the recombinant expression vector according to claim 2 or 3.

5. The recombinant microbial strain according to claim 4, characterized in that The recombinant microbial strain is a recombinant Agrobacterium.

6. Use of the orphan gene according to claim 1, the recombinant expression vector according to claim 2 or 3, or the recombinant microbial strain according to claim 4 or 5 in delaying the bolting and flowering time of Chinese cabbage.

7. The use according to claim 6, characterized in that: When the expression level of the orphan gene increases, the bolting and flowering time of the Chinese cabbage is delayed.

8. A method for delaying the bolting and flowering time of Chinese cabbage, characterized in that: The method comprises the steps of introducing the orphan gene of claim 1 into Chinese cabbage plants to construct a transgenic plant over-expressing the orphan gene.

Images