PCR-RFLP Identification Method for Six Phase Variants of the Streptococcus pneumoniae Type I Methylation Modification System
Through the primer set and restriction endonuclease combined with PCR-RFLP method, the accuracy and efficiency of the identification of six phase subtypes of Streptococcus pneumoniae type I methylation modification system were solved, and efficient and low-cost qualitative quantitative analysis was achieved.
Patent Information
- Application Number
- CN202410103179.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-24
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2044-01-24
AI Technical Summary
In the prior art, the six phase subtype identification methods of Streptococcus pneumoniae type I methylation modification system have characteristic band size differences too small, the equipment accuracy requirements are high, and the amplification primer cannot fully cover different subtypes, resulting in off-target false negative problems, making it difficult to achieve accurate, qualitative, and quantitative identification.
The primer set (including the primers shown in SEQ ID No: 1 to 4) and restriction endonucleases (AccI, HindIII, BstN I) combined with PCR-RFLP method were used to perform sample amplification and enzyme cleavage. Qualitative and quantitative analysis was performed through electrophoretic gel and gene-analyzer analysis tools to ensure that the size difference of the characteristic fragments of each subtype is above 100 bp.
The accurate identification of six phase subtypes of Streptococcus pneumoniae type I methylation modification system was achieved, especially when multiple subtypes exist in the sample, which is highly efficient and low-cost and is suitable for clinical promotion.
Smart Images

Figure BDA0004680792520000051 
Figure BDA0004680792520000061 
Figure BDA0004680792520000062
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly to a PCR-RFLP discrimination method for six phase variants of the type I methylation modification system of Streptococcus pneumoniae. Background Art
[0002] Streptococcus pneumoniae is a Gram-positive bacterium and one of the important pathogenic bacteria commonly found in clinical practice. In clinical settings, serotype is an important indicator for judging the virulence of Streptococcus pneumoniae. However, serotyping of Streptococcus pneumoniae is not sufficient to accurately determine the risks of high invasiveness and drug resistance in Streptococcus pneumoniae infections. The diagnostic method based on serotyping still has significant limitations in assisting clinical diagnosis.
[0003] In addition to the influence of serotyping on the pathogenicity and drug resistance of Streptococcus pneumoniae, the high genetic plasticity of Streptococcus pneumoniae also gives rise to phenotypic diversity, which is one of the important factors affecting its clinical infection and treatment. Among them, the DNA methylation system, especially the restriction and modification system (RM system), has a significant impact on the virulence, pathogenicity, and drug resistance of Streptococcus pneumoniae. The RM system of Streptococcus pneumoniae is involved in genome regulation and plays a crucial role in physiological and biochemical activities (such as regulating virulence, antibiotic resistance, environmental adaptability, etc.). Studies have found that the type I RM system of Streptococcus pneumoniae is one of the most conserved methylation typing methods. The Streptococcus pneumoniae genome generates six methylation typing methods (spnIII hsdSA, spnIII hsdSB, spnIII hsdSC, spnIII hsdSD, spnIII hsdSE, spnIII hsdSF) through phase variation. Different methylation sites can affect the expression of different genes, ultimately resulting in the same genotype of strains showing different physiological and biochemical phenotypes. This phase change can cause changes in the phenotypes of strains, and the most characteristic one is the change in colony transparency. Opaque strains are more conducive to colonization, while transparent colony strains are more virulent. Multiple typing methods can coexist within a single colony of Streptococcus pneumoniae of the same serotype, resulting in differential gene expression, which can further affect its pathogenicity and drug resistance, etc., further exacerbating the difficulty of clinical testing.
[0004] In related technologies, the methods for differentiating different hsdSx within Streptococcus pneumoniae communities mostly have problems such as the difference in the sizes of characteristic bands being too small (less than 20 bp), which requires too high precision of the testing equipment; or the amplification primers being single, unable to fully cover the amplification requirements of different subtypes, resulting in off-target false negatives. Therefore, there is an urgent need to provide a method that can accurately, in real time, qualitatively, and quantitatively differentiate different hsdSx within Streptococcus pneumoniae communities. Summary of the Invention
[0005] The present invention aims to solve at least one of the technical problems existing in the prior art. For this purpose, the present invention provides a reagent combination for differentiating or assisting in differentiating six phase variants of the type I methylation modification system of Streptococcus pneumoniae, which can be used to effectively distinguish six phase variants of the type I methylation modification system of Streptococcus pneumoniae.
[0006] The present invention also provides the application of the above reagent combination in the preparation of a product for differentiating or assisting in differentiating six phase variants of the type I methylation modification system of Streptococcus pneumoniae.
[0007] The present invention also provides a product comprising the above reagent combination.
[0008] The present invention also provides a method for differentiating or assisting in differentiating six phase variants of the type I methylation modification system of Streptococcus pneumoniae.
[0009] The present invention also provides the application of the above reagent combination, product, or method in differentiating or assisting in differentiating six phase variants of the type I methylation modification system of Streptococcus pneumoniae.
[0010] The reagent combination for differentiating or assisting in differentiating six phase variants of the type I methylation modification system of Streptococcus pneumoniae according to the first aspect embodiment of the present invention comprises:
[0011] A primer set comprising primers with nucleotide sequences as shown in SEQ ID No: 1 to 4;
[0012] Restriction endonucleases, including AccI, HindIII, and BstN I.
[0013] The reagent combination according to the embodiment of the present invention has at least the following beneficial effects:
[0014] The reagent combination of the embodiment realizes relevant detection based on the PCR-RLFP (PCR-restriction fragment length polymorphism) method. Using one PCR forward primer and three PCR reverse primers, it can simultaneously amplify different hsdS subtype gene sequences in the sample. Combining with the specific triple enzyme digestion of HindIII, AccI, and BstNI, it can obtain the hsdS characteristic fragments of each subtype, and the size difference of the characteristic fragments between different subtypes is more than 100bp, which is conducive to qualitative and quantitative analysis by electrophoresis gel and gene-analyzer analysis tools. The present invention is beneficial to accurately identify the phase subtypes of the type I restriction modification system of Streptococcus pneumoniae clinically at the DNA level. Especially when multiple subtypes exist in the sample simultaneously, the present invention can identify multiple subtypes simultaneously, with higher efficiency and lower cost, and is suitable for clinical promotion and use.
[0015] Use of the above reagent combination according to the embodiment of the second aspect of the present invention in the preparation of a product for identifying or assisting in the identification of six phase subtypes of the type I methylation modification system of Streptococcus pneumoniae.
[0016] The product according to the embodiment of the third aspect of the present invention includes the above reagent combination.
[0017] According to some embodiments of the present invention, the product is selected from a kit.
[0018] According to some embodiments of the present invention, the product further includes at least one of DNA extraction reagent, PCR amplification reagent, enzyme digestion reaction reagent, and electrophoresis reagent.
[0019] According to some embodiments of the present invention, the PCR amplification reagent includes deionized water and / or PCR Mix.
[0020] According to some embodiments of the present invention, the enzyme digestion reaction reagent includes nuclease-free deionized water and / or enzyme digestion buffer.
[0021] According to some embodiments of the present invention, the electrophoresis reagent includes agarose.
[0022] A method for identifying or assisting in the identification of six phase subtypes of the type I methylation modification system of Streptococcus pneumoniae according to the embodiment of the fourth aspect of the present invention includes the following steps:
[0023] S1. Perform PCR amplification on the sample to be tested using the above primer set, purify the PCR amplification product, and obtain the purified PCR amplification product;
[0024] The sample to be tested contains the genome of Streptococcus pneumoniae;
[0025] S2. Use the above-mentioned restriction enzyme to digest the purified PCR amplification product, and identify or assist in identifying six phase subtypes of the pneumococcal type I methylation modification system according to the size of the digested fragments.
[0026] According to some embodiments of the present invention, the method for purifying the PCR amplification product includes, but is not limited to, the phenol / chloroform method, the silica gel chromatography column method, the magnetic bead method, or the agarose gel purification method.
[0027] According to some embodiments of the present invention, the annealing temperature used for the PCR amplification is 53°C to 57°C.
[0028] According to some embodiments of the present invention, the amplification program for the PCR amplification is: pre-denaturation at 94°C for 6 min; denaturation at 94°C for 30 s, annealing at 55°C for 90 s, extension at 72°C for 30 s, for 32 cycles; extension at 72°C for 10 min.
[0029] According to some embodiments of the present invention, the method for the digestion includes the steps shown in A1) or A2):
[0030] A1) After the purified PCR amplification product is digested with AccI and HindIII, it is then digested with BstN I.
[0031] A2) The purified PCR amplification product is digested with AccI, HindIII, and BstN I in a triple digestion.
[0032] According to some embodiments of the present invention, in the method of A1), the conditions for the AccI and HindIII digestions are: the digestion temperature is 37°C, and the digestion time is 5 to 30 min;
[0033] And / or, the conditions for the BstN I digestion are: the digestion temperature is 37°C to 60°C, and the digestion time is 10 min to 60 min. For example: it can be 5 min, 10 min, 15 min, 20 min, 25 min, or 30 min.
[0034] According to some embodiments of the present invention, in the method of A2), the conditions for the triple digestion are: the digestion temperature is 37°C, and the digestion time is 30 min to 60 min.
[0035] According to some embodiments of the present invention, the basis for the identification or assisted identification in step S2 includes:
[0036] When a digested fragment with a molecular weight of 800 - 825 bp is identified, it means that hsdSA exists;
[0037] When a digested fragment with a molecular weight of 1050 - 1080 bp is identified, it means that hsdSB exists;
[0038] The digested fragment with a molecular weight of 1520 - 1580 bp was identified, indicating the presence of hsdSC;
[0039] The digested fragment with a molecular weight of 1280 - 1320 bp was identified, indicating the presence of hsdSD;
[0040] The digested fragment with a molecular weight of 900 - 960 bp was identified, indicating the presence of hsdSE;
[0041] The digested fragment with a molecular weight of 1400 - 1450 bp was identified, indicating the presence of hsdSF.
[0042] According to some embodiments of the present invention, the basis for identification or auxiliary identification in step S2 includes:
[0043] The digested fragment with a molecular weight of 812 bp was identified, indicating the presence of hsdSA;
[0044] The digested fragment with a molecular weight of 1069 bp was identified, indicating the presence of hsdSB;
[0045] The digested fragment with a molecular weight of 1551 bp was identified, indicating the presence of hsdSC;
[0046] The digested fragment with a molecular weight of 1294 bp was identified, indicating the presence of hsdSD;
[0047] The digested fragment with a molecular weight of 940 bp was identified, indicating the presence of hsdSE;
[0048] The digested fragment with a molecular weight of 1422 bp was identified, indicating the presence of hsdSF.
[0049] Use of the above reagent combination, the above product or the above method according to the embodiments of the fifth aspect of the present invention in identifying or auxiliary identifying six phase subtypes of the type I methylation modification system of Streptococcus pneumoniae, and said use does not belong to the methods of disease diagnosis and treatment.
[0050] Other features and advantages of the present invention will be described in the subsequent description, and, in part, will be obvious from the description, or will be understood by implementing the present invention. Brief Description of the Drawings
[0051] Figure 1 Schematic diagram of phase inversion of the type I methylation modification system of Streptococcus pneumoniae; A. The type I methylation modification system-encoding genes consist of hsdS (hsdS, hsdS' and hsdS'), hsdM and hsdR, and the creX gene is involved in the phase inversion of hsdS; B. Schematic diagram of six hsdS subtypes; C. Schematic diagram of motifs of six hsdS subtypes involved in the methylation modification system;
[0052] Figure 2 Schematic diagram of DNA gel electrophoresis of PCR-RFLP characteristic fragments of six hsdS subtypes;
[0053] Figure 3 Differential results of methylation typing of Streptococcus pneumoniae S.pneumoniae D39;
[0054] Figure 4 Differential results of typing of PCR-RFLP products of DNA sequences (spnIII hsdSA(A), spnIII hsdSB(B), spnIII hsdSC(C), spnIII hsdSD(D), spnIII hsdSE(E), spnIII hsdSF(F)) of methylation typing with single-phase variation;
[0055] Figure 5 Differential results of typing of methylation subtypes of 20 clinical Streptococcus pneumoniae samples; among them, D refers to the hsdSD-locked mutant strain of Streptococcus pneumoniae; F refers to the hsdSF-locked mutant strain of Streptococcus pneumoniae; AC refers to the hsdS knockout mutant strain of Streptococcus pneumoniae; D39 refers to the standard strain of Streptococcus pneumoniae S.pneumoniae D39; a-f respectively refer to six standard gene fragments of hsdSA to hsdSF; Mix refers to an equimolar mixture of six standard gene fragments of hsdSA to hsdSF. Detailed implementation mode
[0056] The concept and technical effects of the present invention will be clearly and completely described below in combination with embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative efforts belong to the scope of protection of the present invention.
[0057] For those not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. For reagents or instruments not specified by the manufacturer, they are all conventional products that can be obtained through commercial purchase.
[0058] In the description of the present invention, the terms "include" and "have" and any variations thereof are intended to cover non-exclusive inclusion. For example, a process, method, system, product or device including a series of steps or units does not necessarily limit to those clearly listed steps or units, but may include other steps or units not clearly listed or inherent to these processes, methods, products or devices.
[0059] When a numerical range is disclosed herein, the above range is considered continuous and includes the minimum and maximum values of the range, as well as every value therebetween. Further, when the range refers to integers, every integer between the minimum and maximum values of the range is included. In addition, when multiple ranges are provided to describe features or characteristics, the ranges may be combined. In other words, unless otherwise specified, all ranges disclosed herein should be understood to include any and all sub-ranges subsumed therein.
[0060] Unless otherwise specified, "about" in the present invention means an allowable error within ±15%.
[0061] In the following examples, the typing sequences of the type I methylation subtypes with single-phase changes are synthesized according to their respective arrangements. The arrangements are as Figure 1 shown.
[0062] Example 1
[0063] This example provides a kit for identifying or assisting in the identification of six phase subtypes of the Streptococcus pneumoniae type I methylation modification system based on PCR-RFLP, which consists of a primer set and endonucleases;
[0064] The primer set contains the following primers:
[0065] HsdSA_F_Fw: agttgttggaggacaaataatgacaccagaacaacttaa (SEQ ID No:1);
[0066] HsdSA_D_Rv: tgagaatattttatatttttgttcatctaaattagtgcgtcaatatg (SEQ ID No:2);
[0067] HsdSB_C_Rv: tgagaatattttatatttttgttcatttactcaaaaagttgagaaactt (SEQ IDNo:3);
[0068] HsdSE_F_Rv: tgagaatattttatatttttgttcattcaaagttgatttactttttca (SEQ IDNo:4).
[0069] The endonucleases contain AccI, HindIII and BstN I.
[0070] This example also provides a PCR-RFLP identification method for six phase subtypes of the Streptococcus pneumoniae type I methylation modification system implemented based on the above kit. The steps are as follows:
[0071] S1. Using the Streptococcus pneumoniae obtained from blood culture as a template, perform colony PCR amplification to obtain a PCR amplification product; using the PCR amplification product as a substrate, perform electrophoresis-gel recovery (0.8 w / v% agarose gel; electrophoresis conditions: 110 V, run for about 30 min until the dye band runs to 2 / 3 of the gel) to obtain the purified PCR amplification product.
[0072] The system for colony PCR amplification (total volume 50 μL) is shown in Table 1.
[0073] Table 1
[0074]
[0075]
[0076] Among them, the template can be DNA (working concentration > 0.8 ng / μL), colony or biological / clinical sample; when using colony or biological / clinical sample as the template, the colony or biological / clinical sample can be fully shaken and mixed in sterile water and then used for detection.
[0077] The PCR amplification program is: pre-denaturation at 94°C for 6 min; denaturation at 94°C for 30 s, annealing at 55°C for 90 s, extension at 72°C for 30 s, 32 cycles; extension at 72°C for 10 min.
[0078] HsdSA_F_Fw and HsdSA_D_Rv are expected to amplify 1 DNA band with a size of about 1600 bp; primers HsdSA_F_Fw and HsdSB_C_Rv are expected to amplify 1 DNA band with a size of about 1600 bp; primers HsdSA_F_Fw and HsdSE_F_Rv are expected to amplify 1 DNA band with a size of about 1600 bp.
[0079] S2. Use restriction enzymes AccI, HindIII-HF and BstN I to perform triple digestion on the purified PCR amplification product to obtain a PCR-RFLP product, and perform electrophoresis on the PCR-RFLP product (1 w / v% agarose gel; electrophoresis conditions: 110 V, run for 30 min - 1 h) to analyze the band size and confirm the typing of the phase change.
[0080] The digestion system is shown in Table 2.
[0081] Table 2
[0082]
[0083] The digestion steps are as follows:
[0084] S21. Mix the purified PCR amplification product, AccI, HindIII, 10×rCutSmart Buffer, and nuclease-free water according to the enzyme digestion system shown in Table 2, and react at 37°C for 5 - 15 min;
[0085] S22. Add 1 μL of BstN I to the enzyme digestion system, react at 60°C for 5 - 15 min, and terminate the enzyme digestion reaction.
[0086] The gene sequence length of the type I RM system of Streptococcus pneumoniae undergoing phase variation is approximately 1.6 kp. After triple enzyme digestion with endonucleases AccI, HindIII, and BstN I, each typing sequence has a characteristic fragment length, and the intervals between the fragments are greater than 100 bp. It can be distinguished by conventional DNA electrophoresis gel, and the phase variation typing characteristics in the sample can be judged by combining the fragment lengths. The specific typing basis is shown in Table 3. The schematic diagram of the electrophoresis of the characteristic bands after enzyme digestion is as Figure 2 shown.
[0087] Table 3
[0088] Subtyping Size of characteristic band after restriction digestion (bp) hsdSA 812 hsdSB 1069 hsdSC 1551 hsdSD 1294 hsdSE 940 hsdSF 1422
[0089] This example also provides a PCR-RFLP quantitative analysis method for six phase subtypes of the type I methylation modification system of Streptococcus pneumoniae, including steps A1 - A3, where steps A1 - A2 are the same as steps S1 - S2 of the PCR-RFLP identification method for six phase subtypes of the type I methylation modification system of Streptococcus pneumoniae above. Step A3 is specifically as follows:
[0090] A3. According to the instructions, mix the PCR-RFLP product with Agilent tapestation D1000 reagent (product number: 5067-5602), place it in the loading slot, and place the D1000 screen tape (product number: 5067-5582) according to the instructions of the Tapestation gene analyzer (Agilent4150) instrument, and process and analyze the data.
[0091] Comparative Example 1
[0092] This example provides a kit for identifying or assisting in the identification of six phase subtypes of the pneumococcal type I methylation modification system based on PCR-RFLP (referenced from the literature "De Ste Croix M, Chen K Y, Vacca I et al. spnIII Recombination of the Phase-Variable Locus Is Independent of All Known Pneumococcal Site-Specific Recombinases. [J]. J Bacteriol, 2019, 201: undefined."), which consists of a primer set and restriction enzymes;
[0093] The primer set contains the following primers:
[0094] [6-FAM]-AMRE74L: FAM-GGAAACTGAGATATTTCGTGGTGATGATGGGA;
[0095] AMRE59: CCTGATCGAGCGGAAGAATATTTCTGCCGAGGTTGCC.
[0096] The restriction enzymes contain DraI and PleI.
[0097] This example also provides a PCR-RFLP identification method for six phase subtypes of the pneumococcal type I methylation modification system implemented based on the above kit, and the steps are as follows:
[0098] S1. Extract the genome of pneumococcal monoclonal, perform PCR amplification on the genome using [6-FAM]-AMRE74L and AMRE59, and obtain a PCR product with a size of approximately 4.2 kb through agarose gel purification.
[0099] The PCR amplification system is shown in Table 4.
[0100] Table 4
[0101] Component Dosage [6-FAM]-AMRE74L (10 mM) 0.75 μL AMRE59 (10 mM) 0.75 μL Template 1 μL 11.1× buffer 2.25 μL Tris (pH 8.8) 0.15 μL Kapa Taq (5 U / μL) 0.2 μL Pfu (2.5 U / μL) 0.05 μL Sterile water 19.85 μL
[0102] The PCR amplification program is: pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 1 min, annealing at 68 °C for 1 min, extension at 68 °C for 5 min, 40 cycles; extension at 68 °C for 10 min.
[0103] S2. Double digest the purified PCR amplification product with restriction enzymes DraI and PleI (20 μL digestion system, including 10 - 15 μL purified PCR amplification product, 1×CutSmart buffer, 1U DraI and 2U PleI, supplemented with sterile water to 20 μL) to obtain the PCR-RFLP product, and perform electrophoresis on the PCR-RFLP product to analyze the band size and confirm the typing of phase variation.
[0104] The expected characteristic band sizes of the six subtypes after digestion are: hsdSA is 1186 bp, hsdSB is 1109 bp, hsdSC is 1090 bp, hsdSD is 1167 bp, hsdSE is 1052 bp, and hsdSF is 1032 bp.
[0105] Detection Example 1
[0106] In this example, the DNA sequences of methylation typing with single phase variation (spnIII hsdSA, spnIII hsdSB, spnIII hsdSC, spnIII hsdSD, spnIII hsdSE, spnIII hsdSF) and the mixed DNA (Mixed Reference) of the DNA sequences of the six methylation typings were used as reference sequences, and the genomes of Streptococcus pneumoniae S.pneumoniae D39 and SP D39ΔcreX (CreX is an important element mediating the phase variation of the HsdSX subtype, and SP D39ΔcreX is a mutant strain of S.pneumoniae D39 after knocking out creX and hsdSX) were used as experimental samples to detect the distribution characteristics of methylation subtypes of phase variation in a single strain of S.pneumoniae D39 (SPD39). The method specifically refers to the PCR-RFLP identification method described in Example 1.
[0107] The detection results are as Figure 3 shown.
[0108] S.pneumoniae D39 contains two methylation subtypes of phase variation, namely hsdSD and hsdSF. It can be seen from the brightness of the electrophoresis bands that the proportion of the hsdSF methylation subtype in the monoclonal of this S.pneumoniae D39 strain is relatively high, significantly higher than that of the hsdSD methylation subtype. Analyze the whole genome sequence of the monoclonal sample of this S.pneumoniae D39 strain by nanopore third-generation sequencing and perform splicing alignment. Due to the limitation of DNA sequence splicing alignment, only the sequence with the highest proportion in the non-single sequence can be presented. The results show that the type I methylation subtype in the monoclonal of the D39 strain is hsdSF, which is relatively consistent with the above analysis results.
[0109] After knocking out CreX, the methylation subtype of SP D39ΔcreX is hsdSD, rather than the wild-type subtype hsdSF.
[0110] It can be seen that the PCR-RFLP identification method in Example 1 can accurately and comprehensively analyze and identify the subtypes of type I methylation modification of Streptococcus pneumoniae. Compared with traditional sequencing methods, it can not only detect multiple subtypes in monoclonal simultaneously, but also perform effective qualitative and quantitative analysis, and can identify the composition ratio of different subtypes in monoclonal under specific culture / growth environments.
[0111] Detection Example 2
[0112] In this example, referring to the PCR-RFLP quantitative analysis method for six phase subtypes of the type I methylation modification system of Streptococcus pneumoniae recorded in Example 1, according to the instrument instructions of Tapestation gene analyzer (Agilent 4150), the PCR-RFLP products of the DNA sequences of single-phase changes in methylation typing (spnIII hsdSA, spnIII hsdSB, spnIII hsdSC, spnIII hsdSD, spnIII hsdSE, spnIII hsdSF) or their mixtures (mixing single-phase change subtypes in different proportions) were analyzed.
[0113] The analysis results are as Figure 4 shown in Table 4.
[0114] Table 4
[0115]
[0116]
[0117] Note: A refers to the DNA sequence containing spnIII hsdSA, B refers to the DNA sequence containing spnIII hsdSB, C refers to the DNA sequence containing spnIII hsdSC, D refers to the DNA sequence containing spnIII hsdSD, E refers to the DNA sequence containing spnIII hsdSE, and F refers to the DNA sequence containing spnIII hsdSF. Loading concentration: is the concentration of total DNA in the sample. Fragment detection concentration: is the sample concentration of the corresponding fragment detected by tapestation, calculated jointly by the peak area integration of this fragment and the size of this fragment. Fragment percentage: is the content of the corresponding fragment detected by tapestation in the six fragments A - F contained in the sample (total percentage is 100%); the fragment percentage detected in the sample is calculated jointly by the fragment concentration, the standard fragment concentration, and the sample loading concentration.
[0118]
[0119] Among them, C A(A:B) refers to the detected concentration of A in sample A:B; C B(A:B) refers to the detected concentration of B in sample A:B; C A:B refers to the sum of the detected concentrations of A and B in sample A:B; C A(MIX) refers to the detected concentration of A in sample MIX (sample MIX is used for calibration); C B(MiX) refers to the detected concentration of B in sample MIX.
[0120] Under the simulated mixing state, the concentration ratios of each subtype detected are consistent with the sample mixing concentration ratios. This indicates that the discrimination method in Example 1 has good reliability in qualitative and quantitative analysis.
[0121] Detection Example 3
[0122] In this example, 20 clinical Streptococcus pneumoniae samples (numbered 1, 2, 3, 9, 10, 12, 13, 14, 16, 17, 18, 19, 20, 21, 22, 23, 24, 26, 27, 28) were randomly selected, genomic DNA was extracted respectively, and referring to the PCR-RFLP quantitative analysis method for six phase subtypes of the Streptococcus pneumoniae type I methylation modification system recorded in Example 1, with the DNA fragment of a single subtype as the reference standard, qualitative and quantitative analysis of the methylation subtypes of the above-mentioned clinical Streptococcus pneumoniae samples was carried out.
[0123] The analysis results of the digested fragments are as Figure 5 shown. The gene-analyzer fragment analysis results are shown in Table 5.
[0124] Most of the clinical Streptococcus pneumoniae samples have 1 or more hsdS subtypes; among them, 15 clinical strains have the hsdSA subtype, 14 strains have the hsdSD subtype, while the hsdSE subtype and hsdSF subtype were not detected.
[0125] In addition, according to the splicing results of the second-generation sequencing data of these 20 clinical Streptococcus pneumoniae samples, only one hsdS subtype can be obtained; among them, 1 sample did not sequence and splice out the hsdS subtype gene cluster typing information, 6 clinical Streptococcus pneumoniae samples' sequencing data showed one subtype in the PCR-RFLP detection results, and the subtypes obtained from the second-generation sequencing results of another 13 strains did not match the PCR-RFLP results. Based on the results of the second-generation sequencing data analysis, the hsdS subtype information of Streptococcus pneumoniae cannot be accurately and comprehensively presented, and it is difficult to provide the composition ratios of different subtypes. And the method of the present disclosure can accurately perform qualitative and quantitative analysis on the hsdS subtype.
[0126] Table 5
[0127]
[0128]
[0129] Note: The sample concentration is the concentration of the PCR-RFLP product.
[0130] When using clinical samples BALF-Sp-663, BALF-Sp-19, BALF-Sp-62, BALF-Sp-732, BALF-Sp-673, BALF-Sp-709, BALF-Sp-134, BALF-Sp-682, BALF-Sp-449 as the detection objects (the genomic concentration for PCR amplification ≥ 10 ng / μL) and detecting them by using the PCR-RFLP quantitative analysis method for six phase subtypes of the Streptococcus pneumoniae type I methylation modification system described in Comparative Example 1, a usable fragment of approximately 4.2 kb in size cannot be amplified. This indicates that the amplification efficiency of the primer set in Comparative Example 1 is lower than that in Example 1. Moreover, the sizes of multiple digested fragments of the primer set in Comparative Example 1 only differ by about 20 bp, making it difficult to directly distinguish them.
[0131] The embodiments of the present invention have been described in detail above in combination with the examples. However, the present invention is not limited to the above embodiments, and various changes can be made without departing from the gist of the present invention within the knowledge scope of those of ordinary skill in the art.
Claims
1. A reagent combination for identifying or assisting in identifying six phase subtypes of the pneumococcal type I methylation modification system, characterized in that, Comprising: A primer set, including primers with nucleotide sequences as shown in SEQ ID No: 1 to 4; Restriction endonucleases, including AccI, HindIII, and BstN I.
2. Use of the reagent combination according to claim 1 in the preparation of a product for identifying or assisting in the identification of six phase subtypes of the pneumococcal type I methylation modification system.
3. A product, characterized in that, The product includes the reagent combination according to claim 1.
4. The product according to claim 3, wherein The product further includes at least one of DNA extraction reagent, PCR amplification reagent, restriction enzyme digestion reagent, and electrophoresis reagent.
5. A method for differentiating or assisting in differentiating six phase subtypes of the pneumococcal type I methylation modification system for non-diagnostic purposes, characterized in that, Comprising the following steps: S1. Perform PCR amplification on a test sample using the primer set described in claim 1, and purify the PCR amplification product to obtain the purified PCR amplification product; The test sample contains the genome of Streptococcus pneumoniae; S2. Digest the purified PCR amplification product with the endonuclease described in claim 1, and identify or assist in the identification of six phase subtypes of the pneumococcal type I methylation modification system according to the sizes of the digested fragments.
6. The method according to claim 5, characterized in that, The annealing temperature used for the PCR amplification is 53°C to 57°C.
7. The method according to claim 6, wherein The amplification program for the PCR amplification is: pre-denaturation at 94°C for 6 min; denaturation at 94°C for 30 s, annealing at 55°C for 90 s, extension at 72°C for 30 s, for 32 cycles; extension at 72°C for 10 min.
8. The method according to claim 5, characterized in that, The method for the restriction enzyme digestion includes the steps shown in A1) or A2): A1) After the purified PCR amplification product is digested with AccI and HindIII, it is then digested with BstN I; A2) The purified PCR amplification product is digested with AccI, HindIII, and BstN I in a triple digestion.
9. The method according to claim 8, wherein In A1), the conditions for the AccI and HindIII digestions are: digestion temperature is 37°C, digestion time is 5 to 30 min; And, the conditions for the BstN I digestion are: digestion temperature is 37°C to 60°C, digestion time is 10 min to 60 min.
10. The method according to claim 8, characterized in that In A2), the conditions for the triple digestion are: digestion temperature is 37°C, digestion time is 30 min to 60 min.
11. Use of the reagent combination according to claim 1, the product according to claim 3 or 4, or the method according to any one of claims 5 to 10 in the identification or assistance in the identification of six phase subtypes of the pneumococcal type I methylation modification system, and the use does not belong to a disease diagnosis and treatment method.
Citation Information
Patent Citations
MNP marker combination of streptococcus pneumoniae, primer pair combination, kit and application of MNP marker combination and primer pair combination
CN114277164A
Primer probe group for detecting streptococcus pneumoniae and detection kit thereof
CN116479149A