Application of Corydalis in the preparation of preparations against porcine Seneca virus

Abstract

The present invention provides a use of Corydalis for preparing a product for preventing and / or treating SVA infection; in another aspect, the present invention also provides a product for preventing and / or treating SVA infection, wherein the product contains Corydalis at a pharmacologically effective concentration. The present invention provides the use of Corydalis in preparing a preparation for preventing and / or treating SVA infection. Corydalis has a very significant effect on preventing SVA infection, can reduce cell infection caused by SVA, and inhibit the adsorption, endocytosis, replication, assembly and release stages of SVA, providing a scientific and reliable theoretical basis for the clinical treatment of swine Seneca virus disease.

Description

Technical Field

[0001] The invention belongs to the technical field of antiviral preparation preparation, and particularly relates to the application of corydaline in the preparation of preparations against porcine Seneca virus. Background Art

[0002] Senecavirus A (SVA), formerly known as Seneca Valley virus (SVV), is the only member of the genus Seneca Valley virus in the family Picornaviridae. Senecavirus is a positive-sense single-stranded RNA virus that does not have an envelope. It is a spherical virus particle with a diameter range of 26-30nm and icosahedral symmetry. The main symptoms of swine Senecavirus disease caused by Senecavirus A SVA are vesicular lesions, blisters and ulcers appear on the skin or mucous membranes of the nose, snout and hoof crown of the sick pigs, and in severe cases, it can cause acute death of newborn piglets. Clinically, the disease is difficult to distinguish from swine foot-and-mouth disease, vesicular stomatitis, and infectious vesicular disease of swine. It can only be identified by laboratory means, which is easy to cause panic in pig farming companies. The virus has spread widely around the world, affecting major pig farming countries such as the United States, Canada, and Thailand.

[0003] As a new swine epidemic, there is no effective technical means to prevent and control the porcine Seneca virus disease caused by SVA. Commercial vaccines and antibodies are still in the development stage, and few teams have reported on drug development. In addition, SVA has been constantly evolving in recent years, and its strains frequently show genomic mutations and recombination, further hindering the development of effective vaccines. In animal disease prevention and control, chemical drugs are easy to use, low-cost, and effective. They can be used in combination with vaccines to prevent the occurrence of diseases. Therefore, the timely development of drugs with SVA antagonistic activity is of great research significance for the prevention and control of SVA. Summary of the invention

[0004] The object of the present invention is to provide the use of Corydalis in the preparation of an anti-SVA preparation, thereby being able to effectively prevent and treat SVA disease.

[0005] The present invention first provides a use of Corydalis for preparing a product for preventing and / or treating SVA infection;

[0006] In yet another aspect, the present invention provides a preparation for preventing and / or treating SVA infection, wherein the preparation contains corydaline at a pharmacologically effective concentration;

[0007] Preferably, the preparation is a liquid preparation;

[0008] Furthermore, the liquid preparation is PBS buffer or DMSO.

[0009] Preferably, the concentration of the PBS buffer is 0.05-0.15 mol / L.

[0010] Preferably, the concentration of the PBS buffer is 0.08-0.12 mol / L.

[0011] The pharmacologically effective concentration, as specifically described in some embodiments, is 10 to 100 μmol / L.

[0012] Preferably, the concentration of corydaline in the preparation is 20 to 80 μmol / L.

[0013] Preferably, the concentration of corydaline in the preparation is 40-60 μmol / L.

[0014] The present invention provides the use of corydaline in preparing a preparation for preventing and / or treating SVA infection. Corydaline has a very significant anti-SVA infection effect, can reduce cell infection caused by SVA, and inhibit the adsorption, cellular entry, replication, assembly and release stages of SVA, thus providing a scientific and reliable theoretical basis for the clinical treatment of swine Seneca virus disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Photographs showing the effect of Corydalis on the infection efficiency of BSR cells infected with SVA were observed under a fluorescence microscope.

[0016] Figure 2 The effect of Corydalis on SVA infection in BSR cells; A is the effect of Corydalis on SVA infection in BSR cells determined by Western blot; B is the effect of Corydalis on SVA infection in BSR cells determined by TCID50; C is the effect of Corydalis on SVA infection in BSR cells determined by fluorescent quantitative RT-PCR;

[0017] Figure 3 This is a diagram of the effect of corydaline on SVA adsorption on BSR cells measured by fluorescence quantitative RT-PCR;

[0018] Figure 4 Figure 1 is the effect of Corydalis on the intracellular incorporation of SVA in BSR cells; A is the effect of Corydalis on the intracellular incorporation of SVA in BSR cells determined by Western blot; B is the effect of Corydalis on the intracellular incorporation of SVA in BSR cells determined by fluorescence quantitative RT-PCR;

[0019] Figure 5Figure 1 is the effect of Corydalis on SVA replication in BSR cells; A is the effect of Corydalis on SVA replication in BSR cells determined by Western blot; B is the effect of Corydalis on SVA replication in BSR cells determined by TCID50; C is the effect of Corydalis on SVA replication in BSR cells determined by fluorescent quantitative RT-PCR;

[0020] Figure 6 The figure shows the effect of corydaline on the assembly and release of SVA in BSR cells; wherein A is the effect of corydaline on the release of SVA determined by TCID50, and B is the effect of corydaline on the assembly of SVA in BSR cells determined by fluorescence quantitative RT-PCR. DETAILED DESCRIPTION

[0021] The corydaline used in the present invention is an alkaloid substance extracted from the dried whole herb with roots of Corydalis bukiensis. It is derived from a natural product, has little environmental pollution after being metabolized by an animal body, and has no toxic side effects on animals. The present invention has no special requirements on the source of the corydaline used, and can use a conventional commercial product in the art or prepare it by itself.

[0022] The present invention also provides a preparation for preventing and / or treating SVA infection, wherein the concentration of corydaline in the preparation is 10 to 100 μmol / L, preferably 20 to 80 μmol / L, more preferably 40 to 60 μmol / L, and most preferably 50 μmol / L. In the present invention, the drug is preferably a liquid preparation, and the solvent of the drug is preferably PBS buffer or DMSO; when the solvent is PBS buffer, the concentration of the PBS buffer is preferably 0.05 to 0.15 mol / L, more preferably 0.08 to 0.12 mol / L, and most preferably 0.1 mol / L.

[0023] In the present invention, the drug is preferably obtained by dissolving the corydaline in a solvent.

[0024] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0025] Example 1

[0026] In this example, two kinds of Corydalis preparations were prepared, one of which was obtained by dissolving Corydalis in 0.1 mol / L PBS buffer, and the concentration of Corydalis was 10 mmol / L.

[0027] Another preparation is obtained by dissolving corydaline in DMSO, and the concentration of corydaline is 10mmol / L.

[0028] To verify the effect of Corydalis on the infection efficiency caused by SVA, the specific experimental method is as follows:

[0029] The trypsin-digested BSR cells were diluted with a nutrient solution containing 10% fetal bovine serum and counted according to 5×10 5 The cells were plated in a six-well plate at a concentration of 100 cells / well and placed in a 37°C incubator containing 5% CO2. After the cells grew to a density of 80-90% (approximately 24 hours), they were washed three times with PBS solution, pretreated with empty DMEM and different concentrations of corydaline PBS solution (10 μM, 20 μM, 50 μM) for 1 hour, and then infected with the SVA strain (MOI=1). The medium was changed after 1 hour. The infection lasted for 24 hours with the drug present. The infection of the cells was observed under a fluorescence microscope. Figure 1 The results showed that corydaline could reduce the green fluorescence produced by SVA, indicating that corydaline may reduce the infection of SVA.

[0030] Example 2

[0031] Verify the effect of Corydalis in inhibiting the infection activity of SVA during the whole infection cycle (Western blot, fluorescence quantitative PCR and TCID50 experiments), the specific steps are as follows:

[0032] 1) Western blot assay of the inhibitory activity of Corydalis on SVA infection in BSR cells

[0033] Dilute the BSR cells with DMEM containing 10% FBS to a volume concentration of 5 × 10 5 / well was added dropwise to a 6-well plate, placed in a 37°C, 5% CO2 incubator until the cells attached to the wall to form a monolayer (about 24h), and then the cells were washed three times with PBS solution. After the residual PBS was aspirated, 1mL of serum-free DMEM was added to dilute the corresponding concentration of corydaline (50μM), and incubated with BSR cells at 37°C for 1h. The cells were infected with SVA (MOI=1) in the presence of the corresponding concentration of corydaline (50μM), placed in a 37°C, 5% CO2 incubator for 1h, and then replaced with 2mL of DMEM containing 2% FBS. M nutrient solution and the corresponding concentration of corydaline (50μM) were maintained, and cultured in a 37℃, 5% CO2 incubator. After infection for 8h, 12h, 24h, and 36h, the cell supernatant was collected (1mL was stored at -70℃ for later TCID50 experiments), washed three times with PBS, and the residual liquid was sucked out. The cells were lysed with a lysis buffer containing protease inhibitors. After the concentration of the lysis buffer was determined, 5× protein loading was added to collect the cell samples, boiled in a metal bath at 96℃ for 15min, and then Western blot was performed. It was found that corydaline reduced the expression of SVA VP3 protein, which preliminarily confirmed that corydaline reduced the infection of SVA.

[0034] 2) TCID50 determination of the inhibitory activity of Corydalis on SVA infection in BSR cells

[0035] Dilute the BSR cells with DMEM containing 10% FBS to a volume concentration of 2 × 10 4 / well concentration was added to a 96-well plate, placed in a 37°C, 5% CO2 incubator, and after the cells adhered to the wall to form a monolayer, washed three times with PBS, and after the residual liquid was sucked out, the virus supernatant collected in the previous experiment diluted with serum-free DMEM was added. Eight replicates were made for each concentration. After 1.5 hours of infection, DMEM containing 2% FBS was replaced for maintenance. After 72 hours of infection, the cell infection was observed, and the observation was made until 120 hours after infection. It was found that corydaline reduced the virus titer of SVA infection supernatant ( Figure 2 B) in the figure demonstrated that corydaline reduces the infection of SVA.

[0036] 3) Fluorescence quantitative RT-PCR determination of the inhibitory activity of Corydalis on SVA infection in BSR cells

[0037] After digestion, BSR cells were diluted with DMEM containing 10% FBS to a concentration of 5 × 10 5 / well was added dropwise to a 6-well plate, placed in a 37°C, 5% CO2 incubator until the cells adhered to the wall into a monolayer (about 24 hours), the cells were washed three times with PBS solution, and after the residual PBS was absorbed, 1 mL of serum-free DMEM was added to dilute the corresponding concentration of corydaline (10 μM), and incubated with BSR cells at 37°C for 1 hour. The cells were infected with SVA in the presence of corydaline (10 μM), placed in a 37°C, 5% CO2 incubator for 1 hour, and then replaced with 2 mL of DMEM nutrient solution containing 2% FBS for maintenance in the presence of corydaline (10 μM) at a corresponding concentration, placed in a 37°C, 5% CO2 incubator for culture, and after infection for 24 hours, directly frozen and placed in a -70°C refrigerator. After repeated freezing and thawing 3 times, viral RNA was extracted for detection by real-time fluorescence quantitative RT-PCR method. The fluorescent quantitative RT-PCR primers and probes used were: SVA-FCTGCGCTGGGACCGTATCTCA, SVA-R CGCCGCGCCACCTCATT, SVA-PTCGCCGTAAGCGTGCACCGAGACAG. The 20 μL reaction system used contained 5×One Step U + Mix 4μL, OneStep U +Mix 1μL, upstream and downstream primers 0.4μL each, probe 0.2μL, RNase-free water 14.0μL, template 5μL. Amplification program is reverse transcription at 55℃ for 15min, pre-denaturation at 95℃ for 2min 30s, PCR reaction is denaturation at 95℃ for 8s, annealing at 60℃ for 16s, a total of 45 cycles, and fluorescence reading at 60℃. The results are as follows Figure 2 As shown in C, corydaline can reduce the copy number of SVA nucleic acid, confirming that corydaline reduces the infection of SVA.

[0038] Example 3

[0039] Verification of the effect of corydaline on SVA adsorption

[0040] After digestion, BSR cells were diluted with 10% FBS DMEM nutrient solution to a concentration of 5 × 10 5 / well concentration was added to a 6-well plate, placed in a 37°C, 5% CO2 incubator until the cells adhered to the wall into a monolayer (about 24 hours), and then washed three times with PBS solution. After the residual PBS was sucked out, 1 mL of serum-free DMEM was added to dilute the corresponding concentration of corydaline (10 μM, 20 μM, 50 μM), and incubated with BSR cells at 37°C for 1 hour, and then replaced with cold serum-free DMEM. SVA was infected at 4°C and corydaline (10 μM, 20 μM, 50 μM) was present at the corresponding concentration. After incubation for 1 hour, it was washed three times with cold PBS, 1 mL of cold serum-free DMEM was added, and it was frozen in a -70°C refrigerator. The viral RNA was extracted by repeated freezing and thawing three times for fluorescence quantitative RT-PCR determination. The results are shown in Figure 3 As shown in , it was found that corydaline reduced the SVA nucleic acid copy number, confirming that corydaline reduced the adsorption of SVA.

[0041] Example 4

[0042] Verify the effect of Corydalis on SVA cell entry (Western blot and fluorescence quantitative RT-PCR)

[0043] The digested BSR cells were diluted to an appropriate density of 5 × 10 cells / mL using DMEM containing 10% FBS. 5 / well concentration was added to a 6-well plate, placed in a 37°C, 5% CO2 incubator until the cells adhered to the wall and formed a monolayer (about 24 hours), washed with PBS three times, and after absorbing the residual PBS, 1 mL of serum-free cold DMEM was added and infected with SVA (MOI = 10). After incubation at 4°C for 1 hour, the cells were washed three times with cold PBS and the residual liquid was absorbed, and 1 mL of cold DMEM containing 2% FBS and corresponding concentrations of dipotassium glycyrrhizinate (0μM, 10μM, 20μM and 50μM) was added. After incubation at 37°C for 1 hour, the cells were washed three times with citric acid and then washed three times with PBS, and the residual liquid was absorbed, and replaced with 2 mL of DMEM nutrient solution containing 2% FBS for maintenance, and placed in a 37°C, 5% CO2 incubator for culture. After infection for 18 hours, cell samples were collected for Western blot and fluorescent quantitative RT-PCR detection. The results are shown in Figure 4 As shown, corydaline reduced the expression of SVA VP3 protein entering cells and also reduced the amount of SVA nucleic acid entering cells, confirming that corydaline reduced the level of SVA entering cells.

[0044] Example 5

[0045] Verify the effect of Corydalis on SVA replication (Western blot, TCID50, fluorescent quantitative RT-PCR)

[0046] Dilute the BSR cells to an appropriate density of 5 × 10 cells / mL in DMEM with 10% FBS. 5 / well concentration was added to a 6-well plate and placed in a 37°C, 5% CO2 incubator until the cells adhered to the wall and formed a monolayer (about 24 hours). The cells were washed three times with PBS solution, and after the residual PBS was sucked out, 1 ml of empty DMEM containing SVA virus (MOI=1) was added. After incubation at 37°C for 1 hour, the cells were washed three times with PBS, and 2 ml of DMEM (containing 2% serum) containing 10μmol / L, 20μmol / L and 50μmol / L corydaline was added to the cells. After incubation at 37°C for 12 hours, Western blot, TCID50, and fluorescent quantitative RT-PCR were performed, and the results are as follows. Figure 5 As shown in , it was found that corydaline reduced the expression of SVA VP3 protein, reduced the SVA nucleic acid copy number and virus titer, confirming that corydaline can inhibit SVA replication.

[0047] Example 6

[0048] Verify the effect of Corydalis on SVA assembly and release (Western blot, TCID50, fluorescence quantitative RT-PCR)

[0049] BSR cells were cultured on different cell plates and grown to a monolayer. After SVA (MOI=1) infected BSR cells at 37°C for 1 hour, the cells were washed 3 times with PBS and the residual liquid was aspirated. The cells were incubated with 2% DMEM culture medium containing 0μmol / L, 10μmol / L, 20μmol / L and 50μmol / L reboxetine mesylate for 12 hours, which is about one virus replication cycle. The supernatant was taken for later use. The cells were added with 1mL PBS and repeatedly frozen and thawed 3 times, and then the solution was collected. Within a replication cycle, when the virus assembly and release mechanism is normal, the virus titer and nucleic acid ratio in the supernatant and cells should be basically constant. The ratio of SVA virus titer in the supernatant to that in the cells was detected by TCID50, and the ratio of SVA nucleic acid copy number in the supernatant to that in the cells was detected by fluorescent quantitative RT-PCR. The results are shown in Figure 6 As shown in A, corydaline reduced the titer ratio of extracellular and intracellular SVA, confirming that corydaline can inhibit the release of SVA. Figure 6 As shown in B, corydaline can reduce the ratio of extracellular and intracellular SVA nucleic acids, proving that corydaline can inhibit the SVA assembly process.

Claims

1. A use of Corydalis, characterized in that: The use is in the preparation of products for preventing and / or treating type A Seneca virus infection.

2. The use according to claim 1, characterized in that The product contains corydaline in pharmacologically effective concentration.

3. The use according to claim 2, characterized in that The pharmacologically effective concentration is a concentration that can prevent type A Seneca virus from infecting cells.

4. The use according to claim 2, characterized in that The pharmacologically effective concentration is 10 to 100 μmol / L in the liquid preparation.

5. The use according to claim 4, characterized in that The pharmacologically effective concentration is 20 to 80 μmol / L in the liquid preparation.

6. The use according to claim 4, characterized in that The pharmacologically effective concentration is 40 to 60 μmol / L in the liquid preparation.

7. The use according to claim 4, characterized in that The liquid preparation is PBS buffer or DMSO.

Images