Knockout fragment of biofilm dispersion regulating gene spo0J and its application

Abstract

The invention discloses a knockout fragment of a biofilm dispersion regulating gene spo0J and its application, and belongs to the technical field of microbial genetic engineering. The knockout fragment of the biofilm dispersion regulating gene spo0J of the invention has a nucleotide sequence as shown in SEQ ID NO.3. The target fragment of the knockout spo0J gene, i.e., the knockout fragment of the biofilm dispersion regulating gene spo0J, is obtained by overlapping PCR; the fragment is transformed into a wild-type FZB42 by a chemical transformation method to obtain a spo0J knockout strain △spo0J. Compared with the wild-type FZB42, the △spo0J strain has a significantly improved level of indoleacetic acid (IAA) secretion; the relative expression levels of tryptophan synthesis genes trpB, trpC and indoleacetic acid (IAA) synthesis gene ysnE are significantly increased.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbial genetic engineering, and more specifically, relates to a knockout fragment of a biofilm dispersion regulating gene spo0J and an application thereof. Background Art

[0002] Bacillus velezensis FZB42 is a Gram-positive plant rhizosphere growth-promoting bacterium that was isolated from the rhizosphere of German sugar beets in 1998 and sequenced as the first Bacillus amyloliquefaciens strain in 2007. FZB42 has been commercialized and colonizes plant roots in the form of biofilms and promotes plant growth. The development of bacterial biofilms is a complex cyclic process that includes initial attachment, formation, maturation, and dispersion. In addition to forming biofilms to help colonization, FZB42 can also synthesize indoleacetic acid (IAA) to promote plant growth. As a plant rhizosphere growth-promoting bacterium, FZB42 has broad application prospects, so analyzing its biocontrol mechanism is of far-reaching significance.

[0003] The whole genome of FZB42 has been sequenced, which provides a premise for screening biofilm regulatory genes. Given that biofilm colonization of FZB42 is a key factor in its growth-promoting function, screening FZB42 biofilm regulatory genes will help to explore its growth-promoting value.

[0004] spo0J is a protein in Bacillus subtilis that is associated with the separation of plasmids and chromosomes in bacteria and belongs to the ParABS system.

[0005] As part of the ParABS system, Soj (ParA) and spo0J (ParB) are involved in controlling other key aspects of the bacterial cell cycle. In Bacillus subtilis, the dimer and monomeric forms of Soj activate or inhibit DNA replication, respectively. In addition, spo0J was identified as a specific loading factor for the SMC complex, also known as Condensin (originally in Bacillus subtilis and more recently in a range of other bacteria). SMC / Condensin is conserved from bacteria to humans and, in Bacillus subtilis, is the main organizer of chromosomes: after loading at the origin, the SMC complex uses ATPase activity to transfer toward the termini while arranging chromosome arms in a process that promotes the segregation of large chromosomes until specialized unloading at the termini. Soj and spo0J are also involved in the early stages of sporulation: by activating checkpoint regulators, they participate in chromosome reassembly and segregation. Studies have shown that ParA / Soj and ParB / spo0J are involved in chromosome segregation and sporulation in bacteria, but no reports have been found on their involvement in biofilm dispersion. Summary of the invention

[0006] In view of the above problems existing in the prior art, the technical problem to be solved by the present invention is to provide the spo0J gene of Bacillus varezii FZB42 for constructing a transgenic strain; another technical problem to be solved by the present invention is to provide the application of the spo0J gene of Bacillus varezii FZB42 for screening excellent growth-promoting strains.

[0007] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0008] The nucleotide sequence of the knockout fragment of the biofilm dispersion regulating gene spo0J is shown in SEQ ID NO.3; the nucleotide sequence of the biofilm dispersion regulating gene spo0J is shown in SEQ ID NO.1.

[0009] The use of a knockout fragment of a biofilm dispersion regulating gene spo0J in promoting the secretion of indoleacetic acid by Bacillus varezii FZB42 comprises the following steps:

[0010] (1) Construction of a knockout fragment of the biofilm dispersion regulatory gene spo0J;

[0011] (2) transforming the constructed knockout fragment of the biofilm dispersion regulatory gene spo0J into Bacillus varezii FZB42;

[0012] (3) The strain Bacillus varezii FZB42 with significantly improved indoleacetic acid secretion level was cultivated and screened.

[0013] The method for constructing the knockout fragment of the biofilm dispersion regulating gene spo0J is as follows: based on the biofilm dispersion mutation library, the biofilm regulating gene spo0J is identified by reverse PCR, and the target fragment of the knockout spo0J gene, i.e., the knockout fragment of the biofilm dispersion regulating gene spo0J, is obtained by overlapping PCR.

[0014] The reverse PCR primer sequences are as follows:

[0015] FBO752-F: 5'-GCTTGTAAATTCTATCATAATTG-3',

[0016] FBO753-R: 5'-AGGGAATCATTTGAAGGTTGG-3'.

[0017] Application of the knockout fragment of the biofilm dispersion regulatory gene spo0J in promoting the expression of tryptophan synthesis genes.

[0018] The tryptophan synthesis genes are trpB and trpC.

[0019] Application of the knockout fragment of the biofilm dispersion regulatory gene spo0J in promoting the expression of indoleacetic acid synthesis genes.

[0020] The indoleacetic acid synthesis gene is ysnE.

[0021] The application of the biofilm dispersion regulating gene spo0J in inhibiting the secretion of indoleacetic acid by Bacillus varezii FZB42 and / or inhibiting the expression of tryptophan synthesis genes and / or inhibiting the expression of indoleacetic acid synthesis genes; the tryptophan synthesis genes are trpB and trpC; the indoleacetic acid synthesis gene is ysnE.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] 1) The present invention is based on a biofilm dispersed mutation library, and the biofilm regulatory gene spo0J is identified by reverse PCR. The target fragment of the spo0J gene knockout is obtained by overlapping PCR, and the fragment is introduced into the wild-type FZB42 strain by chemical transformation to obtain the spo0J knockout strain Δspo0J.

[0024] 2) Compared with the wild-type FZB42, the Δspo0J strain of the present invention lacks the ability to disperse biofilm.

[0025] 3) The level of indoleacetic acid (IAA) secreted by the Δspo0J strain of the present invention is significantly increased compared with the wild-type FZB42.

[0026] 4) Compared with the wild-type FZB42, the relative expression levels of the tryptophan biosynthesis genes trpB and trpC and the indoleacetic acid (IAA) biosynthesis gene ysnE in the Δspo0J strain of the present invention were significantly increased. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The biofilm dispersion diagrams of FZB42 and △spo0J;

[0028] Figure 2 Figure 2 is the IAA secretion level of FZB42 and Δspo0J;

[0029] Figure 3 This is the relative expression level of FZB42 and △spo0J trpB, trpC, and ysnE at 12 h of culture. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described below in conjunction with specific embodiments. In the following embodiments, unless otherwise specified, the technical means used are conventional means well known to those skilled in the art.

[0031] The Bacillus varezii FZB42 of the present invention is stored in the Molecular Pathology Laboratory of the Forestry College of Nanjing Forestry University.

[0032] Main reagents: Taq I endonuclease, Premix Taq TM , high-fidelity enzymes were purchased from Takara; gel recovery kits were purchased from Vazyme; reverse transcription and qPCR kits were purchased from TIANGEN; 3-indoleacetic acid was purchased from Sangon; other reagents were of analytical grade.

[0033] LB medium: Tryptone 10g / L, Yeast extract 5g / L, Nacl 5g / L, solid culture medium needs to be supplemented with Agar 15g / L.

[0034] LBGM liquid medium: LB medium supplemented with 1 mL of 100 mM MnSO 4 / L, 10mL glycerol / L.

[0035] Example 1

[0036] 1. Construction of FZB42 transposon library using Escherichia coli-Bacillus shuttle plasmid pMarA

[0037] The E. coli-Bacillus shuttle plasmid pMarA was transformed into FZB42 by electroporation, and the correctly verified transformant was named FBS239.

[0038] The FBS239 plates stored in a -80°C refrigerator were streaked and cultured in a 30°C constant temperature incubator overnight. A single colony was picked and inoculated into LB liquid medium (Kan, Em) and cultured at 30°C, 200 rpm for 12 h. The bacterial solution was diluted 10 5 ~10 7 Spread on Kan screening medium, place in oven at 50℃ for 12h, transfer to constant temperature incubator at 30℃ for 12h; pick out single colonies and streak inoculate on Kan and Em screening medium one by one. The colony that can grow on Kan screening medium but not on Em screening medium is a correct transposon, and 5000 transposons are selected to form FZB42 transposon mutation library.

[0039] 5000 transformants were inoculated into 96-well plates containing LBGM liquid culture medium and cultured at 30°C for 96 h. A mutant strain SL26 was screened based on the biofilm non-dispersion phenotype.

[0040] 2. Identification of the insertion position of the transposable sequence in the mutant SL26

[0041] The genomic DNA of the mutant strain SL26 was extracted by the CTAB method, and the genomic DNA of the mutant strain was digested with Taq I. After sufficient digestion, T4 DNA ligase was used for enzyme ligation. Reverse PCR primers were designed according to the transposition sequence TnYLB-1 (SEQ ID NO.2), and the primer sequences were as follows:

[0042] FBO752-F: 5'-GCTTGTAAATTCTATCATAATTG-3',

[0043] FBO753-R: 5'-AGGGAATCATTTGAAGGTTGG-3'.

[0044] The enzyme linkage product was used as a template, FBO752-F was used as the upstream primer, and FBO753-R was used as the downstream primer. According to the PCR reaction system (DNA of enzyme linkage 2 μL, Primer-F 1 μL, Primer-R 1 μL, Premix Taq TM 12.5 μL, ddHO 2 O up to 25μL) and PCR reaction program (95℃3min; 95℃15s, 50℃15s, 72℃3min, 30 cycles; 72℃5min), the sequencing results of PCR products were compared with the FZB42 genome map, and the biofilm regulatory gene spo0J (SEQ IDNO.1) was identified.

[0045] 3. Construction of spo0J gene knockout strain △spo0J

[0046] 1) According to the FZB42 genome map, primers were designed as follows:

[0047] SLO13-F: 5'-AGTTAGGATTTATCCTCTTCTCTACAGAAA-3',

[0048] SLO14-R:

[0049] 5'-GTACATCCGCAACTGTCCAT-AAATAAAGACAAGCTTGAGCCGCTTG-3',

[0050] SLO15-F:

[0051] 5'-CATAGTATCGACGGAGCCGA-TTTAGCGAGCTGTTCCTGGGTTAAATCCAA-3',

[0052] SLO16-R: 5'-ATGTGAAGGTAGGTGACATCGTGGGAA-3'.

[0053] The CTAB method was used to extract FZB42 genomic DNA, which was used as a template. SLO13 and SLO15 were used as upstream primers, and SLO14 and SLO16 were used as downstream primers. The PCR reaction system (Genome DNA 2 μL, Primer-F 1 μL, Primer-R 1 μL, Max DNA Polymerase 25μL, ddH 2 The fragments of about 1000 bp upstream and downstream of spo0J were amplified using the PCR reaction program (98°C for 10 s; 98°C for 10 s, 55°C for 15 s, 72°C for 30 s, 30 cycles, and 72°C for 120 s).

[0054] 2) Design primers according to the pMarA plasmid map as follows:

[0055] O4-Km-F:5'-:TCGGCTCCGTCGATACTATG-3',

[0056] O5-Km-R: 5'-ATGGACAGTTGCGGATGTAC-3'.

[0057] FBS239 DNA was extracted using the CTAB method and used as a template. O4-Km was used as the upstream primer and O5-Km was used as the downstream primer. The PCR reaction system (Genome DNA 2 μL, Primer-F 1 μL, Primer-R 1 μL, MaxDNA Polymerase 25 μL, ddHO 2 The Kan-resistant fragment was amplified by PCR reaction program (98°C for 10 s; 98°C for 10 s, 55°C for 15 s, 72°C for 30 s, 30 cycles, and 72°C for 120 s).

[0058] 3) Purify the three PCR products according to the instructions of the common DNA product purification kit (TIANGEN, DP204), measure the concentration in ng / μL by Nanodrop, convert it to pmol concentration, mix the three purified PCR products in a ratio of 1:1:1 as templates, without adding primers, and follow the PCR reaction system (template DNA 10μL, Max DNA Polymerase 25 μL, ddHO 2 The PCR reaction program (98°C for 10 s; 98°C for 10 s, 55°C for 15 s, 72°C for 30 s, 12 cycles, 72°C for 120 s) was used for amplification.

[0059] The PCR product from the previous step was directly used as a template, and SLO1 was used as the upstream primer and SLO4 as the downstream primer to amplify the target fragment. Electrophoresis showed about 3000 bp, which was in line with expectations, and the target fragment for knocking out the spo0J gene (SEQ ID NO.3) was obtained.

[0060] 4) According to the instructions of the common agarose gel DNA recovery kit (TIANGEN, DP209), the target fragment was excised and recovered.

[0061] 5) The target fragment was transformed into wild-type FZB42 by chemical transformation to obtain spo0J gene knockout transformants.

[0062] 6) Positive colony PCR detection

[0063] Pick a single colony of the transformant obtained in the previous step and inoculate it in 30 μL ddHO 2 O in a centrifuge tube. Place it in a metal bath at 100°C for 10 min, then immediately place it in an ice bath for 2 min, centrifuge it at 12000 rpm for 1 min, and take 1 μL of the supernatant as a template.

[0064] According to the FZB42 genome map, the primers were designed as follows:

[0065] spo0J-F: 5'-AGTTGACAAGACGTATATAA-3',

[0066] spo0J-R: 5'-CAAAGGAAGTGGCAGCGA-3'.

[0067] The 2×Taq enzyme system of Takara Company was used, spo0J-F was used as the upstream primer, spo0J-R was used as the downstream primer, and the reaction system (8.5 μL ddH 2 O, 12.5μL 2×TaqMaster Mix, 1μL supernatant, 1μL spo0J-F (10μM), 1μL spo0J-R (10μM)) and reaction program (95℃5min; 95℃30s, 50℃30s, 72℃60sec / kb, 30 cycles; 72℃5min) were used to amplify the bacterial solution by PCR. The amplified bacterial solution PCR was taken out for gel electrophoresis detection, and the bacterial solution with bands in the electrophoresis pattern that were similar in size to the target fragment and bright and clear, that is, the positive clone bacterial solution, was sampled and sent to the company for sequencing. The sequencing results were compared using BLAST (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) software, and the comparison was correct, indicating that the spo0J gene knockout strain △spo0J was successfully constructed.

[0068] Example 2

[0069] Under sterile conditions, single colonies of wild-type FZB42 and △spo0J were picked and inoculated into LB liquid medium for pre-culture at 37°C and 200 rpm overnight. The pre-cultured bacterial solution was taken and adjusted to OD 600 =1, inoculated into 24-well plates at 1% (2 mL LBGM medium was added to each well), cultured at 25°C for 120 h, and the biofilm at the solid-air interface and the bottom solution were observed.

[0070] The results are as follows Figure 1 As shown, the biofilm on the FZB42 surface has dispersed, while the △spo0J surface still maintains a robust biofilm. The bottom solution of FZB42 has become turbid while the bottom solution of △spo0J is still clear, indicating that the lack of spo0J causes defects in biofilm dispersion.

[0071] Example 3

[0072] Weigh pure 3-indoleacetic acid and dissolve it in ddH 2 O, prepare 0, 20, 40, 60, 80, 100 mg / L indoleacetic acid (IAA) solutions respectively; take 1 mL of indoleacetic acid (IAA) solutions of different concentrations and add 1 mL of Salkowski reagent (accurately measure 25 mL of 70% HClO 4 , added to 25 mL of distilled water, and after cooling to room temperature, added 1 mL of 0.5 M FeCl 3 Solution), mixed and reacted at 25°C in the dark for 30 min, and the OD 530 The absorbance value at the point where the standard curve is drawn is taken as the horizontal axis and the absorbance value as the vertical axis.

[0073] Under sterile conditions, single colonies of wild-type FZB42 and △spo0J were picked and inoculated into LB liquid medium for pre-culture at 37°C, 200 rpm overnight; the bacterial solution obtained from the pre-culture was taken and adjusted to OD 600 =1; inoculate 1% into new LB liquid medium, culture at 37°C, 200rpm for 12h-18h. Take 1mL of bacterial solution and add 1mL of Salkowski reagent, mix and react in the dark at 25°C for 30min, and measure the absorbance OD 530 , and the standard curve was used to calculate the concentration of indoleacetic acid (IAA).

[0074] The results are as follows Figure 2 As shown, the level of indoleacetic acid (IAA) secreted by Δspo0J was significantly increased compared with wild-type FZB42.

[0075] Example 4

[0076] 1. Extraction of Total RNA

[0077] The total RNA of wild-type FZB42 and △spo0J was extracted by TRIZOL method, and the RNA was detected by 1% agarose gel electrophoresis, and the concentration was detected by Nanodrop. The extracted RNA was detected by electrophoresis and showed that the 5S, 16S, and 23S bands were clear and there was no degradation. The OD 260 / OD 280 ≈2, basically no protein contamination, the RNA concentrations of FZB42 and △spo0J were 2438ng / μL and 2912ng / μL, and the RNA purity and quality met the experimental requirements.

[0078] 2. Reverse transcription and genomic DNA removal

[0079] According to the instruction manual of HiScript III All-in-one RT SuperMix Perfect for qPCR (R333-01), reverse transcription was performed to obtain cDNA.

[0080] 3. qPCR quantitative detection

[0081] The relative expression levels of tryptophan synthesis genes trpB, trpC and indoleacetic acid (IAA) synthesis gene ysnE in wild-type FZB42 and △spo0J were determined by qPCR, and gyrA was selected as the internal reference gene.

[0082] The qPCR reaction system was prepared according to the instructions of the Talent Fluorescence Quantification Detection Kit (SYBR Green) (TIANGEN, FP209), and the qPCR reaction was performed using a two-step PCR reaction program (95°C for 3 min; 95°C for 5 s, 60°C for 15 s, 40 cycles). -ΔΔCT The results of the fluorescence quantitative PCR experiment were calculated by the method, and the data were analyzed using Prism. The primers designed according to the FZB42 genome map are as follows:

[0083] gyrA-F: TGCAGCGGTGTATCAATTCC,

[0084] gyrA-R:GGCCGTTTGTTTGTACAGGT.

[0085] trpB-F:TGCAGCGGTGTATCAATTCC,

[0086] trpB-R:CGGACAAGGTTGTTGCATGT.

[0087] trpC-F:CGGGTATCCGTGAGAACTGA,

[0088] trpC-R: GGCTGATTGCCGAAGTGAAA.

[0089] ysnE-F: TCAAGCATATGGCGGAGGAT,

[0090] ysnE-R:GCGGTGCCTTAAAGGAGCTA.

[0091] The results are as follows Figure 3 As shown, compared with the wild-type FZB42, the relative expression levels of tryptophan synthesis genes trpB, trpC and indoleacetic acid (IAA) synthesis gene ysnE in △spo0J were significantly increased.

[0092] In summary, the deletion of the spo0J gene of Bacillus varezii can enhance the indoleacetic acid (IAA) secretion ability of the FZB42 strain, which has important application value in improving the growth-promoting ability of FZB42.

Claims

1. Biofilm dispersion regulatory genes spo0J The knockout fragment, whose nucleotide sequence is shown in SEQ ID NO.3; the biofilm dispersion regulating gene spo0J The nucleotide sequence is shown in SEQ ID NO.

1.

2. The biofilm dispersion regulating gene according to claim 1 spo0J Application of knockout fragments in promoting the secretion of indoleacetic acid by Bacillus varezii FZB42.

3. The biofilm dispersion regulating gene according to claim 2 spo0J Application of knockout fragments in promoting the secretion of indoleacetic acid by Bacillus varezii FZB42, It is characterized in that The following steps are involved: (1) Construction of biofilm dispersion regulation genes spo0J knockout fragments; (2) Disperse the regulatory genes of the constructed biofilm spo0J The knockout fragment was transformed into Bacillus varezii FZB42; (3) The strain Bacillus varezii FZB42 with significantly improved indoleacetic acid secretion level was cultivated and screened.

4. The biofilm dispersion regulating gene according to claim 3 spo0J Application of knockout fragments in promoting the secretion of indoleacetic acid by Bacillus varezii FZB42, It is characterized in that Biofilm dispersion regulatory genes spo0J The knockout fragments were constructed by identifying biofilm regulatory genes through inverse PCR based on the biofilm dispersed mutation library. spo0J, Knockout obtained by overlapping PCR spo0J The target gene fragment, namely the biofilm dispersion regulating gene spo0J knockout fragment.

5. The biofilm dispersion regulating gene according to claim 4 spo0J Application of knockout fragments in promoting the secretion of indoleacetic acid by Bacillus varezii FZB42, It is characterized in that The primer sequences for the reverse PCR are as follows: FBO752-F: 5'-GCTTGTAAATTCTATCATAATTG-3', FBO753-R: 5'-AGGGAATCATTTGAAGGTTGG-3'.

6. The biofilm dispersion regulating gene according to claim 1 spo0J The knockout fragment promotes the expression of tryptophan biosynthesis genes in Δspo0J trpB , trpC Application in expression.

7. The biofilm dispersion regulating gene according to claim 1 spo0J The knockout fragment promotes the indoleacetic acid biosynthesis gene in △spo0J ysn Application in expression.

8. Knockout of genes regulating biofilm dispersion spo0J Application of the invention in promoting the secretion of indoleacetic acid by Bacillus varezii FZB42 and / or promoting the expression of tryptophan synthesis gene and / or promoting the expression of indoleacetic acid synthesis gene; the tryptophan synthesis gene is trpB , trpC ; The indoleacetic acid synthesis gene is ysn ; The biofilm dispersion regulatory gene spo0J The nucleotide sequence is shown in SEQ ID NO.1.

Images