Recombinant bacteria for degrading crab shells, construction method and application thereof

Abstract

The present application belongs to the field of microbial genetic engineering technology, and particularly relates to a recombinant bacterium for degrading crab shells, a construction method and application thereof. The present application carries out metabolic engineering modification on Pseudomonas putida KT2440 capable of utilizing crab shell substrate to grow and carry out life activities, utilizes overexpression of exogenous protease genes lasBT and IV to construct overexpression strains KT +IV , KT +lasBT The two modified engineering bacteria improve the protein utilization rate, enable the strains to better adapt to the crab shell substrate fermentation environment, enhance the growth ability of the strains, promote the high-value utilization of crab shells, and lay a foundation for realizing efficient and large-scale conversion of crab shells into high-value chemicals.

Description

Technical Field

[0001] This invention belongs to the field of microbial genetic engineering technology, and more specifically, relates to recombinant bacteria for degrading crab shells, their construction methods, and applications. Background Technology

[0002] Crab shells, a major waste product from crustacean seafood processing, are rich in organic components such as protein, chitin, and lipids, possessing extremely high potential for resource utilization. However, traditional treatment methods, such as chemical or physical methods, suffer from high energy consumption and severe environmental pollution. While microbial fermentation technology can achieve green transformation, its application still faces significant challenges. The complex composition of crab shells, such as the cross-linked protein and chitin complex structure, leads to low microbial degradation efficiency, poor strain adaptability, and slow growth, severely restricting its industrial application.

[0003] In the existing technology, although Pseudomonas putida KT2440 has a certain broad substrate spectrum, its natural metabolic capacity is insufficient to efficiently decompose various components in crab shells, resulting in high substrate residue rate and low bacterial biomass during fermentation. Summary of the Invention

[0004] The purpose of this invention is to provide recombinant bacteria for degrading crab shells, their construction methods, and applications.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] The present invention provides a recombinant bacterium for degrading crab shells, wherein the recombinant bacterium is *Pseudomonas putida* KT2440 carrying an exogenous protease gene, wherein the exogenous protease gene is the IV gene with the sequence shown in SEQ ID NO.5 or the lasBT gene with the sequence shown in SEQ ID NO.6.

[0007] This invention involves metabolic engineering of *Pseudomonas putida* KT2440, a bacterium capable of growing and carrying out life activities using crab shell substrates. An overexpression strain KT was constructed by overexpressing the exogenous protease genes lasBT and IV. +IV KT +lasBT The two engineered bacteria improved their protein utilization rate, enabling them to better adapt to the fermentation environment of crab shell substrates, enhancing their growth capacity, promoting the high-value utilization of crab shells, and laying the foundation for the efficient and large-scale conversion of crab shells into high-value chemicals.

[0008] The present invention also provides a method for constructing the recombinant bacteria, comprising: transferring a recombinant overexpression plasmid carrying an exogenous protease gene into the *Pseudomonas putida* KT2440, and obtaining the recombinant bacteria by positive clone screening.

[0009] Furthermore, the recombinant overexpression plasmid carrying the exogenous protease gene is obtained by inserting the exogenous protease gene between the BamHI and SacI sites of the pUCP18 plasmid.

[0010] The present invention also provides the application of the recombinant bacteria in the fermentation and degradation of crab shells.

[0011] The present invention also provides a method for degrading crab shells, comprising: preparing a fermentation culture medium using crab shells as raw materials, inoculating the recombinant bacteria, and degrading the crab shells through fermentation.

[0012] Furthermore, the crab shell culture medium is obtained by adding 1-10g of crab shell fragments to 90-99mL of LB liquid culture medium.

[0013] Furthermore, the inoculation amount of the bacterial solution is 0.5% to 1.5% of the volume of the crab shell culture medium.

[0014] Furthermore, the fermentation conditions are: temperature 28–32°C, fermentation time 40–45 h, and rotation speed 150–250 rpm / min.

[0015] The present invention also provides the application of the recombinant bacteria in the preparation of products that degrade crab shells.

[0016] Furthermore, the degradation of the crab shell includes the degradation of proteins and fats in the crab shell.

[0017] The present invention has the following beneficial effects:

[0018] This invention involves metabolic engineering of *Pseudomonas putida* KT2440, a bacterium capable of utilizing crab shell substrates for growth and life activities. An overexpression strain, KT2440, is constructed by overexpressing the exogenous protease genes lasBT and IV. +IV KT +lasBT The two engineered bacteria strains reduced substrate residue by lowering the percentage of protein and fat dry weight in the substrate. The modified strains were better adapted to the crab shell fermentation environment, increasing bacterial biomass through increased cell growth, thus promoting the high-value utilization of crab shells and laying the foundation for efficient and large-scale conversion of crab shells into high-value chemicals. Attached Figure Description

[0019] Figure 1 This is a schematic diagram of the overexpression vector structure of the exogenous protease gene, where A is a schematic diagram of the recombinant plasmid pPR-IV and B is a schematic diagram of the recombinant plasmid pPR-lasBT.

[0020] Figure 2 This is a graph showing bacterial growth.

[0021] Figure 3This is a graph showing the percentage of dry protein in the fermented crab shell culture medium.

[0022] Figure 4 This is a graph showing the percentage of dry fat in the fermented crab shell culture medium. Detailed Implementation

[0023] The present invention will now be described in detail with reference to specific embodiments, but these should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments can be obtained commercially unless otherwise specified.

[0024] The *Pseudomonas putida* KT2440 used in this invention was purchased from the American Test and Computation Center (ATCC) Biological Standards Resource Center in the United States.

[0025] Example 1: Strain construction and fermentation.

[0026] I. Preparation of experimental materials.

[0027] 1. Raw material preparation: The swimming crabs used in the experiment were purchased from Meixi Village Market in Ningbo City. The raw materials were steamed at 105℃ for 15 minutes, cooled to room temperature, and the muscles and internal organs were removed with dissecting tools, leaving the crab shell. After being washed with clean water, they were dried at a constant temperature of 55℃ for 12 hours. They were then crushed in a mortar and sieved through a 400-mesh sieve and dried at a constant temperature of 55℃ until constant weight.

[0028] 2. Culture Media: The culture media used in this invention are prepared as follows: 10g peptone, 5g yeast extract, and 5g sodium chloride nutrient source are dissolved in 1L of deionized water and autoclaved at 121℃ for 20 minutes. After cooling, this is the LB liquid culture medium. Alternatively, 10g peptone, 5g yeast extract, 5g sodium chloride, and 15g agar powder are dissolved in 1L of water and autoclaved at 121℃ for 20 minutes. After cooling to 60℃, the mixture is shaken well, poured into plates, and allowed to solidify to form LB agar medium. For crab shell culture medium, 7g of crushed crab shells are added to 93mL of unsterilized LB liquid culture medium, shaken well, and the bottle mouth is sealed with film and autoclaved at 121℃ for 20 minutes.

[0029] 3. Strains Construction: Primers used for vector construction are listed in Table 1. The vector used was pUCP18. *E. coli* DH5α strain was used for all molecular operations during plasmid construction. The plasmids were constructed according to standard molecular cloning protocols and verified by DNA sequencing for subsequent analysis. Overexpression vectors, such as... Figure 1 As shown.

[0030] The IV gene sequence is shown in SEQ ID NO.5, and the lasBT gene sequence is shown in SEQ ID NO.6.

[0031]

[0032]

[0033] The target gene IV and lasBT gene were synthesized and their sequences were verified; the PCR reaction system was as follows: The mixture consisted of 25 μL of the initial sample, 2 μL each of the upstream and downstream primers, 2 μL of the gene synthesis fragment, and sterile, enzyme-free water to bring the total volume to 25 μL. The PCR reaction program was as follows: Step 1: 98℃, 2 min; Step 2: 98℃, 10 s; 60℃, 15 s; 75℃, 30 s, repeated 30 times; Step 3: 72℃, 5 min. The target gene was recovered by double digestion with BamHI and SacI, and ligated into the pUCP18 vector using T4 ligase to obtain recombinant plasmids pPR-IV and pPR-lasBT. After transforming the recombinant plasmids into E. coli DH5α competent cells, the recombinant plasmids were extracted from the correctly sequenced strain. Using a gene delivery system, the constructed recombinant plasmids pPR-IV and pPR-lasBT were introduced into *Pseudomonas putida* KT2440 via electroporation to obtain the engineered *Pseudomonas putida* strain KT expressing the exogenous protease. +IV and KT +lasBT The imported parameters are 1200V and 400Ω.

[0034] Table 1 Primers used for vector construction.

[0035] Primer name Sequence 5'-3' SEQ ID NO. IV F CGGAATTCCATGCATAAGAGAACGTACCTGAAT 1 IV R GGATCCTCAGGGCGCGAAGTAGCGGGAGAT 2 lasBT F CCGCGGATCCAAATAAAACGAAAGGCTCAGTCG 3 lasBT R CCCGGAATTCAAAAGGCCATCCGTCAGGAT 4

[0036] II. Strains Culture and Fermentation.

[0037] Pick KT respectively +IV and KT +lasBT Single colonies were inoculated into 5 mL of LB liquid medium containing 30 mg / L gentamicin sulfate and cultured at 30°C and 200 rpm for 24 h to obtain seed culture. A concentration of 10... 7 CFU / mL seed culture was inoculated into crab shell culture medium at a 1% inoculation rate to obtain fermentation broth. At the same time, an empty vector transformed strain was set as a control group. The fermentation parameters were: temperature 30℃, fermentation time 42h, and rotation speed 200rpm.

[0038] III. Data Measurement and Processing.

[0039] 1. Cell growth assay: The dilution plating method was used. In a sterile laminar flow hood, the fermentation broth was diluted 10-fold to 10⁻⁶ cells / mL. -7 Take 100 μL of 10 -7 The diluted solution was evenly spread on LB solid medium and incubated at 30°C for 24 hours. Colony counts were then performed on the plate growth.

[0040] 2. Protein Content Detection: The protein content was determined using the Kjeldahl method. The procedure was as follows: ① Digestion: Weigh 0.5g of fermentation broth into a digestion tube, add 0.3g of copper sulfate and 3g of sodium sulfate, and gently shake to mix. Place a small funnel at the opening of the digestion tube, slowly add 10mL of 70% concentrated sulfuric acid, and then place the digestion tube on a digestion furnace for heating. Initially, the furnace temperature was set to 240℃ and heated for 1 hour. The temperature was then increased to 420℃ and heated for another 2 hours. The furnace was then turned off and allowed to cool naturally to obtain the digested liquid. The blank control was prepared using the same procedure, but without adding fermentation broth. ② Alkaline Distillation: After the digested liquid had completely cooled, the Kjeldahl nitrogen analyzer was started. 10mL of 40% sodium hydroxide solution was slowly added, and 300mg sodium distillation was initiated for 10 minutes to ensure complete volatilization of ammonia. The volatilized ammonia was condensed through a condenser and collected in a 2% boric acid solution to obtain a 2% boric acid solution containing ammonia. ③ Titration: Titrate the 2% boric acid solution containing ammonia with 0.1 mol / L hydrochloric acid standard solution until a faint pink color appears. Record the volume of hydrochloric acid standard solution consumed, and calculate the percentage of protein dry weight using the following formula:

[0041]

[0042] In the formula, V is the volume of hydrochloric acid standard solution consumed during sample titration, in mL; V0 is the volume of hydrochloric acid standard solution consumed during blank titration, in mL; C is the concentration of hydrochloric acid standard solution, in mol / L; m is the sample mass, in g; 14 is the molecular weight of nitrogen; and 6.25 is the coefficient for converting nitrogen to protein.

[0043] 4. Fat Content Detection: The fat content was determined using Soxhlet extraction. The specific steps are as follows: Weigh 5g of the fermentation broth into an evaporating dish, add 20g of quartz sand, evaporate to dryness in a boiling water bath, and then dry in an electric drying oven at 100℃ for 30 minutes. Remove, grind finely, and transfer all the residue into a filter paper tube. Place the filter paper tube into the extraction tube of a Soxhlet extractor, connect it to a receiving flask that has been dried to constant weight, and add anhydrous diethyl ether or petroleum ether through the upper end of the extractor condenser until it reaches two-thirds of the flask's volume. Heat in a water bath for 8 hours of extraction with anhydrous diethyl ether or petroleum ether. Remove the receiving flask, and when only 1mL of solvent remains, evaporate to dryness in a water bath, then dry at 100℃ for 1 hour. Cool in a desiccator for 0.5 hours and weigh. Repeat the above steps until constant weight is achieved. Calculate the percentage of dry fat using the formula:

[0044]

[0045] In the formula, X is the percentage of fat dry weight, in %; M1 is the mass of the receiving bottle and fat after constant weight, in g; M0 is the mass of the receiving bottle, in g; M2 is the mass of the fermentation broth, in g; and 100 is the conversion factor.

[0046] Data processing: Data were analyzed using SPSS Statistics 17.0 software through one-way ANOVA and Tukey's HSD test (p<0.05), and graphs were generated using Origin 2018 software.

[0047] IV. Experimental Results.

[0048] Compared with the control group, KT +IV and KT +lasBT The bacterial growth increased by 95.22% and 301.41% respectively, and the fermentation of crab shells increased KT. +IV and KT +lasBT The amount of bacterial growth, such as Figure 2 As shown. Figure 3 and Figure 4 As shown, substrate assay results indicated that the experimental group exhibited significantly lower percentages of both protein and fat dry weight compared to the control group. The control group had a protein dry weight percentage of 22.04% and a KT... +lasBT Histone dry weight percentage was 15.12%, KT +IV Histone dry weight percentage was 13.14%; fat dry weight percentage in the control group was 5.12%, KT +lasBT The group's fat dry weight percentage was 1.13%, KT +IV The percentage of fat dry weight in the group was 1.14%.

[0049] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.

[0050] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0051] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. Use of a recombinant bacterium for the degradation of crab shells in a fermentation, characterized in that, The recombinant bacteria is *Pseudomonas putida* carrying an exogenous protease gene (…). Pseudomonas putida KT2440, wherein the exogenous protease gene is gene IV with the sequence shown in SEQ ID NO. 5 or gene lasBT with the sequence shown in SEQ ID NO. 6, and the recombinant bacteria are constructed by the following steps: The recombinant overexpression plasmid carrying the exogenous protease gene is transformed into the Pseudomonas putida KT2440, and the recombinant bacteria are obtained through positive clone screening; The recombinant overexpression plasmid carrying the exogenous protease gene is obtained by inserting the exogenous protease gene into a pUCP18 plasmid BamH I and Sac I sites.

2. A method of degrading crab shells, characterized by, The application further relates to a crab shell degradation method, which comprises the following steps: mixing LB liquid medium and crab shell fragments to obtain crab shell culture medium in a mass-volume ratio of 90-99 mL:1-10 g; inoculating the recombinant bacteria of claim 1 in a volume fraction of 0.5%-1.5% of the crab shell culture medium; and fermenting at 28-32 DEG C and 150-250 rpm / min for 40-45 h to degrade the crab shell.

3. The application of the recombinant bacteria in claim 1 in the preparation of a crab shell degradation product. The degradation of the crab shell comprises degradation of protein and fat in the crab shell.

4. The use of the recombinant bacteria according to claim 3 for the preparation of a product for the degradation of crab shells, characterized in that, ​

Images