RPA-LFD primers and probes, kits and applications for detecting Rana chuatsi iridovirus

Abstract

The present invention discloses RPA-LFD primers and probes, a kit and applications for detecting mandarin frog iridovirus, and belongs to the field of virus detection. The present invention proposes an RPA-LFD kit for detecting mandarin frog iridovirus, and the kit mainly comprises a double microsphere system. The present invention also proposes a method for detecting mandarin frog iridovirus, comprising the following steps: S1, extracting nucleic acid from a sample to be tested; S2, adding the nucleic acid extracted in step S1 to the double microsphere system, and reacting to obtain an amplified product; S3, diluting the amplified product, and analyzing the product obtained in step S2 with a nucleic acid detection test strip. The RPA-LFD kit for detecting mandarin frog iridovirus proposed in the present invention does not require the aid of large-scale variable temperature instruments and buffer reagents, and the obtained detection results are comparable to the existing gold standard PCR detection method, and has the advantages of being easy to carry, simple to operate, short detection time and reliable results, and is suitable for outdoor detection scenarios.

Description

Technical Field

[0001] The present invention relates to the field of virus detection, and in particular to RPA-LFD primers and probes, a kit and applications for detecting Rana chuatsi iridovirus. Background Art

[0002] Viral diseases have caused significant losses to the mandarin fish farming industry. The main viruses that infect mandarin fish include infectious spleen and kidney necrosis virus (ISKNV), mandarin fish ranavirus (MRV) and mandarin fish rhabdovirus (SCRV). Among them, mandarin fish infectious spleen and kidney necrosis disease is the most harmful, followed by mandarin fish iridovirus. Mandarin fish iridovirus belongs to the genus Ranavirus of the family Iridoviridae. Mandarin fish iridovirus can be latent in mandarin fish. Once the fish's immunity is low, mandarin fish iridovirus disease is very likely to break out. Therefore, early on-site detection of mandarin fish iridovirus is crucial for the prevention and control of mandarin fish iridovirus disease.

[0003] At present, the detection of mandarin frog iridovirus mainly adopts PCR or fluorescence quantitative PCR detection method targeting major capsid protein (MCP) gene. Liang Hongru et al. established a triple PCR detection method that can simultaneously detect infectious spleen and kidney necrosis virus, mandarin frog iridovirus and mandarin frog rhabdovirus, with high sensitivity, and the detection limit of all three viruses is 10pg / μL. In addition, there are immunohistochemistry and immunofluorescence detection methods based on polyclonal antibodies of mandarin frog iridovirus. However, these methods have high requirements for detection conditions and are only suitable for laboratory detection, and are difficult to be applied to rapid detection in fisheries. The method that can be used for rapid detection of mandarin frog iridovirus in fisheries is the colloidal gold test strip of mandarin frog iridovirus antibody, which can quickly detect mandarin frog iridovirus with whole blood or serum as samples, but the sensitivity of antibody detection is low and cannot completely replace nucleic acid detection.

[0004] Recombinase polymerase amplification (RPA) is an isothermal DNA amplification technology. RPA has many advantages over other nucleic acid amplification methods, especially its application in non-laboratory environments. After RPA reacts at a constant temperature of 30-45°C for 10-30 minutes, the specific oligonucleotide sequence can be amplified, and the amplified product can be combined with lateral flow dipsticks (LFD) for visual interpretation. The combination of the two technologies has extremely low requirements for hardware equipment, and does not require large or expensive instruments and equipment. In addition, RPA has low requirements for nucleic acid samples and does not require complex purification of nucleic acid samples. It has the advantages of high flexibility and strong practicality, and is particularly suitable for pathogen detection in fisheries. At present, there is no RPA-LFD detection method for mandarin frog iridovirus.

[0005] However, RPA is not a perfect technology. Especially when combined with LFD, the problem of false positives caused by nonspecific binding between the reverse primer and the probe is particularly prominent. As we all know, the LFD detection line captures the target amplification product with double labels. If the reverse primer with biotin is paired with the probe with a fluorescent group, a "pseudo-double-labeled product" will be formed, causing a false positive signal to be displayed on the LFD detection line. Due to the low reaction temperature of RPA, even if the primers and probes are screened strictly according to the RPA design principles and the primer sequences are designed in the natural sequence, the appearance of primer dimers is still an inevitable phenomenon. Moreover, RPA-LFD only judges the results by whether there is a color band, and cannot distinguish positive results by product fragment size like agarose gel electrophoresis. Therefore, the reverse primer and probe sequences after amplification efficiency screening still need to be modified to eliminate the false positive phenomenon caused by the reverse primer-probe, such as point mutations. Summary of the invention

[0006] The object of the present invention is to provide an RPA-LFD primer and probe combination for detecting Rana chuatsi iridovirus.

[0007] Another object of the present invention is to provide the use of the above primer and probe combination in the preparation of a kit for detecting the mandarin frog iridovirus.

[0008] In order to achieve the above technical objectives, the present invention adopts the following technical measures:

[0009] A RPA-LFD primer-probe combination for detecting Rana chuatsi iridovirus, wherein the RPA-LFD primer pair sequence is shown in SEQ ID NO.1 and SEQ ID NO.2 in Table 1, wherein the 5' end of the reverse primer MCP-mR is connected with Biotin; the sequence of the probe is shown in SEQ ID NO.3 in Table 1, wherein the 5' end of the probe is labeled with carboxyfluorescein FAM, an extension blocking group C3 Spacer is added to the 3' end, and the 33rd position of the probe sequence is not a base but tetrahydrofuran.

[0010] Table 1. Primer and probe sequences used in the RPA-LFD kit for the Mandarin frog iridovirus

[0011]

[0012] The protection scope of the present invention also includes:

[0013] A kit for detecting mandarin frog iridovirus comprises the above primer and probe combination.

[0014] The above-mentioned kit, preferably, comprises a double microsphere system, a disposable diluent and a nucleic acid detection test strip;

[0015] The double microsphere system: microsphere 1 contains RPA-LFD primer and probe combination, recombinase binding to single-stranded nucleic acid, single-stranded DNA binding protein and strand displacement DNA polymerase; microsphere 2 contains rehydration buffer and magnesium acetate solution.

[0016] Preferably, the microsphere 1 mentioned above contains 10 μmol / L of forward primer, 10 μmol / L of reverse primer, and 5 μmol / L of probe;

[0017] The non-diagnostic detection method of the above-mentioned kit includes:

[0018] S1. Extracting nucleic acid from the sample to be tested;

[0019] S2, adding 50 μL of the nucleic acid extracted in step S1 to the double microsphere system, and starting the reaction immediately after mixing to obtain the amplified product;

[0020] S3. After diluting the amplified product with a disposable diluent, the amplified product obtained in step S2 is analyzed with a nucleic acid detection test strip.

[0021] Further, in step S3, the amplification product is analyzed using a nucleic acid detection test strip: if bands appear on both the quality control line (C) and the detection line (T) on the test strip, it is positive; if a band appears on the quality control line (C) of the test strip but there is no band on the detection line (T), it is negative; if there is no band on the quality control line (C), the reaction is invalid.

[0022] Application of the primer and probe combination in the preparation of a kit for detecting the mandarin frog iridovirus.

[0023] Compared with the prior art, the beneficial effects of the present invention include:

[0024] 1) Save time: PCR takes at least 60 minutes to complete a reaction, while RPA takes less than 30 minutes, and can even reach the nucleic acid concentration detected by the test strip in 10 minutes, greatly shortening the time for nucleic acid amplification.

[0025] 2) Lower the reaction temperature: RPA can complete the experiment at a constant temperature of 35-45°C, which is much lower than the 60-95°C of PCR.

[0026] 3) The method is simple and easy to carry: the enzymes required for amplification, the RPA-LFD primer probe combination and the buffer solution are all made into freeze-dried microspheres. During amplification, it is only necessary to add the extracted nucleic acid to the double microsphere system and start the reaction after mixing. The detection method of the present invention has low professional requirements for operators, is suitable for on-site detection in fisheries, and can also be used for scientific research on MRV.

[0027] 4) Strong specificity: The probe sequence is added to the kit of the present invention to increase the specificity of the detection.

[0028] 5) High sensitivity and can be read by naked eyes: directly observe the color of the test strip with the naked eye. If both the test line and the quality control line are colored, it can be qualitatively judged as MRV positive. The sensitivity is comparable to or even higher than PCR widely used in molecular detection laboratories. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Schematic diagram of the comparison analysis and modification of the reverse primer and probe sequences;

[0030] Figure 2 Comparison of RPA-LFD results between MCP-F / R / Probe and MCP-F / mR / mProbe;

[0031] Among them, MCP-R / Probe is the original sequence before base modification, and MCP-mR / mProbe is the modified sequence.

[0032] Figure 3 To optimize the reaction conditions of the RPA-LFD detection system;

[0033] Among them: (A) the effect of different reaction temperatures on the amplification effect of RPA-LFD, (B) the effect of different reaction times on the amplification effect of RPA-LFD, (C) the effect of different probe concentrations on the amplification effect of RPA-LFD.

[0034] Figure 4This is the result of RPA-LFD specific detection.

[0035] Figure 5 To test the sensitivity of PCR and RPA-LFD using MRV genomic DNA;

[0036] Among them: (A) PCR detection results; (B) RPA-LFD detection results.

[0037] Figure 6 To test the sensitivity of PCR and RPA-LFD using pMD18-MCP plasmid;

[0038] Among them: (A) PCR detection results; (B) RPA-LFD detection results. DETAILED DESCRIPTION

[0039] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0040] In certain embodiments, the products are analyzed by 2% agarose gel electrophoresis.

[0041] In certain embodiments, the product is analyzed using a nucleic acid test strip: if bands appear on both the control line and the test line of the test strip, it is positive; if a band appears on the control line of the test strip but no band appears on the test line, it is negative; if there is no band on the control line, the reaction is invalid.

[0042] It should be noted that the DNA constant temperature rapid detection kit (product number: WLN8203KIT), dual microsphere system customization and nucleic acid detection test strips (product number: WLFS8204) in the following examples were all purchased from Weifang Anpu Future Biotechnology Co., Ltd., China.

[0043] Embodiment 1:

[0044] Design and optimization of primer pair-probe sequence for MRV RPA-LFD

[0045] (1) Design of primer pairs and probe sequences

[0046] The present invention designs RPA-LFD primer pairs and probes according to the gene sequence (MG941005.3) of the MRV major capsid protein (MCP) published on GenBank. Then, a sequence comparison analysis is performed by BLAST to compare the similarity between the designed primer and probe sequences and the gene sequences of common viruses of mandarin fish such as ISKNV and SCRV, and determine the specificity of the primer pairs and probes.

[0047] (2) Optimization of reverse primer and probe sequences

[0048] After sequence analysis and base modification, we modified a total of four bases between the reverse primer and the probe (e.g. Figure 1 The modified primer-probe set (MCP-F / mR / mProbe) was compared with the unmodified one (MCP-F / R / Probe) to explore whether the base modification had any effect on the RPA amplification efficiency. Figure 2 The results showed (RPA-LFD reaction system as shown in Example 2) that the modified primer-probe set eliminated the weak false positive signal and presented a normal negative result, and in the positive group, there was no obvious difference before and after the modification, that is, the modification of the reverse primer and probe bases had no significant effect on the amplification efficiency.

[0049] The following is the modified optimal primer pair-probe combination (primers and probes are synthesized by Qingke Biotechnology Co., Ltd.):

[0050]

[0051] The 5' end of the reverse primer MCP-mR is connected with Biotin; the 5' end of the probe is labeled with carboxyfluorescein FAM, and the extension blocking group C3 Spacer is added to the 3' end. The 33rd position of the probe sequence is not a base but tetrahydrofuran.

[0052] Embodiment 2:

[0053] Optimization of reaction system and conditions for RPA-LFD of MRV

[0054] (1) Extraction of viral genomic DNA

[0055] The supernatant after centrifugation of the MRV cell culture medium was used to extract the MRV genomic DNA according to the instructions of the viral DNA / RNA extraction kit (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.), and finally eluted with 30 μL of DNase- and RNase-free water. The extracted DNA was stored at -20°C for use.

[0056] (2) RPA-LFD reaction system

[0057] The reaction system is: 2μL forward primer, 2μL reverse primer, 0.6μL probe, 2μL DNA template, 11.5μL DNase- and RNase-free water and 29.4μL A buffer are added to the reaction tube containing freeze-dried enzyme powder, 2.5μL starting solution B buffer is added to the reaction tube cap, the tube cap is closed, centrifuged together, and vortexed to mix to ensure consistent starting reaction time.

[0058] Result interpretation: Take 10 μL of the amplified product and dilute it with DNase-free and RNase-free water to a total volume of 200 μL, then add 80 μL of the diluted product to the nucleic acid detection test strip for color development. The color development time should be controlled within 10 minutes.

[0059] Use nucleic acid test strips to analyze the amplified products: if bands appear on both the control line (C) and the test line (T) on the test strip, it is positive; if a band appears on the control line (C) but not on the test line (T), it is negative; if there is no band on the control line (C), the reaction is invalid.

[0060] (3) Reaction temperature optimization

[0061] When determining the optimal reaction temperature of the RPA-LFD method, we tested 11 different reaction temperatures, namely 20°C, 25°C, 30°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 45°C, and 50°C, and set the incubation time to 15 min. The test results are shown in Figure 2. Figure 3 As shown in A, at 30°C, a relatively clear positive band appears on the test strip test line. Between 35 and 45°C, there are obvious and clear bands on the test strip test line with no difference. When the temperature is 50°C, no band appears on the test strip test line. The results show that the reaction temperature of the test can be 30-45°C, and the optimal reaction temperature is 35-45°C. We choose 39°C as the reaction temperature for subsequent experiments.

[0062] (4) Optimization of response time

[0063] When determining the optimal reaction time of the RPA-LFD method, we set 8 different times at 39°C, namely 1min, 5min, 10min, 15min, 20min, 25min, 30min, and 35min. The test results are as follows: Figure 3 As shown in B, when the reaction time is 5 minutes or less, there is no band on the test strip test line. When the reaction time is 10 minutes or more, clear and distinct bands appear on the test strip test line. In order to make the test results more stable, we choose 15 minutes as the reaction time for subsequent experiments.

[0064] (5) Optimization of probe concentration

[0065] The optimal reaction conditions after optimization were 39°C for 15 min, and the optimal probe concentration of RPA-LFD was further explored. The probe concentrations were set to 10μM, 7.5μM, 5μM, 2.5μM, 1.25μM, 0.625μM, 0.313μM, and 0.156μM, respectively. A blank control group was also set up. The results are shown in the figure. Figure 3 As shown in C, the bands were still clear and bright when the probe concentration was 5 μM, and the corresponding blank control group also showed a normal negative result. Therefore, 5 μM was selected as the optimal probe concentration for RPA-LFD.

[0066] Embodiment 3:

[0067] Integrate the reaction reagents into dual microspheres and perform RPA-LFD specific detection of MRV

[0068] The integrated reaction reagent is a double microsphere: In order to improve the convenience of using this detection kit in fisheries, we integrated the optimized detection reagent and lyophilized it into a double microsphere. The double microsphere reaction system is: microsphere 1 contains 10μmol / L forward primer, 10μmol / L reverse primer, 5μmol / L probe, recombinase, single-stranded DNA binding protein and strand displacement DNA polymerase; microsphere 2 contains rehydration buffer and magnesium acetate solution. The reaction only needs to add 2μL of purified nucleic acid and 48μL of enzyme-free water, or directly add 50μL of the supernatant of crude nucleic acid release product, and the reaction can be started after mixing.

[0069] RPA-LFD specificity detection of MRV: The genomes of MRV, infectious spleen and kidney necrosis virus (ISKNV), mandarin fish rhabdovirus (SCRV), Aeromonas salmonicida, Edwardsiella tarda, Aeromonas hydrophila, and Flavobacterium cloumnare were extracted and preserved by our laboratory. The specificity of RPA-LFD was detected using the nucleic acids of MRV, ISKNV, SCRV, Aeromonas salmonicida, Edwardsiella tarda, Aeromonas hydrophila, and Flavobacterium cloumnare as templates, and a blank control group was set up. The results are shown in Figure 2. Figure 4 As shown, only the test strip using MRV as template showed a band on the test line, while the others did not show a band on the test line, indicating that this method is specific for detecting MRV.

[0070] Embodiment 4:

[0071] RPA-LFD sensitivity detection of MRV

[0072] (1) Sensitivity testing using MRV genomic DNA as a template

[0073] The concentration of the extracted MRV genomic DNA was measured with a Nanodrop-2000 spectrophotometer and diluted to 10 ng / μL. The DNA with a concentration of 10 ng / μL was diluted tenfold, and 8 concentrations of genomic DNA with a concentration of 10 ng / μL to 1 fg / μL were selected as templates for RPA-LFD amplification at 39°C for 15 min. A blank control group was set up to determine the minimum detection concentration of RPA-LFD, and a sensitivity analysis was performed. The results were compared with PCR.

[0074] The nucleotide sequences of the primer pairs used in the PCR method are as follows:

[0075] Forward primer: 5'-TGTGCTCAACTCTTGGCTGGTC-3',

[0076] Reverse primer: 5'-TGATGGGAATGGCGGGTGC-3'

[0077] The reaction system was: 1 μL forward primer (10 μM), 1 μL reverse primer (10 μM), 1 μL template, 10 μL 2× Taq Master Mix (Nanjing Novogene Biotech Co., Ltd.) and 7 μL ddH2O.

[0078] The amplification conditions were pre-denaturation at 94°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, for a total of 32 cycles; and extension at 72°C for another 10 min.

[0079] Test results such as Figure 5 As shown, RPA-LFD is one order of magnitude more sensitive than the PCR method, and the minimum detection concentration of MRV genomic DNA by RPA-LFD is 10 pg / μL.

[0080] (2) Sensitivity testing using plasmid as template

[0081] The PCR primers for amplifying the MCP gene of MRV are as follows:

[0082] Forward primer: 5'-ATGTCTTCTGTTACGGGTTC-3',

[0083] Reverse primer: 5'-TTACAGGATGGGGAAACCCA-3'

[0084] The reaction system and amplification procedure are consistent with those in Example 4. The PCR product was identified by electrophoresis in a 2% agarose gel. The PCR product was recovered using an agarose gel DNA recovery kit (purchased from Guangzhou Meiji Biotechnology Co., Ltd.), connected to the pMD18-T cloning vector (TAKARA, Japan), and transformed into Escherichia coli competent cells DH5α (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), and then coated on a LB medium plate containing 100 mg / L ampicillin and cultured at 37°C for 12 hours. The positive single colonies were screened into a liquid culture medium containing ampicillin and cultured overnight at 37°C. Finally, the plasmid was extracted using an endotoxin-free plasmid mini-extraction kit (purchased from Tiangen Biochemical Technology Co., Ltd.), and the pMD18-MCP concentration extracted was measured using a Nanodrop-2000 spectrophotometer after being sent to a sequencing company for sequencing of positive pMD18-MCP.

[0085] According to the copy number calculation formula: copies / μL = 6.02×10 23 ×Plasmid concentration (ng / μL)×10 -9 / (plasmid base number × 660), calculate the copy number of the extracted recombinant plasmid pMD18-MCP, and dilute it to 10 7 copies / μL. 7 The plasmid with 10 copies / μL was diluted tenfold, and the copy number was 10 7 ~10 0 The plasmid with a concentration of 10 copies / μL was amplified by RPA-LFD at 39°C for 15 min. A blank control group was set up, i.e. no template was added and the template volume was supplemented with enzyme-free water. The minimum detection concentration of RPA-LFD was determined, and a sensitivity analysis was performed. The results were compared with PCR.

[0086] Test results such as Figure 6 As shown in Figure 2, RPA-LFD is one order of magnitude more sensitive than PCR. The minimum detection concentration of pMD18-MCP plasmid by RPA-LFD is 10 2 copies / μL.

[0087] In summary, the MRV RPA-LFD detection method established in the present invention has a high sensitivity and is comparable to the existing gold standard PCR method.

[0088] The specific implementation of the present invention described above does not constitute a limitation on the protection scope of the present invention. Any other corresponding changes and modifications made based on the technical concept of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. The RPA-LFD primer and probe combination used to detect Rana chuatsi iridovirus is the following primer pair and probe: MCP-F: ACAACATGATTGGCAACACTAGCGATCTCGTC, MCP-mR: CATCTACATCTGCTCCACCACCATATCCCT and MCP-mProbe: TGCCTAAAGTCACCCTGCCTTACAACGAAATTGAATCACCATCCGCC; the 33rd position of the probe MCP-mProbe is tetrahydrofuran.

2. Use of the primer and probe combination according to claim 1 in the preparation of an RPA-LFD detection kit for Rana chuatsi iridovirus.

3. An RPA-LFD detection kit for Rana chuatsi iridovirus, comprising the primer and probe combination of claim 1.

4. The kit according to claim 3, characterized in that: The kit comprises a double microsphere system, a disposable diluent and a nucleic acid detection test strip; The double microsphere system: microsphere 1 contains RPA-LFD primer and probe combination, recombinase binding to single-stranded nucleic acid, single-stranded DNA binding protein and strand displacement DNA polymerase; microsphere 2 contains rehydration buffer and magnesium acetate solution.

5. The kit according to claim 4, characterized in that: The microsphere 1 contains 10 μmol / L of the forward primer MCP-F, 10 μmol / L of the reverse primer MCP-mR, and 5 μmol / L of the probe MCP-mProbe.

6. The non-diagnostic detection method of the kit of claim 4, comprising: S1. Extracting nucleic acid from the sample to be tested; S2, adding 50 μL of the nucleic acid extracted in step S1 to the double microsphere system, and starting the reaction immediately after mixing to obtain the amplified product; S3. After diluting the amplified product with a disposable diluent, the amplified product obtained in step S2 is analyzed with a nucleic acid detection test strip.

7. The method according to claim 6, wherein the determination method for analyzing the amplification product using the nucleic acid detection test strip is: if bands appear on both the quality control line and the detection line on the test strip, it is positive; if a band appears on the quality control line of the test strip, but there is no band on the detection line, it is negative; if there is no band on the quality control line, the reaction is invalid.

Images