Method for repairing HBA2 gene mutation by single-base editing and its application

Through the combination of a single-base editor and gRNA, efficient and safe repair of Hb-CS mutations is achieved, and the problems of low gene editing efficiency and poor safety in the existing technology are solved, genome stability and safety are ensured, and the expression of α/β globin is balanced.

CN118056014BActive Publication Date: 2025-07-08GUANGZHOU REFORGENE MEDICINE CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202380013633.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2022-04-06
Filing Date
2023-03-24
Publication Date
2025-07-08
Estimated Expiration
2043-03-24

AI Technical Summary

Technical Problem

The prior art has problems such as low gene editing efficiency, poor safety, and possible chromatin conformational changes and genome instability in the treatment of alpha thalassemia. In particular, repair methods for Hb-CS type mutations have failed to achieve effective and safe treatment levels.

Method used

The combination of a single-base editor and gRNA is used to accurately edit the target cytosine bases in the HBA2 gene and convert them into thymine, achieving efficient repair of Hb-CS mutations, avoiding double-strand breaks and genomic instability, and ensuring safety.

Benefits of technology

Efficient and safe repair of Hb-CS mutations is achieved, double-strand breaks and genomic instability are avoided, and the risk of oncogene activation or tumor suppressor gene inactivation is reduced. The repaired gene expression is naturally regulated, balanced the expression of α/β globin.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118056014B_ABST
    Figure CN118056014B_ABST
Patent Text Reader

Abstract

A method for single-base editing to repair HBA2 gene mutations and its application, belonging to the field of gene editing technology. This method includes the following steps: contacting a single-base editor and gRNA with the HBA gene sequence to be edited and repaired, so that the codon target cytosine base at CD142 in the HBA gene sequence is deaminated and converted into thymine. This method can accurately edit pathogenic mutation sites, does not produce double-strand breaks, does not affect chromatin conformation and genomic stability; nor does it produce random insertions of large fragment genes in the genome, and has a low impact on oncogene activation or tumor suppressor gene inactivation; it will not produce random insertions / deletions at other sites in the genome; and the expression of the repaired target gene is regulated by all natural HBA2 regulatory elements, having high safety and being more capable of balancing the expression of α / β globin.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of gene editing, and in particular to a method for single-base editing to repair HBA2 gene mutations and its application. Background Art

[0002] Thalassemia is a hereditary hemolytic anemia that is widely distributed south of the Yangtze River in China, with the Guangxi region being the most severely affected. According to gene typing, clinically, mainly α-thalassemia and β-thalassemia occur. The mutations causing α-thalassemia are divided into deletion types and non-deletion types. Non-deletion type α-thalassemia is caused by a "point mutation" of α-gene nucleotides. Among α-thalassemia in Guangdong, Guangxi, Sichuan and other places, the non-deletion type accounts for 35% - 60%. There are 3 common non-deletion type α-thalassemias in China: Hb-CS (CD142), Hb-QS (CD125) and Hb-WS (CD122). Among them, patients with the Hb-CS type have relatively the most severe condition, low hemoglobin, and low survival rate.

[0003] Hemoglobin CS (Hb-CS, Haemoglobin-Constant Spring, α142, Term→Gln, TAA>CAA (α2), αcsα / ) is a non-deletion form of α-thalassemia (α-Thal), with a nucleotide substitution (UAA>CAA) at the stop codon CD142 of the α2-globin gene (HBA2). If Hb-CS is combined with the α2α1 double deletion type thalassemia mutation (such as α SEA ,α MED ,α THAI ), when only one normal α1-globin gene (HBA1) remains, the genotype is α CS α / --, and its clinical manifestations and blood picture are similar to those of hemoglobin H disease (HbH), which is called HbH-CS disease. In addition, individuals affected by HbH-CS disease usually have more severe anemia symptoms and are prone to obvious hepatosplenomegaly. Especially compared with individuals with three-gene deletions involving the α-globin gene (-- / -α), HbH-CS patients have a greater need for blood transfusion.

[0004] Hematopoietic stem cell (HSC) transplantation is an effective means and the only way to cure severe thalassemia, but the lack of HLA-matched healthy donors, immune complications and viral vector safety issues limit its use.

[0005] In conventional techniques, there are also some gene therapy methods for α-thalassemia, such as overexpressing genes such as α-globin and ζ-globin. However, such methods have significant safety problems. For example, the overexpressed globin gene copies randomly integrate into thousands of different sites in the genome, leading to the possibility of insertion mutations and malignancies. In addition, none of these techniques have been proven effective and safe in patient cells, animal experiments, or clinical trials.

[0006] The Hb-CS locus can also be repaired by nuclease cleavage of the target site and homology-mediated gene repair. However, the efficiency of this method is currently low and insufficient to reach the level of treatment. At the same time, the cleavage method will produce indels, resulting in unnatural forms of α-globin mutations, and there are also safety hazards. In addition, the cleavage method may have a certain off-target risk, such as random insertions / deletions at other loci, or the genomic double-strand break is likely to cause changes in chromatin conformation, affecting genomic stability. Summary of the Invention

[0007] Based on this, it is necessary to provide a method for single-base editing to repair HBA2 gene mutations in view of the above problems. Using this method, pathogenic mutation sites can be precisely edited without generating double-strand breaks, without affecting chromatin conformation and genomic stability; nor randomly inserting large fragments of genes into the genome, having a low impact on oncogene activation or tumor suppressor gene inactivation; and not generating random insertions / deletions at other sites in the genome. At the same time, the expression of the repaired target gene is regulated by all natural HBA2 regulatory elements, with high safety and better balancing the expression of α / β globin.

[0008] The present invention discloses a method for single-base editing to repair HBA2 gene mutations, including the following steps: contacting a single-base editor and gRNA with the HBA2 gene sequence to be edited and repaired, so that the target cytosine base in the codon (CAA) at CD142 of the mutant HBA2 gene is deaminated and converted into thymine (TAA).

[0009] The above method for single-base editing to repair HBA2 gene mutations utilizes the characteristic that a single-base editor can precisely modify a single base in the genome without causing DNA double-strand breaks. The single-base editor and gRNA are contacted with the HBA2 gene with pathogenic mutations, so that the target cytosine (C) base in the HBA2 gene is deaminated, resulting in the conversion of cytosine (C) to thymine (T) in the polynucleotide target site encoding α-globin, providing a more efficient and safer method for repairing Hb-CS mutations.

[0010] It is understandable that the above method for single-base editing to repair HBA2 gene mutations is also a method for editing polynucleotides encoding α-globin, which includes contacting the HBA2 polynucleotide sequence encoding α-globin with a fusion protein and a guiding nucleotide sequence (such as gRNA, etc.). Among them, the fusion protein includes: a programmable DNA-binding protein domain that binds to the guiding nucleotide sequence and a cytosine deaminase domain; the guiding nucleotide sequence is to target the fusion protein to the target cytosine (C) base in the polynucleotide encoding HBA2; subsequently, the contact causes the fusion protein to deaminate the target C base, thereby causing a change from cytosine (C) to thymine (T) in the polynucleotide encoding HBA.

[0011] In some embodiments, the method for single-base editing to repair HBA2 gene mutations is used for non-therapeutic purposes, such as scientific research, etc.

[0012] The present invention also discloses the application of the above method for single-base editing to repair HBA2 gene mutations in the preparation of drugs for the treatment of α-thalassemia.

[0013] The present invention also discloses a composition for repairing HBA2 gene mutations, including: a single-base editor and gRNA,

[0014] The single-base editor includes a target nucleic acid binding structural unit and a deaminase structural unit, and the deaminase structural unit includes a cytosine deaminase active domain;

[0015] The gRNA includes a guiding sequence and a backbone sequence that binds to the single-base editor, and the guiding sequence targets the cytosine base in the CD142 codon (CAA) of the mutant HBA2 gene.

[0016] It is understandable that the above "targeting" means that the gRNA guides the single-base editor to the vicinity of the cytosine of the CD142 codon of the mutant HBA2 gene for editing of this cytosine. Generally speaking, this guiding sequence binds to the antisense strand of the cytosine base of the CD142 codon of the mutant HBA2 gene.

[0017] The target nucleic acid binding structural unit in the above single-base editor is a structure that can accurately locate and bind to the target nucleic acid editing region, which can be a nucleotide or a protein polypeptide, etc. It is understandable that in some embodiments, the organic connection means that the target nucleic acid binding structural unit, the deaminase structural unit or some of their active domains are connected by peptide bonds or linker peptides to form a fusion protein. And it can include one or more uracil glycosylase inhibitor UGI domains, one or more NLSs, one or more Gam proteins, etc. to improve the base repair efficiency, as long as it has the function of deaminating and converting the cytosine (C) base into thymine (T).

[0018] In some embodiments, the deaminase structural unit contained in the single-base editor may be a deaminase protein or its active domain, or a polypeptide capable of recruiting a deaminase protein, or a nucleotide-binding motif capable of recruiting a deaminase protein, and the nucleotide-binding motif may be linked to the gRNA, etc.

[0019] The following lists some cytosine deaminases that can achieve the above deamination function, including but not limited to: APOBEC1 deaminase, APOBEC2 deaminase, APOBEC3A deaminase, APOBEC3B deaminase, APOBEC3C deaminase, APOBEC3D deaminase, APOBEC3F deaminase, APOBEC3G deaminase, APOBEC3H deaminase, APOBEC4 deaminase, activation-induced deaminase (AID), and pmCDA1 and its variants or combinations thereof. Also included are cytosine deaminase variants, such as Anc689APOBEC, YE1 APOBEC, etc.

[0020] For the gRNA in the composition, it can be a single-molecule gRNA, a two-molecule gRNA, or a multi-molecule gRNA. The gRNA can be replaced with other RNA molecules containing a guiding sequence capable of complementary base pairing with the target site and a backbone sequence linked or bound to the single-base editor.

[0021] In some embodiments, the target nucleic acid binding structural unit includes a programmable nucleic acid binding protein, that is, a nucleic acid binding protein that can be programmed to target any desired nucleotide sequence within the genome. To program the nucleic acid binding protein to bind the desired nucleotide sequence, the nucleic acid binding protein can be modified to change its binding specificity, such as a zinc finger DNA binding domain, a zinc finger nuclease (ZFN), or a transcription activator-like effector protein (TALE), etc.

[0022] In some embodiments, the target nucleic acid binding structural unit is selected from: CRISPR / Cas nuclease, ZFN, TALEN, Argonaute (AGO protein).

[0023] The above-mentioned Argonaute refers to AGO a protein, and the AGO protein can bind to siRNA, and through the binding of siRNA to mRNA, thereby cleaving the target nucleotide, and has the characteristics of the "programmable nucleic acid binding protein" of the present invention.

[0024] It can be understood that the CRISPR / Cas nuclease in the above-mentioned target nucleic acid binding structural unit is preferably a protein with catalytic activity partially inactivated or completely inactivated, and only its positioning function is utilized.

[0025] In some embodiments, the guide nucleotide sequence-programmable nucleic acid binding protein can be a DNA binding protein or an RNA binding protein.

[0026] In some embodiments, the CRISPR / Cas nuclease is selected from at least one of: Cas9, CasX, CasY, Cpf1, C2c1, cas12b2, cas12h, cas12i, cas12g, C2c2, C2c3, C2c4, C2c5, C2c6, C2c7, c2c8, c2c9, c2c10, cas14a, cas14b, cas14c, Cas13d, and variants thereof.

[0027] In some embodiments, the CRISPR / Cas nuclease is selected from at least one of: Cas9, CasX, CasY, Cpf1, C2c1, cas12b2, cas12h, cas12i, cas12g, C2c3, C2c4, C2c5, c2c8, c2c9, c2c10, cas14a, cas14b, cas14c, and variants thereof.

[0028] In some embodiments, the CRISPR / Cas nuclease has nickase activity.

[0029] In some embodiments, the CRISPR / Cas nuclease is a Cas9 variant with nickase activity.

[0030] In some embodiments, the target nucleic acid binding structural unit is selected from: a nuclease-inactive Cas9 (dCas9) domain, a nuclease-inactive Cpf1 domain, a nuclease-inactive Argonaute domain, or a Cas9 (nCas9) domain with partial nuclease activity deletion, or variants thereof, or combinations, etc.

[0031] In some embodiments, the CRISPR / Cas nuclease is selected from: Cas9 nickase variants (nCas9).

[0032] It can be understood that the programmable nucleic acid binding protein can have an optimal PAM (protospacer adjacent motif) site, or can have no optimal PAM site or no PAM site restriction.

[0033] In some embodiments, the target nucleic acid binding structural unit has no PAM site restriction.

[0034] In some embodiments, the target nucleic acid binding structural unit has an optimal PAM site. For example, the optimal PAM site is NGG, NG, NNNNCC, NAA, NAAN, NGGNG, NNNNGATT, NNNNCNDD, NNNNCAAA, NNNNCRAA, NNAGAAW, NNGRRN, TTN, TTTV / TTTN, ATTN or TTCN (where N represents A / T / C / G, R represents A / G, W represents A / T, and V represents A / C / G), etc.

[0035] In some embodiments, the CRISPR / Cas nuclease is selected from at least one of: SpRY variant, NG-nCas9 variant, NGG-nCas9 variant. The above SpRY variant is the SpRY nuclease variant without PAM site restriction, the NG-nCas9 variant is nCas9 with an optimal PAM of NG, and the NGG-nCas9 is nCas9 with an optimal PAM of NGG.

[0036] In some embodiments, the cytosine deaminase domain comprises deaminases of the apolipoprotein B mRNA-editing complex (APOBEC) family.

[0037] In some embodiments, the deaminase structural unit is selected from: APOBEC1 deaminase, APOBEC2 deaminase, APOBEC3A deaminase, APOBEC3B deaminase, APOBEC3C deaminase, APOBEC3D deaminase, APOBEC3F deaminase, APOBEC3G deaminase, APOBEC3H deaminase, APOBEC4 deaminase, activation-induced deaminase (AID), and pmCDA1 and its variants or combinations.

[0038] In some embodiments, the target nucleic acid binding structural unit is organically linked to the deaminase structural unit. The target nucleic acid binding structural unit in the above single-base editor is a structure that can accurately locate and bind to the target nucleic acid editing region, which can be a nucleotide or a protein polypeptide, etc.

[0039] It can be understood that in some embodiments, the target nucleic acid binding structural unit, the deaminase structural unit or a partial active domain thereof is organically linked through a peptide bond or a linker peptide to form a fusion protein. And it can include one or more uracil glycosylase inhibitor UGI domains, one or more NLSs, one or more Gam proteins, etc., to improve the base repair efficiency, as long as it has the function of deaminating and converting cytosine (C) bases into thymine (T) bases.

[0040] In some embodiments, the cytosine deaminase variant is the Anc689 APOBEC variant.

[0041] In some embodiments, the cytosine deaminase variant is a W90Y / R126E APOBEC variant.

[0042] In some embodiments, the single-base editor is selected from at least one of SpRY-CBE, AncBE, and YE1-CBE.

[0043] The above single-base editor is a fusion protein formed by the partial active domains of a target nucleic acid binding unit and a deaminase unit being organically linked by a peptide bond or a linker peptide.

[0044] The above SpRY-CBE is a connection of a SpRY nuclease without optimal PAM site restriction and a cytidine deaminase (SpRY-CBE). Preferably, the SpRY nuclease-cytidine deaminase is linked to 2 UGIs. Preferably, the SpRY nuclease-cytidine deaminase-2×UGI is linked to 2 or more NLSs. Preferably, it is a CBE4max-SpRY base editor.

[0045] The cytidine deaminase of the above AncBE is an Anc689 APOBEC variant. Preferably, the target nucleic acid binding unit protein is a nCas9 nuclease with impaired activity. Preferably, nCas9-Anc689 APOBEC is linked to 2 UGIs, or nCas9-Anc689 APOBEC-2×UGI is linked to 2 or more NLSs. More preferably, it is an AncBE4max base editor.

[0046] The above YE1-CBE is a YE1 APOBEC containing the W90Y+R126E mutation in APOBEC. Preferably, a programmable nucleic acid binding protein is linked to YE1 APOBEC. Preferably, the programmable nucleic acid binding protein-YE1 APOBEC-2×UGI is linked to 2 or more NLSs. Preferably, it is a YE1-BE4max base editor.

[0047] In some embodiments, the guiding sequence of the gRNA binds to or is reverse complementary to the target region of Chr16:173548-173648. It can be understood that the above region is the region where the cytosine of the CD142 codon of the mutant HBA2 gene to which the single-base editor is to be guided by the gRNA. Due to the single nucleotide polymorphism (SNP) of the organism, there may be some natural mutations in the above region. The guiding sequence of the gRNA can be adjusted and designed according to the natural mutations, or allow 1-5 base mismatches and be able to bind to the above region, then the object of the present invention can be achieved.

[0048] In some embodiments, the guide sequence of the gRNA binds or is reverse complementary to the target regions of Chr16:173589-173613, Chr16:173588-173612, Chr16:173586-173610, Chr16:173590-173614, Chr16:173587-173611, Chr16:173590-173609, Chr16:173596-173615.

[0049] In some embodiments, the base at the 3'-end of the gRNA guide sequence binds to the base at the 5'-end of the antisense strand of the target region. Binding the base at the 3'-end of the gRNA guide sequence to the base at the 5'-end of the antisense strand of the genomic region defines the Hb-CS mutation locus, i.e., defines the distance between the Hb-CS mutant base pair and the 3'-end or the PAM site of the gRNA.

[0050] In some embodiments, the guide sequence of the gRNA is complementary to Chr16:173594-173613, Chr16:173599-173613, Chr16:173598-173613, Chr16:173597-173613, Chr16:173596-173613, Chr16:173595-173613, Chr16:173593-173613, Chr16:173592-173613, Chr16:173591-173613, Chr16:173590-173613, Chr16:173589-173613, Chr16:173593-173612, Chr16:173598-173612, Chr16:173597-173612, Chr16:173596-173612, Chr16:173595-173612, Chr16:173594-173612, Chr16:173592-173612, Chr16:173591-173612, Chr16:173590-173612, Chr16:173589-173612, Chr16:173588-173612, Chr16:173591-173610, Chr16:173596-173610, Chr16:173595-173610, Chr16:173594-173610, Chr16:173593-173610, Chr16:173592-173610, Chr16:173590-173610, Chr16:173589-173610, Chr16:173588-173610, Chr16:173587-173610, Chr16:173586-173610, Chr16:173595-173614, Chr16:173600-173614, Chr16:173599-173614, Chr16:173598-173614, Chr16:173597-173614, Chr16:173596-173614, Chr16:173594-173614, Chr16:173593-173614, Chr16:173592-173614, Chr16:173591-173614, Chr16:173590-173614, Chr16:173592-173611, Chr16:173596-173611, Chr16:173596-173611, Chr16:173595-173611, Chr16:173594-173611,Chr16:173593-173611, Chr16:173591-173611, Chr16:173590-173611, Chr16:173589-173611, Chr16:173588-173611, Chr16:173587-173611, Chr16:173590-173609, Chr16:173594-173609, Chr16:173596-173615, Chr16:173600-173615 are reverse complementary or have 1-5 mismatches.

[0051] In some embodiments, the guiding sequence of the gRNA is complementary to Chr16:173594-173613, Chr16:173598-173613, Chr16:173597-173613, Chr16:173596-173613, Chr16:173595-173613, Chr16:173593-173613, Chr16:173592-173613, Chr16:173591-173613, Chr16:173590-173613, Chr16:173589-173613, Chr16:173593-173612, Chr16:173597-173612, Chr16:173596-173612, Chr16:173595-173612, Chr16:173594-173612, Chr16:173592-173612, Chr16:173591-173612, Chr16:173590-173612, Chr16:173589-173612, Chr16:173588-173612, Chr16:173591-173610, Chr16:173595-173610, Chr16:173594-173610, Chr16:173593-173610, Chr16:173592-173610, Chr16:173590-173610, Chr16:173589-173610, Chr16:173588-173610, Chr16:173587-173610, Chr16:173586-173610, Chr16:173595-173614, Chr16:173599-173614, Chr16:173598-173614, Chr16:173597-173614, Chr16:173596-173614, Chr16:173594-173614, Chr16:173593-173614, Chr16:173592-173614, Chr16:173591-173614, Chr16:173590-173614, Chr16:173592-173611, Chr16:173596-173611, Chr16:173595-173611, Chr16:173594-173611, Chr16:173593-173611, Chr16:173591-173611, Chr16:173590-173611, Chr16:173589-173611, Chr16:173588-173611,Reverse complement of Chr16:173587-173611 or with 1-5 mismatches.

[0052] In some embodiments, the guiding sequence of the gRNA is reverse complementary to or has 1-5 mismatches with Chr16:173594-173613, Chr16:173598-173613, Chr16:173597-173613, Chr16:173596-173613, Chr16:173595-173613, Chr16:173593-173613, Chr16:173592-173613, Chr16:173591-173613, Chr16:173590-173613, Chr16:173589-173613;

[0053] In some embodiments, the guiding sequence of the gRNA is reverse complementary to or has 1-5 mismatches with Chr16:173593-173612, Chr16:173597-173612, Chr16:173596-173612, Chr16:173595-173612, Chr16:173594-173612, Chr16:173592-173612, Chr16:173591-173612, Chr16:173590-173612, Chr16:173589-173612, Chr16:173588-173612;

[0054] In some embodiments, the guiding sequence of the gRNA is reverse complementary to or has 1-5 mismatches with Chr16:173591-173610, Chr16:173595-173610, Chr16:173594-173610, Chr16:173593-173610, Chr16:173592-173610, Chr16:173590-173610, Chr16:173589-173610, Chr16:173588-173610, Chr16:173587-173610, Chr16:173586-173610;

[0055] In some embodiments, the guiding sequence of the gRNA is reverse complementary to or has 1-5 mismatches with Chr16:173595-173614, Chr16:173599-173614, Chr16:173598-173614, Chr16:173597-173614, Chr16:173596-173614, Chr16:173594-173614, Chr16:173593-173614, Chr16:173592-173614, Chr16:173591-173614, Chr16:173590-173614;

[0056] In some embodiments, the guiding sequence of the gRNA is reverse complementary to or has 1-5 mismatches with Chr16:173592-173611, Chr16:173596-173611, Chr16:173595-173611, Chr16:173594-173611, Chr16:173593-173611, Chr16:173591-173611, Chr16:173590-173611, Chr16:173589-173611, Chr16:173588-173611, Chr16:173587-173611.

[0057] In some embodiments, the distance between the 3'-end of the guiding sequence of the gRNA and the cytosine of the codon at CD142 in the HBA2 gene sequence is C12-C18.

[0058] The distance between the 3'-end of the above guiding sequence and cytosine is also the distance between the Hb-CS mutation site and PAM. The present invention finds through research that gRNAs with C12-C18 can all repair the Hb-CS mutation.

[0059] "Hb-CS mutation positioning" refers to the positioning of the Hb-CS mutation site in the base editor-gRNA, that is, the distance between the 3'-end of the guiding sequence of the gRNA and the cytosine of the codon at CD142 in the HBA2 gene sequence. Specifically, in some embodiments, it is represented by the position of the Hb-CS mutant base in the gRNA guiding sequence, that is, the xth nucleotide from the 3'-end of the guiding sequence, or the xth nucleotide from the PAM site (in the case of having a PAM site), abbreviated as Cx.

[0060] In some embodiments, the distance between the 3'-end of the guiding sequence of the gRNA and the cytosine of the codon at CD142 in the HBA2 gene sequence is C13-C18.

[0061] In some embodiments, the distance between the 3'-end of the guiding sequence of the gRNA and the cytosine of the codon at CD142 in the HBA2 gene sequence is C13 - C17. It is confirmed by the research of the present invention that although gRNAs with C12 - C18 can all repair the Hb-CS mutation, the gRNAs with C13 - C17 have better effects than the gRNAs with C12 and C18.

[0062] In some embodiments, the single-base editor is SpRY-CBE, and the distance between the 3'-end of the guiding sequence of the gRNA and the cytosine of the codon at CD142 in the HBA2 gene sequence is C13 - C17.

[0063] Using the single-base editor SpRY-CBE in combination with the above gRNA has better editing efficiency.

[0064] In some embodiments, the single-base editor is SpRY-CBE, and the distance between the 3'-end of the guiding sequence of the gRNA and the cytosine of the codon at CD142 in the HBA2 gene sequence is C14 - C17.

[0065] Using the single-base editor SpRY-CBE in combination with the above gRNA has better editing efficiency.

[0066] In some embodiments, the single-base editor is SpRY-CBE, and the distance between the 3'-end of the guiding sequence of the gRNA and the cytosine of the codon at CD142 in the HBA2 gene sequence is C15 - C17.

[0067] Using the single-base editor SpRY-CBE in combination with the above gRNA has a lower probability of off-target editing.

[0068] In some embodiments, the single-base editor is AncBE, and the distance between the 3'-end of the guiding sequence of the gRNA and the cytosine of the codon at CD142 in the HBA2 gene sequence is C13 - C17.

[0069] In some embodiments, the single-base editor is AncBE, and the distance between the 3'-end of the guiding sequence of the gRNA and the cytosine of the codon at CD142 in the HBA2 gene sequence is C13 - C16.

[0070] In some embodiments, the single-base editor is AncBE, and the distance between the 3'-end of the guiding sequence of the gRNA and the cytosine of the codon at CD142 in the HBA2 gene sequence is C13 or C16.

[0071] Using the single-base editor AncBE in combination with the above gRNA has better editing efficiency.

[0072] In some embodiments, the single-base editor is AncBE, and the distance between the 3'-end of the guiding sequence of the gRNA and the cytosine of the codon at CD142 in the HBA2 gene sequence is C16.

[0073] Using the single-base editor AncBE in combination with the above gRNA has a lower probability of off-target editing.

[0074] In some embodiments, the single-base editor is YE1-CBE, and the distance between the 3'-end of the guiding sequence of the gRNA and the cytosine of the codon at CD142 in the HBA2 gene sequence is C13 - C17.

[0075] In some embodiments, the single-base editor is YE1-CBE, and the distance between the 3'-end of the guiding sequence of the gRNA and the cytosine of the codon at CD142 in the HBA2 gene sequence is C14 - C17.

[0076] In some embodiments, the single-base editor is YE1-CBE, and the distance between the 3'-end of the guiding sequence of the gRNA and the cytosine of the codon at CD142 in the HBA2 gene sequence is C14 - C16.

[0077] Using the single-base editor YE1-CBE in combination with the above gRNA has better editing efficiency.

[0078] In some embodiments, the single-base editor is YE1-CBE, and the distance between the 3'-end of the guiding sequence of the gRNA and the cytosine of the codon at CD142 in the HBA2 gene sequence is C15 - C16. Using the single-base editor YE1-CBE in combination with the above gRNA has a lower probability of off-target editing.

[0079] In some embodiments, the length of the guiding sequence of the gRNA ≥ 16bp.

[0080] Considering the gRNA structure and the design of the above guiding sequence matching the target nucleic acid region, the length of the guiding sequence of the gRNA should be at least 16bp to accurately locate for single-base repair.

[0081] In some embodiments, the length of the guiding sequence of the gRNA is 16 - 25bp.

[0082] In some embodiments, the length of the guiding sequence of the gRNA is 17 - 25bp. Setting the length of the guiding sequence of the gRNA within the above range has a better editing and repair effect.

[0083] In some embodiments, the target DNA nucleotide sequence encoding the gRNA guiding sequence is selected from the basic sequences shown in SEQ ID NO: 1 - SEQ ID NO: 62 and mismatch sequences having 1 - 5 base mismatches with the basic sequences.

[0084] In some embodiments, the number of mismatch sites in the mismatch sequence is less than 5 nucleotides. For example, the gRNA guiding sequence may contain 1, 2, 3, 4, or 5 nucleotide mismatches.

[0085] In some embodiments, the number of mismatch sites in the mismatch sequence is less than 3 nucleotides, that is, 1 - 3 base mismatches are allowed. The present invention has confirmed through experiments that gRNAs with 1 - 3 nucleotide mismatches still have Hb - CS mutation repair efficiency.

[0086] Preferably, the mismatch site is not at the Hb - CS site, and is preferably located in the front segment (near the 5' end) or the middle segment of the gRNA guiding sequence. Further preferably, the mismatch is at least 8 nucleotides away from the 3' end of the guiding sequence or the PAM site, and more preferably at least 10 nucleotides.

[0087] In some embodiments, the basic sequence is selected from the sequences shown in SEQ ID NO: 1 - SEQ ID NO: 58. Using the above gRNA, higher editing and repair efficiency can be achieved.

[0088] In some embodiments, the single - base editor is SpRY - CBE, and the basic sequence is selected from the sequences shown in SEQ ID NO: 1, SEQ ID NO: 3 - SEQ ID NO: 15, SEQ ID NO: 17 - SEQ ID NO: 26, SEQ ID NO: 28 - SEQ ID NO: 37, SEQ ID NO: 39 - SEQ ID NO: 48, SEQ ID NO: 50 - SEQ ID NO: 58. Combining the above gRNA and single - base editor has a lower non - target editing rate.

[0089] In some embodiments, the single - base editor is AncBE, and the basic sequence is selected from the sequences shown in SEQ ID NO: 1 - SEQ ID NO: 14, SEQ ID NO: 26 - SEQ ID NO: 36.

[0090] In some embodiments, the basic sequence is selected from the sequences shown in SEQ ID NO: 1, SEQ ID NO: 3 - SEQ ID NO: 14, SEQ ID NO: 26, SEQ ID NO: 28 - SEQ ID NO: 36.

[0091] In some embodiments, the single-base editor is YE1-CBE, and the basic sequence is selected from the sequences shown in SEQ ID NO: 1 - SEQ ID NO: 25 and SEQ ID NO: 48 - SEQ ID NO: 58. The combination of the above gRNA and single-base editor has a lower probability of off-target editing.

[0092] In some embodiments, the basic sequence is selected from the sequences shown in SEQ ID NO: 1, SEQ ID NO: 3 - SEQ ID NO: 15, SEQ ID NO: 16 - SEQ ID NO: 25, SEQ ID NO: 48, SEQ ID NO: 50 - SEQ ID NO: 58.

[0093] The present invention also discloses a gRNA for single-base editing to repair HBA2 gene mutations, which comprises the above gRNA.

[0094] The present invention also discloses a cell, which comprises the above composition for repairing HBA2 gene mutations.

[0095] In some embodiments, the cell is a cell line and / or a primary cell.

[0096] In some embodiments, the cell is a hematopoietic stem / progenitor cell, an induced pluripotent stem cell, an erythroid progenitor cell, or other cells with the potential to be induced to differentiate or transdifferentiate or reprogram into mature red blood cells.

[0097] In some embodiments, somatic cells containing Hb-CS mutations can be reprogrammed into iPSC cells. After introducing the gRNA and single-base editor for repairing Hb-CS mutations, the Hb-CS mutations are repaired, and the cells are induced to differentiate into hematopoietic stem / progenitor cells or erythroid progenitor cells.

[0098] The present invention also discloses a reagent for repairing HBA2 gene mutations, comprising:

[0099] 1) The above single-base editor protein or protein composition, or the nucleotide sequence encoding the single-base editor; and

[0100] 2) The above gRNA, or the nucleotide sequence encoding the gRNA, or the nucleotide composition containing the nucleotide sequence encoding the gRNA.

[0101] It can be understood that the above single-base editor protein refers to an active protein with single-base editing function, and the protein composition refers to a protein composition with single-base editing function, such as a protein composition composed of an active protein with a target nucleic acid binding structural unit and an active protein with a deaminase structural unit activity; the above nucleotide composition can be a mixture including DNA and RNA.

[0102] The above-mentioned reagent for repairing HBA2 gene mutations, base editor and / or its gRNA can be delivered to host cells in vitro, ex vivo or in vivo in the form of plasmid vectors, viral vectors, ribonucleoprotein complexes, viroid vectors, etc., and play a therapeutic role by repairing the HBA2 gene to make it function normally.

[0103] The present invention also discloses a delivery system for repairing HBA2 gene mutations, which is used to deliver the above-mentioned reagent.

[0104] It can be understood that for the delivery system, a conventional delivery system in the art, such as liposome delivery, lipid nanoparticle delivery, extracellular vesicle EV, virus particles or electroporation, etc., can be used to deliver the above-mentioned reagent into cells.

[0105] Compared with the prior art, the present invention has the following beneficial effects:

[0106] The method for repairing HBA2 gene mutations by single-base editing of the present invention uses the method of single-base editing. Compared with conventional gene editing, it does not produce double-strand breaks, does not affect chromatin conformation and genomic stability; nor does it produce random insertions of large fragments of genes in the genome, and has a low impact on oncogene activation or tumor suppressor gene inactivation; at the same time, it will not produce random insertions / deletions at other sites in the genome, causing unpredictable risks; and the expression of the target gene to be repaired is regulated by all natural HBA2 regulatory elements, which is safe and can better balance α / β globin, and the therapeutic effect is better.

[0107] Moreover, the gRNA further screened by the present invention has a high repair efficiency. Especially the gRNA with the Hb-CS mutation site at C13-C17 also has the advantages of low non-target editing probability and high safety. Furthermore, the present invention has screened gRNAs with less restriction by PAM sites. Especially the gRNA with the Hb-CS mutation site at C16 is almost not restricted by PAM sites. BRIEF DESCRIPTION OF THE DRAWINGS

[0108] Figure 1 It is a schematic structural diagram of the pLenti6-GFP-HbCS reporter vector in Example 1;

[0109] Figure 2 It is a sequencing and efficiency analysis diagram of base editing results at the Hb-CS site in Example 4;

[0110] Figure 3 It is a schematic diagram of the efficiency of gRNA combined with a base editor for repairing the Hb-CS mutation with a 15-25nt guide sequence with the Hb-CS mutation located at C16 in Example 5;

[0111] Figure 4 Schematic diagram of the efficiency of repairing Hb-CS mutations by the gRNA combined with a base editor for the 15-25 nt guide sequence targeting C15 of the Hb-CS mutation in Example 5;

[0112] Figure 5 Schematic diagram of the efficiency of repairing Hb-CS mutations by the gRNA combined with a base editor for the 15-25 nt guide sequence targeting C17 of the Hb-CS mutation in Example 5;

[0113] Figure 6 Sequencing and efficiency analysis chart of the repair of Hb-CS site mutations by the AncBE base editor in Example 6;

[0114] Figure 7 Sequencing and efficiency analysis chart of the repair of Hb-CS mutations by the YE1-CBE base editor in Example 7;

[0115] Figure 8 Schematic diagram of the gRNA guide sequence mismatch in Example 8, where: the shaded bases represent mismatched bases, and the underlined bases represent the Hb-CS mutation sites. Detailed implementation manners

[0116] For ease of understanding of the present invention, the present invention will be described more comprehensively below with reference to the relevant drawings. Preferred embodiments of the present invention are shown in the drawings. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0117] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which this invention belongs. The terms used herein in the description of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more of the related listed items.

[0118] Definition:

[0119] Variant: A group of highly similar protein members that are homologous to a single protein or protein family and have the same or similar biological functions. The variants of the CRISPR / Cas nuclease of the present invention represent CRISPR / Cas homologous proteins, which are nucleic acid-binding proteins programmed to target any desired nucleotide sequence within the genome. The deaminase variants of the present invention represent deaminase homologous proteins and have base deamination functions. For example, a protein containing a CRISPR / Cas nuclease or a fragment thereof can be referred to as a "CRISPR / Cas nuclease variant", such as a Cas9 variant. The CRISPR / Cas nuclease variant shares homology with the CRISPR / Cas nuclease or a fragment thereof. For example, the CRISPR / Cas nuclease variant is at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.5% or at least about 99.9% identical to the wild-type CRISPR / Cas nuclease.

[0120] In some embodiments, compared with the wild-type CRISPR / Cas nuclease, the CRISPR / Cas nuclease variant may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 21, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more amino acid changes, but it still has the function of binding to programmable nucleotides such as gRNA and targeting nucleic acid targets.

[0121] Chemically synthesized and modified gRNA: It refers to gRNA that can be modified by chemical modification methods well-known to those skilled in the art. For example, in some embodiments, it is modified with 2'-O-methyl (2'-O-Me) or 2'-fluoro (2'-F). In some embodiments, the modification mode between the gRNA nucleotides includes phosphorothioate (PS) bonds. In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end are modified. In some embodiments, the first four nucleotides at the 5' end and the last four nucleotides at the 3' end are linked by phosphorothioate (PS) bonds.

[0122] In some embodiments, the gRNA can also use modified ribonucleotides, deoxyribonucleotides, other synthetic bases, and synthetic backbone linkages (such as peptide nucleic acids (PNA), locked nucleic acids (LNA), etc.). In some embodiments, the nucleic acid constituting the guide nucleotide sequence comprises natural nucleosides (such as adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine); nucleoside analogs (such as 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine); chemically modified bases; biologically modified bases (such as methylated bases); inserted bases; modified sugars (such as 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (such as phosphorothioates and 5'-N-phosphoramidite linkages).

[0123] Unless otherwise specified, the reagents used in the following examples are commercially available; unless otherwise specified, the methods used in the following examples can be achieved by conventional methods.

[0124] Example 1

[0125] Construction of Hb-CS mutant-GFP reporter gene vector and cells.

[0126] 1. Design and construct the GFP-HbCS reporter vector

[0127] Select the HBA2 gene fragment (SEQ ID NO:63) containing the Hb-CS mutation: TTCTGTGAGCACCGTGCTGACCTCCAAATACCGT C AAGCTGGAGCCTCGGTAGCCGTTCCTCCTGCCCGCTGGGCCTCCCAACGGGCCCTCCTCCCCTCCTTGCACCGGCCCTTCCTGGTCTTTGAATAAAGTCTGAGTGGGCAGCAGCCTGTGTGTGCCTGGGTTCTCTCTATCCCGGAATGTGCCAACAATGGAGGTGTTTACCTGTCTCAGACCAAGGACCTCTCTGCAGCTGCATGGGGCTGGGGAGGGAGAACTGCAGGGAGTATGGGAGGGGAAGCTGAGGTG

[0128] In the above sequence fragment, the capital bold underlinedC It represents Hb-CS, the Hb Constant Spring mutation, i.e., HBA2:c.427T>C. It replaces the stop codon TAA of GFP. Therefore, GFP lacks the stop codon and cannot emit green fluorescence.

[0129] Synthesize the target gene fragment: Design the following gene fragment: CMV promoter + GFP gene (removing the stop codon TAA) + HBA2 gene fragment (Hb-CS mutation). After inserting the target fragment into the lentiviral backbone vector, construct a lentiviral vector containing pCMV-GFP-HBA2(HbCS) and verify it by sequencing. The positive clone is used for lentiviral packaging.

[0130] Specifically, the pLenti6 / V5-GW / lacZ vector (Invitrogen, catalog number V49610 kit) used in this example is used as the lentiviral backbone vector. The target gene fragment is inserted in reverse and replaces the CMV promoter and lacZ gene fragment of the original backbone vector. The structure of the pLenti6-GFP-HbCS reporter vector is as Figure 1 shown, that is, the vector structure contains the lentiviral backbone, the antibiotic module contains the promoter PSV40-Blasticidin (blastocidin), and the target gene module contains the promoter pCMV-GFP (without stop codon)-HBA2 fragment (Hb-CS mutation).

[0131] 2. Package and concentrate lentivirus

[0132] Resuscitate and amplify 293T cells to the exponential growth phase, and then transfect 293T cells with the lentiviral plasmid and the helper plasmid using Lipofectamine2000. Recover the cells and concentrate the virus 48 - 72 h later. Seed 293T cells and proliferate them to 80 - 90% confluence for use in lentiviral packaging.

[0133] One hour before transfection, replace with fresh complete medium. Taking transfection of T25 as an example, the specific steps for preparing the transfection complex are as follows:

[0134] ① Add the plasmid and mix well in 500 μl of OPTI-MEM. The plasmid dosages are pCMV-VSV-G (source: ADDGENE#8454): pMDLg (source: ADDGENE#12251): pRSV-Rev (source: ADDGENE#12253): pLenti6-GFP-HbCS = 2 μg: 4 μg: 3 μg: 5 - 6 μg;

[0135] ② Add 3 times the amount of plasmid of Lipo2000 and mix well in 500 μl of OPTI-MEM;

[0136] After leaving ① and ② at room temperature for 5 minutes, mix them evenly and then leave for another 20 minutes to make it ready.

[0137] Add the transfection complex evenly into the cell culture flask and continue culturing for 4 - 6 hours. Replace with fresh complete medium and continue culturing for 48 - 72 hours. Collect the culture supernatant, centrifuge at 1500g for 10 minutes, and collect the supernatant again. Filter through a 0.45 μm PVDF syringe filter. Add 1 / 5 volume of 50% PEG 6000, mix evenly, and leave at 4°C overnight. A small amount of precipitate can be seen. Centrifuge at 1500g for 10 minutes to make it aggregate at the bottom of the tube. Discard the supernatant, add serum-free DMEM to resuspend to an appropriate volume, which is the concentrated GFP-HbCS lentivirus.

[0138] 3. Construct a GFP-HbCS reporter cell model

[0139] Inoculate the host cells to be transfected (such as 293T cells, K562 cells, human HUDEP2 cells, human hematopoietic stem cells, erythroid progenitor / precursor cells, etc.) into a 6-well plate, add 5 μl - 10 μl of the concentrated GFP-HbCS lentivirus to each well, add Blasticidin antibiotic (concentration 10 - 40 μg / mL) and culture for 48 - 72 hours, and identify by PCR whether the positive fragment is inserted.

[0140] Aliquot the positive clone cells into a 96-well cell culture plate, screen out the positive monoclonal cell line, and preserve it for use as a GFP-HbCS reporter cell model.

[0141] Example 2

[0142] Design and synthesis of gRNA.

[0143] In order to achieve the editing and repair of the target base, in the present invention, gRNA (guide RNA) is used to achieve the guiding and positioning function. The guiding sequence in the gRNA binds to the target nucleic acid region, and the backbone sequence part in the gRNA combines with the target nucleic acid binding structural unit of the single-base editor, thereby guiding the single-base editor to edit and repair the target base. In this example, the gRNA is designed and synthesized.

[0144] 1. Screening of gRNA

[0145] The gRNA sequence contains a guiding sequence that binds to or is reverse complementary to the regions within 50 nucleotides upstream and downstream of the Hb-CS mutation site to be edited, Chr16:173548-173648, or the nucleic acid sequence (ccgttgggaggcccagcgggcaggaggaacggctaccgaggctccagcttAacggtatttg gaggtcagcacggtgctcacagaagccaggaacttgtcca) (SEQ ID NO:64), as well as a backbone sequence that binds to a single-base editor.

[0146] Based on the editing window requirements of the single-base editor, such as 12-18 nucleotides from the 3' end of the PAM or guiding sequence, and principles such as the gRNA guiding sequence length being at least 16bp, etc., the present invention comprehensively considers and designs the gRNA guiding sequence.

[0147] Meanwhile, since the HBA2 gene has a high homology with the HBA1 gene, therefore, during the design of the guiding sequence, the target site specific to HBA2 or the target sequence covering the Hb-CS mutation should be preferably selected.

[0148] Combined with the above sequence analysis and screening, the present invention screened and obtained 62 gRNA guiding sequences (as shown in Table 1)

[0149] Table 1. List of gRNA guiding sequences, gRNA binding sites / target sequences, and Hb-CS mutation locations

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156] The above "Hb-CS mutation location" refers to the location of the Hb-CS mutation site in the single-base editor-gRNA, that is, the distance from the 3' end of the guiding sequence of the gRNA to the cytosine of the codon at CD142 in the HBA2 gene sequence. Specifically, in this embodiment, it is represented by the position of the Hb-CS mutant base in the gRNA guiding sequence, that is, the xth nucleotide from the 3' end of the guiding sequence, or the xth nucleotide from the PAM site (in the case of having a PAM site), abbreviated as Cx.

[0157] It is understandable that the gRNA can be selected from forms such as bimolecular guide RNA (dgRNA, i.e., crRNA and trRNA), single-molecule guide RNA (sgRNA), or multimolecular guide RNA, etc.

[0158] The single-molecule gRNA used in this example has the structure: 5’-[guide sequence]-guuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu[gRNA backbone sequence] (SEQ ID NO:65)-3’. If the guide sequence of this gRNA corresponds to the target sequence numbered 1 above, the complete gRNA sequence is ccgucaagcuggagccucggguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu (SEQ ID NO:66).

[0159] 2. gRNA synthesis

[0160] 2.1 Construction of gRNA plasmid

[0161] The sense strand and antisense strand of the DNA sequence corresponding to the gRNA guide sequence in Table 1 above are synthesized by conventional methods. The 5’-end of the sense strand is added with caccg, the 5’-end of the antisense strand is added with aaac, and the 3’-end of the antisense strand is added with C.

[0162] Take 2 μl each of the sense strand (Oligo-F) and antisense strand (Oligo-R) of the DNA sequence corresponding to the above gRNA guide sequence, add 2 μl of NEB 10x cuttersmart buffer and 14 μl of H2O, incubate in a PCR instrument at 95 °C for 5 minutes, immediately take it out and incubate on ice for 5 minutes to anneal to form a double-stranded guide sequence DNA with sticky ends.

[0163] The double-stranded guide sequence DNA with sticky ends was ligated to the BpiI digestion product (linearized vector) of a plasmid vector containing the gRNA backbone sequence (such as PUC19-U6 promoter - BpiI - BpiI - gRNA backbone, the PUC19-U6 background plasmid is from ADDGENE #121958, and the gRNA backbone sequence is: gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtg c) (SEQ ID NO:67) by T4 ligase. The ligation product was transformed, and monoclonal colonies were selected for PCR testing and Sanger sequencing verification. Positive clones, namely gRNA plasmids, were screened and obtained.

[0164] 2.2 Synthesis and chemical modification of gRNA

[0165] According to the gRNA guide sequence list in Table 1 above, gRNA modified with methyl and phosphorothioate bonds was obtained by chemical synthesis and modification for standby.

[0166] For example, the synthesis sequence and modification of the single-molecule gRNA1 after synthesis and modification are: 5′- mC*mC*mG* UCAAGCUGGAGCCUCGG -GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU*mU*mU*mU-3'(SEQ ID NO:70) (the underlined part is the guide sequence, m represents 2’-O-methyl modification, and * represents phosphorothioate bond modification).

[0167] Example 3

[0168] The single-base editor and gRNA were delivered to the host cell.

[0169] 1. Resuscitate cells

[0170] Resuscitate the GFP-HbCS reporter cell model successfully constructed in step 3 of Example 1 and plate it into a 6-well cell culture plate. After culturing in a CO2 incubator for 24 hours, it was used for cell transfection.

[0171] 2. Liposome transfection

[0172] (1) Wash the host cells in the logarithmic growth phase cultured in a 6-well plate with 1 mL of PBS, obtain a resuspended / suspended host cell solution through operations such as digestion or recovery, take 20 μl for cell counting, and plate it into a 24-well plate, 2×10 5 / well. Each well was supplemented with medium to approximately 500 μl.

[0173] (2) Prepare transfection complex A

[0174] Take a 1.5 ml EP tube, and successively add the OPTI-MEM obtained in Example 1, the gRNA plasmid obtained in Example 2, and the base editor plasmid, gently mix and incubate, let it stand at room temperature for 20 minutes to form a complex, and then add 40 μl of OPTI-MEM.

[0175] (3) Prepare transfection complex B

[0176] Take a 1.5 ml EP tube, successively add OPTI-MEM and Lipofectamine 2000 transfection reagent, gently mix and let it stand at room temperature for 10 minutes; gently mix transfection complex A and B, let it stand at room temperature for 15 minutes, then add the mixture to a 24-well plate, 50 μl per well, and continue to culture for 72 hours.

[0177] 3. Plasmid electroporation

[0178] Transfer the host cells in the 6-well plate to a T25 culture flask and culture for 24 hours, paying attention to controlling the cell density. Transfer the T25 cell culture medium to a 15 mL centrifuge tube, centrifuge at 90 xg for 10 min, discard the supernatant, and resuspend with 1 mL of PBS. Perform cell counting. Take 0.5×10 6 cells, centrifuge at 90 xg for 10 min, discard the supernatant, resuspend with about 20 μL of electroporation mixture (a mixture of single base editor plasmid solution (plasmid mass 300 ng - 5 μg) / gRNA plasmid solution (plasmid mass 300 ng - 5 μg) / SF-P3 solution / Supplement solution, implemented according to the instruction manual of Lonza product number V4XC-2032), and transfer to an electroporation cuvette, and perform electroporation according to the corresponding electroporation program for the host cells.

[0179] After electroporation, let it stand at room temperature for 10 min, add 80 μL of RPMI1640 medium (containing 10% FBS); gently pipette 3 times, transfer the cells, and culture in a 24-well plate, and supplement the medium volume to 400 μL.

[0180] 4. RNA system electroporation

[0181] Deliver single base editor mRNA and chemically synthesized gRNA into host cells by electroporation. Transfer the host cells in the 6-well plate to a T25 culture flask and culture for 24 hours, paying attention to controlling the cell density. Transfer the T25 cell culture medium to a 15 mL centrifuge tube, centrifuge at 90 xg for 10 min, discard the supernatant, and resuspend with 1 mL of PBS. Perform cell counting. Take 0.5×10 6The cells were centrifuged at 90xg for 10 min, the supernatant was removed, and they were resuspended with approximately 20 μL of electroporation mixture (a mixture of single-base editor mRNA solution / gRNA solution / SF-P3 solution / Supplement solution, implemented according to the instruction manual of Lonza product number V4XC-2032), and transferred to an electroporation cuvette. The corresponding electroporation program for the host cells was selected for electroporation operation.

[0182] After electroporation, the cells were left standing at room temperature for 10 min, and 80 μL of RPMI1640 medium (containing 10% FBS) was added; they were gently pipetted 3 times, the cells were transferred and cultured in a 24-well plate, and the medium volume was supplemented to 400 μL.

[0183] 5. RNP electroporation

[0184] The single-base editor protein and chemically synthesized gRNA were incubated and packaged into ribonucleoprotein (RNP) in vitro. The RNP was delivered into host cells by electroporation. The host cells in a 6-well plate were transferred to a T25 culture flask and cultured for 24 hours, paying attention to controlling the cell density. The culture medium of the T25 cells was transferred to a 15 mL centrifuge tube, centrifuged at 90xg for 10 min, the supernatant was removed, and they were resuspended with 1 mL of PBS. Cell counting was performed. Take 0.5×10 6 The cells were centrifuged at 90xg for 10 min, the supernatant was removed, and they were resuspended with approximately 20 μL of electroporation mixture (a mixture of single-base editor protein solution / gRNA solution / SF-P3 solution / Supplement solution, implemented according to the instruction manual of Lonza product number V4XC-2032), and transferred to an electroporation cuvette. The corresponding electroporation program for the host cells was selected for electroporation operation.

[0185] After electroporation, the cells were left standing at room temperature for 10 min, and 80 μL of RPMI1640 medium (containing 10% FBS) was added; they were gently pipetted 3 times, the cells were transferred and cultured in a 24-well plate, and the medium volume was supplemented to 400 μL.

[0186] 6. Delivery of lipid nanoparticles (LNP)

[0187] The plasmid DNA, mRNA or ribonucleoprotein complex of the single-base editor and gRNA was encapsulated in "stabilized plasmid-lipid particles" (SPLP) containing the fusogenic lipid dioleoylphosphatidylethanolamine (DOPE) and a low level (5-10 mol%) of cationic lipid, and stabilized by a polyethylene glycol (PEG) coating. LNP delivery can be used to deliver single-base editor-gRNA into cells in vitro or for in vivo delivery.

[0188] 7. Sequencing after transfection

[0189] After culturing the transfected cells for 72 hours, the host cells co-transfected with the single-base editor plasmid and the gRNA plasmid were recovered, the genes were extracted, and the target fragment was amplified by PCR. The PCR primer sequences were: (F primer) CGACAAGCAGAAGAACGGCATCAA (SEQ ID NO:68), (R primer) CAGCTGCAGAGAGGTCCTTG (SEQ ID NO:69), and the PCR product was sequenced by the Sanger method.

[0190] 8. Result analysis

[0191] The gene editing efficiency was analyzed by the EditR 10.10 website (https: / / moriaritylab.shinyapps.io / editr_v10 / ) for the sequencing results.

[0192] Example 4

[0193] Repair the Hb-CS mutation with a gRNA-guided single-base editor through Hb-CS mutation repair.

[0194] 1. Method

[0195] In this example, referring to the plasmid electroporation method in Example 3, the gRNA1 plasmid, gRNA15 plasmid, gRNA26 plasmid, gRNA37 plasmid, gRNA48 plasmid, gRNA59 plasmid, and gRNA61 plasmid with the Hb-CS mutation located at C12-18 were respectively mixed with pCAG-CBE4max-SpRY-P2A-EGFP (source: Addgene Plasmid #139999) and electroporated into the K562 cell line (GFP-HbCS reporter cells obtained by the construction method in Example 1). After culturing the transfected cells for 72 hours, the host cells co-transfected with the single-base editor plasmid and the gRNA plasmid were recovered, the genes were extracted, and the target fragment was amplified by PCR. The PCR product was sequenced by the Sanger method.

[0196] 2. Results

[0197] The gene editing efficiency of the sequencing results was analyzed by the EditR 10.10 website as shown in the following table and Figure 2 as shown, Figure 2 is a sequencing and efficiency analysis diagram of the base editing results at the Hb-CS locus, where the numbers marked in the box represent the efficiency (%) of the target base editing.

[0198] Table 2. Repair of Hb-CS mutation by SpRY-single base editor

[0199]

[0200] The above results showed that the SpRY base editors mediated by gRNA-1 (C16), gRNA-15 (C15), gRNA-26 (C13), gRNA-37 (C17), gRNA-48 (C14), and gRNA-59 (C12) could repair the Hb-CS mutation in the HBA2 gene, and the repair efficiencies of gRNA-1, gRNA-15, gRNA-26, gRNA-37, and gRNA-48 at the Hb-CS mutation site were significantly better than that of gRNA-59.

[0201] Table 3. Off-target editing efficiency of SpRY-base editor in repairing Hb-CS mutation

[0202]

[0203] The above results showed that the off-target editing frequency of gRNA-59 was very high relative to gRNA-1, gRNA-15, gRNA-26, gRNA-37, and gRNA-48, and was higher than the editing efficiency at the target site. The on-target editing efficiencies of gRNA-1, gRNA-15, gRNA-26, gRNA37, and gRNA48 were all higher than their off-target editing efficiencies, and gRNA-1, gRNA-15, gRNA-26, and gRNA37 had lower off-target editing efficiencies.

[0204] Example 5

[0205] Experiment on repairing Hb-CS mutation by base editors mediated by gRNAs with different lengths.

[0206] In this example, referring to the method of plasmid electroporation in Example 3, gRNAs with different guide sequence lengths and the same Hb-CS mutation location (the number of bases counted from the 3'-end of the self-guided sequence) were co-delivered into host cells together with the CBE base editor, so as to observe whether gRNAs with different lengths could induce the repair of the Hb-CS mutation site and detect the effect of different gRNA lengths on the repair efficiency.

[0207] 1. Method

[0208] 1.1 Electroporation

[0209] 1) gRNA-2, gRNA-3, gRNA-4, gRNA-6, and gRNA-11 with different guide sequence lengths and Hb-CS mutation located at C16 (from the 3'-end of the self-guided sequence) were respectively mixed with pCAG-CBE4max-SpRY-P2A-EGFP (source: Addgene Plasmid #139999) and electroporated into the K562 cell line (GFP-HbCS reporter cells obtained according to the construction method in Example 1).

[0210] 2) gRNAs gRNA-16, gRNA-17, gRNA-18, gRNA-20, and gRNA-25 with different lengths of the guide sequence targeting the Hb-CS mutation at C15 (3' end of the self-guide sequence) were respectively mixed with pCAG-CBE4max-SpRY-P2A-EGFP (Addgene Plasmid #139999) and electrotransfected into the K562 cell line (GFP-HbCS reporter cells obtained by the construction method of Example 1).

[0211] 3) gRNAs gRNA38, gRNA39, gRNA40, gRNA42, and gRNA47 with different lengths of the guide sequence targeting the Hb-CS mutation at C17 (3' end of the self-guide sequence) were respectively mixed with pCAG-CBE4max-SpRY-P2A-EGFP (Addgene Plasmid #139999) and electrotransfected into the K562 cell line (GFP-HbCS reporter cells obtained by the construction method of Example 1).

[0212] 1.2 Cultivation

[0213] After culturing the transfected cells for 72 hours, the host cells co-transfected with the base editor plasmid and the gRNA plasmid were recovered.

[0214] 1.3 Sequencing

[0215] Genes were extracted, the target fragments were amplified by PCR, and the PCR products were sequenced by the Sanger method.

[0216] 2. Results

[0217] The gene editing efficiency of the sequencing results was analyzed by the EditR 10.10 website as shown in the following table and Figures 3-5 as follows.

[0218] Table 4. Efficiency of gRNAs with 15 - 25 nt guide sequences targeting the Hb-CS mutation at C16 in combination with a base editor to repair the Hb-CS mutation

[0219]

[0220] Table 5. Efficiency of gRNAs with 15 - 25 nt guide sequences targeting the Hb-CS mutation at C15 in combination with a base editor to repair the Hb-CS mutation

[0221]

[0222] Table 6. Efficiency of gRNAs with 15 - 25 nt guide sequences targeting the Hb-CS mutation at C17 in combination with a base editor to repair the Hb-CS mutation

[0223]

[0224]

[0225] The above experimental results show that the gRNAs with a length of 16 - 25 nt targeting the Hb - CS mutation at C16, the gRNAs with a length of 16 - 25 nt targeting the Hb - CS mutation at C15, and the gRNAs with a length of 16 - 25 nt targeting the Hb - CS mutation at C17 can repair the Hb - CS mutation when combined with the base editor respectively.

[0226] Moreover, according to the results of this example and the above Examples 3 - 4, it can be known that the gRNAs with a guiding sequence length of 16 - 25 nt targeting the Hb - CS mutation at the same positions of C13 - C17 (counting the number of bases from the 3' end of the self - guiding sequence) can repair the Hb - CS mutation when combined with the base editor respectively.

[0227] Furthermore, the gRNAs with a guiding sequence length of 17 - 25 nt targeting the Hb - CS mutation at the same positions of C13 - C17 (counting the number of bases from the 3' end of the self - guiding sequence) have a better Hb - CS mutation repair effect, that is, when the gRNA binds or is reverse - complementary to the target nucleotide sequences with more than 16 bp starting from the positions of chr16:173613, 173612, 173610, 173614, and 173611 on the antisense strand of the human genome respectively, it can jointly induce the conversion of C to T at the Hb - CS mutation site of the HBA2 gene with the base editor and has a good editing efficiency.

[0228] Example 6

[0229] Experiment on repairing Hb - CS mutation by AncBE base editor.

[0230] 1. Method

[0231] In this example, referring to the method of plasmid electroporation in Example 3, the plasmids of gRNA1, gRNA26, gRNA59, and gRNA61 were respectively mixed with pCMV - AncBE4max - GFP (source: Addgene plasmid #112100) and electroporated into the K562 cell line (GFP - HbCS reporter cells obtained according to the construction method in Example 1). After culturing the transfected cells for 72 hours, the host cells co - transfected with the base editor plasmid and the gRNA plasmid were recovered, the genes were extracted, the target fragments were amplified by PCR, and the PCR products were sequenced by the Sanger method.

[0232] 2. Results

[0233] The gene editing efficiency was analyzed by the EditR 10.10 website for the sequencing results as shown in the following table and Figure 6 as follows, Figure 6Sequencing and efficiency analysis diagram of the repair of Hb-CS site mutations by the gRNA-1-mediated AncBE base editor. The numbers marked in the boxes represent the efficiency (%) of the target editing.

[0234] Table 7. Repair of Hb-CS mutations by the AncBE base editor

[0235]

[0236] The above experimental results show that the gRNA1- and gRNA26-mediated AncBE base editors can repair the Hb-CS mutations in the HBA gene, and the repair efficiency is significantly better than that of gRNA59 and gRNA61. Moreover, experiments have shown that the probability of off-target editing relative to on-target editing of gRNA1 and gRNA26 is lower.

[0237] The gRNA-26-mediated AncBE base editor has a higher repair efficiency for Hb-CS mutations, which is better than the combination with other base editors. Although gRNA-1 is not the optimal PAM site for the nuclease in Anc-BE4, it has an unexpectedly significant Hb-CS repair efficiency, which is much higher than the off-target site editing efficiency of 2-4%. At the same time, the off-target editing efficiency of the gRNA-1-guided AncBE base editor is significantly lower than that of the SpRY base editor. It can be seen that the PAM site is not the determining factor restricting the repair efficiency of the base editor for Hb-CS.

[0238] Example 7

[0239] Repair of Hb-CS mutations by the YE1-CBE base editor

[0240] 1. Method

[0241] In this example, referring to the method of plasmid electroporation in Example 3, plasmids of gRNA-1, gRNA-15, gRNA-48, gRNA-59, and gRNA-61 were respectively mixed with YE1-BE4max-NG (source: Addgene Plasmid #138159) and electroporated into the K562 cell line (GFP-HbCS reporter cells obtained by the construction method in Example 1). After culturing the transfected cells for 72 hours, the host cells co-transfected with the base editor plasmid and the gRNA plasmid were recovered, the genes were extracted, the target fragments were amplified by PCR, and the PCR products were sequenced by the Sanger method.

[0242] 2. Results

[0243] The gene editing efficiency of the sequencing results analyzed by the EditR 10.10 website is as shown in the following table and Figure 7 shown Figure 7This is a sequencing and efficiency analysis chart of the base editing results at the Hb-CS locus, where the numbers marked in the boxes represent the efficiency (%) of the target editing.

[0244] Table 8. Repair of Hb-CS mutations by the YE1 single-base editor

[0245]

[0246] The above experimental results show that the YE1-CBE single-base editor mediated by gRNA-1, gRNA-15, and gRNA-48 can repair the Hb-CS mutation of the HBA2 gene, and the repair efficiency is significantly better than that of gRNA59 and gRNA61. Moreover, it has been experimentally confirmed that its off-target editing efficiency is much lower than the repair efficiency of the Hb-CS mutation.

[0247] Although the efficiency of the YE1-CBE single-base editor guided by gRNA-2 and gRNA-5 to repair the Hb-CS mutation is weaker than that of the SpRY single-base editor, it can significantly down-regulate the frequency of off-target editing, reduce the potential off-target editing risk, and has the advantage of high safety.

[0248] Although the single-base editing efficiency of gRNA-15 is lower than that of gRNA-48, the off-target editing efficiency of gRNA-48 is significantly higher than that of gRNA-15 and gRNA-1.

[0249] Example 8

[0250] Experiment on the repair of Hb-CS mutations mediated by mismatched gRNAs with a single-base editor.

[0251] 1. Method

[0252] Refer to the method of plasmid electroporation in Example 3. Plasmids that are mismatched with gRNA-6 by 1, 2, and 3 nucleotides respectively (corresponding to gRNA-12, gRNA-13, and gRNA-14) are mixed with YE1-BE4max-NG (Addgene Plasmid #138159) and electroporated into the K562 cell line (GFP-HbCS reporter cells obtained by the construction method in Example 1). After culturing the transfected cells for 72 hours, the host cells co-transfected with the single-base editor plasmid and the gRNA plasmid are recovered, the genes are extracted, the target fragment is amplified by PCR, and the PCR product is sequenced by the Sanger method.

[0253] 2. Results

[0254] The gene editing efficiency analyzed by the EditR 10.10 website for the sequencing results is as shown in the following table and Figure 8 as follows, Figure 8Schematic diagram of gRNA guide sequence mismatch, where the shaded bases represent mismatched bases and the underlined bases represent the Hb-CS mutation site.

[0255] Table 9. gRNAs with 1-3 bp mismatches all have base repair effects

[0256]

[0257]

[0258] The above experimental results show that gRNA6 with 1-3 nucleotide mismatches can repair the Hb-CS mutation of the HBA2 gene. From this, it can be seen that gRNAs with 1-3 nucleotide mismatches can still guide the base editor to repair the Hb-CS mutation of the HBA2 gene.

[0259] Example 9

[0260] Experiment on repairing Hb-CS mutation in patient-derived hematopoietic stem / progenitor cells.

[0261] 1. Ex vivo repair experiment

[0262] 1.1 Method

[0263] After resuscitating CD34-positive cells (mPBSC) containing the Hb-CS mutation of the HBA2 gene, culture them in StemSpan serum-free expansion medium (StemCell Company, StemSpan TM SFEM #09600) rich in human cytokines (SCF, TPO, Flt3L, 100 ng / ml each) for two days.

[0264] Deliver the CBE base editor for repairing Hb-CS and gRNA-1 into mPBSC cells. After electroporation, recover and culture in SFEM rich in human cytokines (SCF, TPO, Flt3L, 100 ng / ml each) for one day, and then induce the differentiation of mPBSC into red blood cells in three stages. On the 4th day of starting the induced differentiation, take out 2×10 5 cells, extract genomic DNA, and then PCR amplify the Hb-CS mutation site and adjacent fragments of the HBA2 gene and send them for sanger sequencing. The sequencing results are analyzed by synthego software for gene editing efficiency.

[0265] On the 18th day after the start of induced differentiation, the relative expression level of repaired HBA2 mRNA was detected by relative real-time quantitative qPCR, the percentage of blood proteins was analyzed by high-performance liquid chromatography (HPLC) of hemoglobin, and the enucleation percentage and cell size in red blood cells after repair and induced differentiation were analyzed by flow cytometry. The experimental group of red blood cells induced from unrepaired patient-derived hematopoietic stem / progenitor cells was used as the negative control.

[0266] 1.2 Results

[0267] Compared with the negative control, the mPBSC cells treated with the CBE base editor for repairing Hb-CS and gRNA-1 obtained red blood cells with restored expression and function of HBA hemoglobin after induced differentiation.

[0268] 2. In vivo repair

[0269] The CBE base editor for repairing Hb-CS and gRNA-1 were loaded into viral vectors, or encapsulated by lipid nanoparticles, or expressed by engineered cells and secreted by encapsulating exosomes to prepare intravenous infusion preparations, which were delivered to the body marrow by intravenous infusion to repair the Hb-CS mutation in hematopoietic stem cells and restore the expression and function of HBA hemoglobin.

[0270] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope described in this specification.

[0271] The above-described embodiments only express several implementation manners of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several deformations and improvements can be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the invention patent should be subject to the appended claims.

Claims

1. A method for single-base editing to repair HBA2 gene mutations for non-diagnostic or therapeutic purposes, characterized in that, Comprising the following steps: Contacting a base editor and a gRNA with the HBA2 gene sequence to be edited and repaired, deaminating the cytosine base in the CD142 codon of the mutant HBA2 gene to convert it into thymine; The distance from the 3'-end of the guiding sequence of the gRNA to the cytosine of the codon at CD142 in the HBA2 gene sequence is C13-C17, where C13 refers to the 13th nucleotide counted from the 3'-end of the guiding sequence of the gRNA corresponding to the Hb-CS mutant base, and C17 refers to the 17th nucleotide counted from the 3'-end of the guiding sequence of the gRNA corresponding to the Hb-CS mutant base; the length of the guiding sequence of the gRNA is 17-25 bp, the guiding sequence of the gRNA binds to or is reverse complementary to the Chr16:173548-173648 target region, the 3'-end base of the guiding sequence of the gRNA binds to the 5'-end base of the antisense strand of the target region, and there is no mismatch between the guiding sequence of the gRNA and the Chr16:173548-173648 target region; or, The coding nucleotide sequence of the guiding sequence of the gRNA is selected from SEQ ID NO: 12, SEQ ID NO: 13 or SEQ ID NO:

14.

2. A composition for repairing HBA2 gene mutations, characterized in that, Including: A base editor and a gRNA, The base editor comprises a target nucleic acid binding structural unit and a deaminase structural unit, and the deaminase structural unit comprises a cytosine deaminase active domain; The gRNA comprises a guiding sequence and a backbone sequence that binds to the base editor, and the guiding sequence targets the cytosine base in the CD142 codon of the mutant HBA2 gene; The distance from the 3'-end of the guiding sequence of the gRNA to the cytosine of the codon at CD142 in the HBA2 gene sequence is C13-C17, where C13 refers to the 13th nucleotide counted from the 3'-end of the guiding sequence of the gRNA corresponding to the Hb-CS mutant base, and C17 refers to the 17th nucleotide counted from the 3'-end of the guiding sequence of the gRNA corresponding to the Hb-CS mutant base; the length of the guiding sequence of the gRNA is 17-25 bp, the guiding sequence of the gRNA binds to or is reverse complementary to the Chr16:173548-173648 target region, the 3'-end base of the guiding sequence of the gRNA binds to the 5'-end base of the antisense strand of the target region, and there is no mismatch between the guiding sequence of the gRNA and the Chr16:173548-173648 target region; or, The coding nucleotide sequence of the guiding sequence of the gRNA is selected from SEQ ID NO: 12, SEQ ID NO: 13 or SEQ ID NO:

14.

3. The composition according to claim 2, wherein The target nucleic acid binding structural unit is selected from: CRISPR / Cas nuclease.

4. The composition according to claim 3, characterized in that, The CRISPR / Cas nuclease is selected from at least one of: Cas9, CasX, CasY, Cpf1, C2c1, cas12b2, cas12h, cas12i, cas12g, C2c3, C2c5, c2c8, c2c9, and variants thereof.

5. The composition according to claim 4, wherein The CRISPR / Cas nuclease is selected from: Cas9 nickase variants.

6. The composition according to claim 4, characterized in that, The CRISPR / Cas nuclease is selected from at least one of: SpRY variants, NG-nCas9 variants, NGG-nCas9 variants.

7. The composition according to claim 2, wherein The deaminase structural unit is selected from: APOBEC1 deaminase, APOBEC2 deaminase, APOBEC3A deaminase, APOBEC3B deaminase, APOBEC3C deaminase, APOBEC3D deaminase, APOBEC3F deaminase, APOBEC3G deaminase, APOBEC3H deaminase, APOBEC4 deaminase, activation-induced deaminase, and pmCDA1 and variants or combinations thereof.

8. The composition according to claim 7, characterized in that, The base editor is a fusion protein, and the target nucleic acid binding structural unit is organically linked to the deaminase structural unit.

9. The composition according to claim 8, wherein The base editor is selected from at least one of: SpRY-CBE, AncBE, YE1-CBE.

10. The composition according to claim 2, characterized in that, The guiding sequence of the gRNA binds to or is reverse complementary to the target regions of Chr16:173589-173613, Chr16:173588-173612, Chr16:173586-173610, Chr16:173590-173614, Chr16:173587-173611.

11. The composition according to claim 10, wherein The guiding sequence of the gRNA is reverse complementary to Chr16:173594-173613, Chr16:173597-173613, Chr16:173596-173613, Chr16:173595-173613, Chr16:173593-173613, Chr16:173592-173613, Chr16:173591-173613, Chr16:173590-173613, Chr16:173589-173613, Chr16:173593-173612, Chr16:173596-173612, Chr16:173595-173612, Chr16:173594-173612, Chr16:173592-173612, Chr16:173591-173612, Chr16:173590-173612, Chr16:173589-173612, Chr16:173588-173612, Chr16:173591-173610, Chr16:173594-173610, Chr16:173593-173610, Chr16:173592-173610, Chr16:173590-173610, Chr16:173589-173610, Chr16:173588-173610, Chr16:173587-173610, Chr16:173586-173610, Chr16:173595-173614, Chr16:173598-173614, Chr16:173597-173614, Chr16:173596-173614, Chr16:173594-173614, Chr16:173593-173614, Chr16:173592-173614, Chr16:173591-173614, Chr16:173590-173614, Chr16:173592-173611, Chr16:173595-173611, Chr16:173594-173611, Chr16:173593-173611, Chr16:173591-173611, Chr16:173590-173611, Chr16:173589-173611, Chr16:173588-173611, Chr16:173587-173611.

12. The composition according to claim 2, wherein The DNA nucleotide sequence encoding the gRNA guiding sequence is selected from the sequences shown in SEQ ID NO: 1, SEQ ID NO: 4 - SEQ ID NO: 15, SEQ ID NO: 18 - SEQ ID NO: 26, SEQ ID NO: 29 - SEQ ID NO: 37, SEQ ID NO: 40 - SEQ ID NO: 48, SEQ ID NO: 51 - SEQ ID NO:

58.

13. The composition according to claim 2, characterized in that, The single-base editor is SpRY-CBE, and the DNA nucleotide sequence encoding the gRNA guiding sequence is selected from the sequences shown in SEQ ID NO: 1, SEQ ID NO: 4 - SEQ ID NO: 15, SEQ ID NO: 18 - SEQ ID NO: 26, SEQ ID NO: 29 - SEQ ID NO: 37, SEQ ID NO: 40 - SEQ ID NO: 48, SEQ ID NO: 51 - SEQ ID NO:

58.

14. The composition according to claim 2, wherein The single-base editor is AncBE, and the DNA nucleotide sequence encoding the gRNA guiding sequence is selected from the sequences shown in SEQ ID NO: 1, SEQ ID NO: 4 - SEQ ID NO: 14, SEQ ID NO: 26, SEQ ID NO: 29 - SEQ ID NO:

36.

15. The composition according to claim 2, wherein The single-base editor is YE1-CBE, and the DNA nucleotide sequence encoding the gRNA guiding sequence is selected from the sequences shown in SEQ ID NO: 1, SEQ ID NO: 4 - SEQ ID NO: 15, SEQ ID NO: 18 - SEQ ID NO: 25, SEQ ID NO: 48, SEQ ID NO: 51 - SEQ ID NO:

58.

16. A gRNA for single-base editing to repair HBA2 gene mutations, characterized in that, Comprising the gRNA according to any one of claims 2 - 15.

17. A cell, characterized in that, Comprising the composition for repairing the HBA2 gene mutation according to any one of claims 2 - 14.

18. The cell according to claim 17, wherein, The cell is a cell line and / or primary cell.

19. The cell according to claim 17, wherein The cell is a hematopoietic stem / progenitor cell or an induced pluripotent stem cell.

20. The cell according to claim 17, wherein The cell is an erythroid progenitor cell.

21. A reagent for repairing HBA2 gene mutations, characterized in that, Comprising: 1) The single-base editor protein or protein composition in the composition according to any one of claims 2 - 15, or the nucleotide sequence encoding the single-base editor; and 2) The gRNA in the composition according to any one of claims 2 - 15, or the nucleotide sequence encoding the gRNA, or the nucleotide composition comprising the nucleotide sequence encoding the gRNA.

22. Use of the composition according to any one of claims 2 - 15, the gRNA according to claim 16, the cell according to any one of claims 17 - 20, and the reagent according to claim 21 in the preparation of a medicament for treating α-thalassemia.

Citation Information

Patent Citations

  • Method for repairing HBA2 gene mutation in vitro by using single-stranded nucleotide fragment

    CN108165581A

  • Basic group editing system and method for specifically repairing HBB gene mutation, kit and application of system and method and kit in human genital system

    CN109136272A