Molecular Marker, Primer Pair, Kit and Their Applications and Genotype Detection Method for High Lysine Loci in Maize

Abstract

The present invention relates to the technical field of molecular genetics, and specifically relates to molecular markers, primer pairs, kits and their applications and genotype detection methods for high-lysine loci in maize. The molecular markers for high-lysine loci in maize kernels include a first molecular marker with a nucleotide sequence as shown in Sequence 1, and a second molecular marker with a nucleotide sequence as shown in Sequence 2; the primer pairs for detecting the above molecular markers include forward primers with nucleotide sequences as shown in Sequences 3 and 5, and reverse primers with nucleotide sequences as shown in Sequences 4 and 6. The molecular markers, primer pairs and kits provided by the present invention can be well used to distinguish the wild type and mutant type of the mutation site, provide new targets for molecular marker-assisted selection breeding, and can greatly shorten the breeding cycle.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular genetics, and in particular to a molecular marker, a primer pair, a kit and application thereof, and a genotype detection method for a high-lysine site in corn. Background Art

[0002] Corn has long been the basic food source for human survival and the main animal feed ingredient. Typically, corn endosperm contains 90% starch and 10% protein. 70% of these proteins are alcohol-soluble proteins (zein), also known as corn protein. However, the nutritional composition of these rich alcohol-soluble proteins is very unbalanced. It lacks some amino acids necessary for monogastric animals, especially lysine; alcohol-soluble proteins only contain 1.5% to 2.0% lysine, while the optimal human nutritional ratio is 5.0%. Most corn floury endosperm mutants have a common feature: the lysine content is significantly increased, thereby improving the protein quality of the grain. Among them, opaque2 ( o2 ) mutant was the most significant, with its lysine content increasing nearly 2-fold.

[0003] In 1964, Mertz et al. first reported o2 The lysine content in the endosperm of recessive mutation homozygotes is higher than that in normal corn ( Zea mays L. ) increased by nearly double. o2 The gene encodes the O2 protein, which contains a leucine zipper domain and belongs to the basic leucine zipper (bZIP) family. It is an important transcriptional regulator in maize endosperm. As a transcriptional regulator, the O2 protein, acting as a homodimer or heterodimer, regulates the expression of a 22kD gliadin and several other genes, including lysine ketoglutarate reductase (LKR). o2 The mutant reduces the synthesis of gliadin, a protein with a very low lysine content, while significantly increasing the content of non-gliadin, thereby significantly increasing the lysine and tryptophan content in the kernel. Furthermore, loss of LKR function can also lead to the accumulation of free lysine. However, this type of mutation results in low kernel density, soft texture, and reduced firmness. This in turn leads to unfavorable agronomic traits, such as brittle kernels, susceptibility to insect damage, and poor storage properties, resulting in reduced yield, significantly reducing the commercial value of this mutant. Summary of the invention

[0004] against o2 Mutants can cause technical problems such as low density, soft texture, and decreased hardness of corn kernels. The present invention provides molecular markers, primer pairs, kits, applications thereof, and genotype detection methods for corn high lysine sites.

[0005] In a first aspect, the present invention provides a set of molecular markers for high-lysine loci in maize, including:

[0006] A first molecular marker, the nucleotide sequence of the first molecular marker is as shown in Sequence 1;

[0007] A second molecular marker, the nucleotide sequence of the second molecular marker is as shown in Sequence 2.

[0008] In a second aspect, the present invention provides a set of primer pairs for detecting the above molecular markers, including:

[0009] A forward primer for the first molecular marker, the nucleotide sequence of the forward primer is as shown in Sequence 3;

[0010] A reverse primer for the first molecular marker, the nucleotide sequence of the reverse primer is as shown in Sequence 4;

[0011] A forward primer for the second molecular marker, the nucleotide sequence of the forward primer is as shown in Sequence 5;

[0012] A reverse primer for the second molecular marker, the nucleotide sequence of the reverse primer is as shown in Sequence 6.

[0013] In a third aspect, the present invention provides a kit for detecting the above molecular markers, comprising the above primer pairs.

[0014] In a fourth aspect, the present invention provides an application of the above molecular markers, primer pairs and / or kit in detecting high-lysine loci in maize kernels.

[0015] In a fifth aspect, the present invention further provides an application of the above molecular markers, primer pairs and / or kit in maize germplasm improvement and molecular-assisted breeding.

[0016] In a sixth aspect, the present invention provides a method for detecting the genotype of maize Opaque2 Genotype detection method, using the above primer pairs to perform PCR amplification on the genomic DNA of the maize to be tested, and after sequencing the PCR amplification product, judging the genotype of the maize carried by the maize to be tested according to the bases of the mutation sites Opaque2 Genotype.

[0017] Further, when the base of the mutation site is G, it indicates that the genotype of the maize to be tested is the wild genotype; Opaque2 Genotype is the wild genotype;

[0018] When the base of the mutation site is A, it indicates that the genotype of the maize to be tested is the homozygous mutant genotype. Opaque2 Genotype is the homozygous mutant genotype.

[0019] Further, when the maize is of the homozygous mutant genotype, the maize lysine concentration, maize kernel density and hardness are increased.

[0020] The beneficial effects of the present invention are as follows:

[0021] The present invention first screened in a maize EMS mutant library (MEMD, https: / / elabcaas.cn / memd / public / index.html# / ) to obtain mutants with plump grains and hard endosperm. o2 Through molecular identification of the o2 mutants, it was found that the single-base mutation (G→A) site occurred in the first exon. This site mutation can increase the lysine content of the grains without changing the yield. Studying the maize Opaque2 genotype and germplasm innovation can change the modifier genes of the soft and floury endosperm phenotype, thereby obtaining grains with increased essential amino acid content and unchanged physical properties, which is beneficial to increasing the commercial value of maize and promoting the development of the maize industry.

[0022] The molecular markers, primer pairs, and kits for the high-lysine locus of maize provided by the present invention can be well used to distinguish the Opaque2 wild type and mutant types, providing a new target for marker-assisted selection breeding and greatly shortening the breeding cycle. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, for those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0024] Figure 1 is o2 a schematic diagram of the mutation site in the gene structure.

[0025] Figure 2 is the phenotype of B73 wild type and mutants o2-1 and o2-2 .

[0026] Figure 3 is the amino acid content measurement results of B73 wild type and mutants o2-1 and o2-2 . DETAILED DESCRIPTION OF THE EMBODIMENTS

[0027] In order to enable those skilled in the art to better understand the technical solutions in the present invention, the following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0028] Example 1

[0029] A mutant with a lighter yellow grain color was crossed with the wild-type B73 to obtain F1. The F1 seeds were planted, and the F1 plants were self-crossed to obtain F2. Single grains with phenotypes were selected from the F2 population. After germination, DNA was extracted from each individual plant, and the DNA was mixed in equal amounts. MutMap cloning combined with exon capture sequencing was used, and it was found that the mutant phenotype was tightly linked to a G-to-A mutation at position 10799228 of the gene on chromosome 7 Opaque2 ( O2 : GRMZM2G015534). This mutation site is located at position 10799228 of the Opaque2 gene, resulting in premature termination of the encoded protein translation. This mutant was named o2-1 . A mutant with a mutation site located at position 10799907 of the Opaque2 gene, a G-to-A mutation that caused a change in the splicing site, was named o2-2 , o2-2 and o2-1 had similar phenotypes. By measuring the amino acids, it was found that the lysine content in o2-2 and o2-1 increased. Therefore, it was preliminarily determined that the increase in lysine content was caused by the O2 mutation.

[0030] An amino acid analyzer was used to detect the concentrations of each amino acid component in the o2-1 mutant, the o2-2 mutant, and the wild-type B73. Each sample was subjected to 3 biological replicates, and the results are shown in Table 1, Figure 3 . The values in Table 1 are the averages and standard deviations of 3 replicates. The letters in parentheses represent the significance of multiple comparisons at the alpha = 0.01 level between different genotypes (SNK method).

[0031] Table 1 Mean values of the nutritional traits of wild-type and o2 mutant grains

[0032] Genotype B73 o2-1 o2-2 Protein % 9.05±0.15 (b) 8.76±0.1 (b) 9.43±0.12 (a) Fatty acid % 7.18±0.13 (a) 7.3±0.06 (a) 6.9±0.11 (b) Total starch % 61.68±0.95 (a) 52.51±1.02 (b) 53.63±1.76 (b) Amylose % 18.68±0.96 (a) 14.56±0.46 (b) 14.36±0.45 (b) Cysteine mg / 100mg 0.14±0.01 (a) 0.17±0.01 (a) 0.08±0.01 (b) Alanine mg / 100mg 0.74±0.03 (a) 0.50±0.05 (b) 0.64±0.06 (b) Arginine mg / 100mg 0.41±0.04 (a) 0.48±0.01 (a) 0.53±0.02 (a) Aspartic acid mg / 100mg 0.64±0.03 (b) 0.76±0.02 (a) 0.82±0.03 (a) Glutamic acid mg / 100mg 1.72±0.06 (a) 1.45±0.02 (b) 1.75±0.05 (a) Glycine mg / 100mg 0.38±0.01 (b) 0.44±0.02 (a) 0.47±0.02 (a) Histidine mg / 100mg 0.22±0.01 (b) 0.25±0.02 (a) 0.28±0.01 (a) Isoleucine mg / 100mg 0.31±0.01 (b) 0.30±0.01 (b) 0.35±0.01 (a) Leucine mg / 100mg 1.07±0.07 (a) 0.83±0.03 (b) 0.98±0.04 (a) Lysine mg / 100mg 0.27±0.02 (b) 0.40±0.03 (a) 0.39±0.03 (a) Methionine mg / 100mg 0.15±0.02 (a) 0.10±0.02 (a) 0.11±0.01 (a) Ammonium chloride mg / 100mg 0.17±0.02 (a) 0.17±0.02 (a) 0.11±0.01 (a) Phenylalanine mg / 100mg 0.45±0.01 (a) 0.40±0.02 (a) 0.39±0.01 (a) Proline mg / 100mg 1.11±0.07 (a) 0.61±0.08 (b) 0.79±0.09 (b) Serine mg / 100mg 0.46±0.02 (a) 0.40±0.03 (a) 0.46±0.01 (a) Threonine mg / 100mg 0.33±0.01 (a) 0.33±0.01 (a) 0.36±0.01 (a) Tyrosine mg / 100mg 0.24±0.02 (a) 0.20±0.01 (a) 0.26±0.01 (a) Valine mg / 100mg 0.4±0.04 (b) 0.50±0.06 (a) 0.58±0.02 (a)

[0033] The first molecular marker locus is a sequence of 500 bp upstream and downstream of the 10799228th base on chromosome 7 of maize, as shown in Sequence 1. The bolded base is the single nucleotide polymorphism SNP:

[0034] GTGTTTGCTTCTCCCTTTCTTGACCTTTGCTTGGAACCATTGATTGATAGTTACTTATTATTGGGCATGGAGCACGTCATCTCAATGGAGGAGATCCTCGGGCCCTTCTGGGAGCTGCTACCACCGCCAGCGCCAGAGCCAGAGCCAGAGCGAGAGCAGCCTCCGGTAACCGGCATCGTCGTCGGCAGTGTCATAGACGTTGCTGCTGCTGGTCACGGTCATGGTGGCGGCGACATGATGGATCAGCAGCACGCCACAGAGTGGACCTTTGAGAGGTTACTGGAAGAGGAGGCTCTGACGACAAGCACACCGCCGCCGGTGGTGGTGGTGCCGAACTCTTGTTGCTCAGGCGCCCTAAATGTTGACCGGCCGCCGGTGATGGAAGAGGCGGTAATGATGGCGCCTGCGGCGGTGAGTAGTGCCGTAGTAGGGGACCCCATGGAGTACAATGCCATACTGAGGAGGAAGCTGGAGGAGGACCTCGAGGCCTTCAAAATGTG GAGGGTATATACACTGCTCGCTCTTCTTCCCTATCTTTATTATTCCCTCGCTATATCTTCGGCGGTTTACTCGTCTTTTATCTCTTATTTTACACTTCATTGTTGTATAAATAGTACAAAACAATGTTTTACACGGCCTGTACTGTACTCTCTATGGGCTACAGGGTTTGTAGTAGTACGTGTGTCTTATTAACTGGGGGTGCAATAACTGAAATCGGCCGGTGCCTTTTCTGACGTACTAAGTTTGTATCACCTACATCTAGTGCATCCAAACACACCTTCTAAAAGTGATGAGGGTAGGTAATCCATGATCTAGCTATAGAGATGTGGTGTTCTCGTTGAGCTATATGCCATGTTTGGCTATACAAACTGCCAAACAAGGATGCCACATCACAAGTCACTGTGCTTAGCTTGTTCTGTATATATGTATATAGCGCTAGCTAGTGTCACGAGATTTGTGATGTTGGATTTAGCTTACTAGGTTTTACACCACGAGTCATG。

[0035] The second molecular marker locus is a sequence of 500 bp upstream and downstream of the 10,799,907th base on chromosome 7 of maize, as shown in Sequence 2. The bolded bases are single nucleotide site variations SNP:

[0036] GTGTGTCTTATTAACTGGGGGTGCAATAACTGAAATCGGCCGGTGCCTTTTCTGACGTACTAAGTTTGTATCACCTACATCTAGTGCATCCAAACACACCTTCTAAAAGTGATGAGGGTAGGTAATCCATGATCTAGCTATAGAGATGTGGTGTTCTCGTTGAGCTATATGCCATGTTTGGCTATACAAACTGCCAAACAAGGATGCCACATCACAAGTCACTGTGCTTAGCTTGTTCTGTATATATGTATATAGCGCTAGCTAGTGTCACGAGATTTGTGATGTTGGATTTAGCTTACTAGGTTTTACACCACGAGTCATGTAAAACCTAGTAAACTAAATCCAACATCACAAAACCTAGTAAGCTAAATACAAACTAGCAATCCATTCTTAGCTTACTAGTTTTTTTTCAAAAAAAACTACGATAGCCACTCGATCTTTACAAACTTTTATTTGTTGAATTTTAAAACTTGAAATTTTGGCATATATACCCATCCACA GGCGGCCTCCAGTGTTGTGACCTCAGATCAACGTTCTCAAGGCTCAAACAATCACACTGGAGGTACTATATCTACTATATATATGTGCCATTATTACATTGTTTACAGACGTGCTTTTGTATATAGATATATATCCTGACTCTCGATCTGGCTCACTTAGGTAGCAGCATCAGGAATAATCCAGTGCAGAACAAGCTGATGAACGGCGAAGATCCAATCAACAATAACCACGCTCAAACCGCAGGCCTTGGCGTGAGGCTTGCTACTAGCTCTTCCTCGAGAGATCCTTCACCATCAGACGAAGACATGGACGGAGAAGTAGAGATTCTGGGGTTCAAGATGCCTACCGAGGAAAGAGTGAGGAAAAGGTAATTCCGGTTGATTTGCAGCTTATTAATTGTACGGTTTTTTTTTACTCCTGGGCTTATCGATCTGTCACTTGATTTTAATTAGAAAGGAATCCAATAGAGAATCAGCCAGACGCTCGAGATACAGGAAAGC。

[0037] Example 2

[0038] Genomic sequences of 500 bp were intercepted on both sides of the mutation site as templates for primer synthesis (a total of 1001 bp including the mutation site), and forward and reverse primers were designed using Primer Premier 5 with sequences 1 and 2 respectively. Primer design principle: T m value is around 60 °C, the product size is 300 - 700 bp, and the primer length is 20 - 21 bp.

[0039] The forward primer of the first molecular marker was designed, and its nucleotide sequence is as shown in sequence 3:

[0040] 5’- CTAAATGTTGACCGGCCGCC -3’;

[0041] The reverse primer of the first molecular marker was designed, and its nucleotide sequence is as shown in sequence 4:

[0042] 5’- GCACCGGCCGATTTCAGTTA -3’;

[0043] The forward primer of the second molecular marker was designed, and its nucleotide sequence is as shown in sequence 5:

[0044] 5’- GCCACATCACAAGTCACTGTG -3’;

[0045] The second molecular marker reverse primer was designed, and its nucleotide sequence is shown in Sequence 6:

[0046] 5’- CATCAGCTTGTTCTGCACTGG -3’.

[0047] The primers were synthesized by Nanjing Tsingke Biotechnology Co., Ltd. And the above primers were used to prepare a kit for detecting the high-lysine gene in maize. O2 gene.

[0048] Example 3

[0049] For the first molecular marker, the genomic DNA of the maize to be tested was PCR amplified using the primers of Sequence 3 and Sequence 4 in Example 2. The total volume of the PCR system was 25 μL, including 1 μL of each forward and reverse primer (10 μmol / L), 1 μL of genomic DNA, 0.2 μL of EasyTaq DNA polymerase, 2.5 μL of buffer, 2 μL of dNTPs, and dd H2O was added to make up to 25 μL.

[0050] The PCR reaction procedure was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles; over-extension at 72°C for 5 min; preservation at 16°C.

[0051] The length of the PCR amplification product was 371 bp, and then it was separated by 1% agarose gel electrophoresis. The PCR products that met the size of the target fragment were sent to the company for Sanger sequencing. The sequencing peak map was submitted to the SeqMan in the Lasergene software package for analysis. The results showed that the mutation site of the wild-type single plant was the G base, and the mutation site of the mutant single plant was the A base. It indicated that this marker could well distinguish the wild-type and mutant genes.

[0052] For the second molecular marker, the genomic DNA of the maize to be tested was PCR amplified using the primers of Sequence 5 and Sequence 6 in Example 2. The total volume of the PCR system was 25 μL, including 1 μL of each forward and reverse primer (10 μmol / L), 1 μL of genomic DNA, 0.2 μL of EasyTaq DNA polymerase, 2.5 μL of buffer, 2 μL of dNTPs, and dd H2O was added to make up to 25 μL.

[0053] The PCR reaction procedure was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles; over-extension at 72°C for 5 min; preservation at 16°C.

[0054] The length of the PCR amplification product is 496 bp, and then it is separated by 1% agarose gel electrophoresis. The PCR products that meet the size of the target fragment are sent to the company for Sanger sequencing. The sequencing peak map is submitted to the SeqMan of the Lasergene software package for analysis. The results show that the mutation site of the wild-type single plant is the G base, and the mutation site of the mutant single plant is the A base. This indicates that this marker can well distinguish between the wild-type and mutant genes.

[0055] Although the present invention has been described in detail by referring to the accompanying drawings and in combination with the preferred embodiments, the present invention is not limited thereto. Without departing from the spirit and essence of the present invention, those of ordinary skill in the art can make various equivalent modifications or substitutions to the embodiments of the present invention, and these modifications or substitutions should all be within the scope of the present invention. / Any person skilled in the art within the technical scope disclosed by the present invention can easily think of changes or substitutions, and all should be covered within the protection scope of the present invention.

Claims

1. Molecular marker for high-lysine locus in maize, characterized in that, Including: The first molecular marker, the wild type of the nucleotide sequence of the first molecular marker is shown in Sequence 1, and the mutation site of the first molecular marker is located on chromosome 7 of maize Opaque2 The base at position 10799228 of gene GRMZM2G015534, and the base at the mutation site is G, indicating that the maize Opaque2 genotype is the wild genotype, and the base at the mutation site is A, indicating that the maize Opaque2 genotype is the homozygous mutant genotype; and The second molecular marker, the wild type of the nucleotide sequence of the second molecular marker is shown in Sequence 2, and the mutation site of the second molecular marker is located on chromosome 7 of maize Opaque2 Base at position 10799907 of gene GRMZM2G015534, the base at the mutation site is G, indicating that the maize of the maize to be tested Opaque2 Genotype is the wild genotype, and the base at the mutation site is A, indicating that the maize of the maize to be tested Opaque2 Genotype is the homozygous mutant genotype.

2. A method for detecting the Opaque2 genotype of corn, characterized in that, Using a primer pair to perform PCR amplification on the genomic DNA of the maize to be tested. After sequencing the PCR amplification product, judge the genotype of the maize Opaque2 carried by the maize to be tested according to the bases at the mutation sites; The primer pair includes: The first molecular marker forward primer, and the nucleotide sequence of the forward primer is as shown in Sequence 3; The first molecular marker reverse primer, and the nucleotide sequence of the reverse primer is as shown in Sequence 4; The second molecular marker forward primer, and the nucleotide sequence of the forward primer is as shown in Sequence 5; The second molecular marker reverse primer, and the nucleotide sequence of the reverse primer is as shown in Sequence 6; The wild-type nucleotide sequence of the first molecular marker is shown in Sequence 1, and the mutation site of the first molecular marker is located on chromosome 7 of maize. Opaque2 The base at position 10799228 of gene GRMZM2G015534, and the base at the mutation site is G, indicating that the genotype of the maize to be tested is the wild genotype. When the base at the mutation site is A, it indicates that the genotype of the maize to be tested Opaque2 is the homozygous mutant genotype; Opaque2 ​ The wild-type nucleotide sequence of the second molecular marker is shown in Sequence 2, and the mutation site of the second molecular marker is located on chromosome 7 of maize Opaque2 The base at position 10799907 of gene GRMZM2G015534. When the base at the mutation site is G, it indicates that the maize to be tested Opaque2 has a wild genotype. When the base at the mutation site is A, it indicates that the maize to be tested Opaque2 has a homozygous mutant genotype; When the first molecular marker or the second molecular marker of maize is a homozygous mutant genotype, the lysine concentration of maize increases.

Images