Process for treating acid mine drainage by using acidophilic algae

Abstract

The application discloses a kind of acidophilic algae biological synergistic treatment acid mine wastewater process, belong to acid mine wastewater treatment field.Acidophilic algae, especially Parachlorella (Parachlorella sp.) AH02 screened in the application, form a kind of algae-bacteria synergistic biological treatment acid mine wastewater process with sulfate-reducing bacteria, first, acidophilic algae is pretreated to acid mine wastewater, remove part of sulfate, toxic copper ions etc. in wastewater, and produce soluble organic carbon;Subsequently, through sterilization treatment and light assistance, trigger the biological activity of acidophilic algae organic acid, chlorophyll, humic acid etc. Component and its photoelectron effect, thereby greatly improving the efficiency of acid mine wastewater sulfate reduction secondary treatment. The process avoids the problems of unstable removal effect of sulfate and heavy metals, high additional cost of additional carbon source in traditional sulfate reduction treatment of acid mine wastewater, realizes green, efficient and low-carbon treatment of pollutants in acid mine wastewater.

Description

Technical Field

[0001] This application belongs to the field of acidic mine wastewater treatment technology, specifically relating to a process for the synergistic biological treatment of acidic mine wastewater by acidophilic algae. Background Technology

[0002] Acid mine wastewater (AMD) is a type of water with a low pH (2.0–4.0) and rich in sulfates and heavy metal pollutants. It primarily originates from sulfide minerals (such as pyrite FeS2) in waste ore and tailings piles during metal mining operations, which are gradually oxidized and acidified by acidophilic bacteria after exposure to air. Generally, AMD contains sulfates ranging from 5000 to 20000 mg / L, and dissolved metals such as copper, manganese, zinc, lead, and arsenic can reach concentrations of tens to hundreds of mg / L. Its pollution control is a global environmental problem.

[0003] Sulfate-reducing bacteria (SRB)-based biological treatment of AMD is widely considered a green and effective technology for treating AMD. The principle is that SRBs reduce sulfate in AMD to sulfides through dissimilatory reduction reactions. These sulfides then convert many soluble heavy metal ions in AMD into poorly soluble metal sulfide precipitates, thus achieving simultaneous removal of sulfate and heavy metals. Compared to chemical processes such as lime neutralization and electrochemical methods, the sulfate biological reduction method for treating AMD has advantages such as broad applicability, less secondary pollution, and selective recovery of precious (heavy) metals.

[0004] However, based on existing research and practice, the practical application of SRB in AMD treatment faces challenges such as high cost and unstable sulfate / heavy metal removal efficiency. This is mainly because: ① SRB are neutrophils, growing well in neutral to slightly acidic water environments (pH>4.0). The lower pH environment of AMD significantly inhibits SRB growth; ② SRB are chemoheterotrophs, requiring organic carbon (glucose, sodium lactate, ethanol, etc.) as a carbon source for growth. However, the endogenous organic matter content in AMD is typically very low (<50 mg / L). To achieve the removal of high-concentration sulfate (>5000 mg / L) in AMD, it is necessary to add a large amount of carbon source to the AMD biological treatment system (ensuring COD / SO4 levels in the system are within acceptable limits). 2- (Achieving a value of 0.67 or higher), the cost of adding additional carbon sources is generally very high; ③ Copper ions in AMD will strongly poison the growth of SRB, resulting in low actual reduction efficiency of sulfate or failure to remove heavy metals.

[0005] Therefore, there is an urgent need to develop a new process that enhances the biological treatment of sulfate reduction, tailored to the actual water quality characteristics of AMD. Summary of the Invention

[0006] 1. The problem to be solved

[0007] This application addresses one of the problems existing in the prior art of sulfate reduction biological treatment of AMD: high cost of carbon source addition and unstable removal effect of sulfate and heavy metals. It provides a process for the synergistic biological treatment of acidic mine wastewater by acidophilic algae, especially *Chlorella pseudochlorella* screened in this application. Parachlorella (sp.)AH02, enhanced sulfate-reducing bacteria treatment for AMD. This process is designed for the actual water quality characteristics of AMD, such as low pH, high sulfate load, and high heavy metal content, and can treat AMD more efficiently and with lower carbon emissions.

[0008] 2. Technical Solution

[0009] To solve the above problems, the technical solution adopted in this application is as follows:

[0010] This application provides a process for the synergistic biological treatment of acidic mine wastewater using acidophilic algae, the process comprising the following steps:

[0011] S1, acidophilic algae pretreatment, includes: inoculating acidophilic algae into acidic mine wastewater, adding nutrients for acidophilic algae, culturing under light, and obtaining pretreated acidic mine wastewater samples; during the growth process, acidophilic algae can assimilate and absorb 40-50% of sulfates in acidic mine wastewater, release dissolved organic carbon, and adsorb toxic heavy metals such as copper ions.

[0012] S2, sterilization treatment, includes: sterilizing the pretreated acidic mine wastewater sample to obtain sterilized acidic mine wastewater sample; during the sterilization process, the organic acids, chlorophyll, humic acid and other bioactive components carried by acidophilic algae can be effectively released, which promotes the efficiency of the subsequent sulfate reduction secondary treatment in S3.

[0013] S3, the secondary treatment for sulfate reduction, includes: inoculating sludge containing sulfate-reducing bacteria into sterilized acidic mining wastewater samples, adding a carbon source, and conducting secondary biological reduction of sulfate under light; obtaining sludge and final effluent after settling; since dissolved organic carbon is released in S1, the amount of carbon source added in S3 can be reduced, saving costs; and under light treatment, the photoelectric effect (photogenerated electrons) of bioactive components such as organic acids, chlorophyll, and humic acid released during sterilization in S2 is induced by light, which significantly improves the removal efficiency of sulfate and heavy metals in the secondary treatment of sulfate reduction in acidic mining wastewater.

[0014] Furthermore, the aforementioned acidophilic algae is *Chlorella pseudochlorella* (… Parachlorellasp.) AH02 was obtained by screening in acidic mine wastewater and is deposited at the China General Microbiological Culture Collection Center, Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO.40698.

[0015] Furthermore, in S1 above, the inoculation density of *Chlorella vulgaris* is 1 × 10⁻⁶. 6 ~1×10 7 cells / mL.

[0016] Furthermore, in S1 above, the Chlorella pseudotrophicum nutrient includes any one or more of the following: NaNO3, K2HPO4, MgSO4·7H2O, CaCl2·2H2O, Na2CO3, and citric acid.

[0017] Further, in S1 above, the Chlorella simulans nutrient solution (g / L) includes any one or more of the following: NaNO3 0.1~1.5, K2HPO4 0.01~0.04, MgSO4·7H2O 0.01~0.075, CaCl2·2H2O 0.01~0.036, Na2CO3 0.01~0.02, and citric acid 0.001-0.01.

[0018] Furthermore, in S1 above, the Chlorella simulans nutrient solution (g / L) includes: NaNO3 1.5.

[0019] Furthermore, in S1 above, the Chlorella simulans nutrient solution (g / L) includes: K2HPO4 0.04 and CaCl2·2H2O 0.036.

[0020] Furthermore, in S1 above, the cultivation under light includes: a light intensity of 0.2~2 mW / cm². 2 Incubate at 15-30℃ for 5-20 days.

[0021] Furthermore, in the above S2, the sterilization process includes: high-temperature sterilization at 121°C for 5 min, or water bath heating at 65°C for 30 min, or ultraviolet irradiation for 60 min.

[0022] Furthermore, in S3 above, the inoculation amount of sludge containing sulfate-reducing bacteria is 5~20 gVS / L.

[0023] Furthermore, in S3 above, the carbon source includes carbon-containing organic waste, such as shrimp shell powder, corn cobs, and waste molasses.

[0024] Furthermore, in S3 above, the amount of carbon-containing organic waste added is 3~5 g / L.

[0025] Furthermore, in S3 above, the secondary treatment for sulfate biological reduction under light includes: a light intensity of 0.2~2 mW / cm². 2 20~35℃, anaerobic, stirred at 50~100 rpm, for 3~7 days.

[0026] This application also provides a *Chlorella vulgaris* ( Parachlorella sp.) AH02 was obtained by screening in acidic mine wastewater and is deposited at the China General Microbiological Culture Collection Center, Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO.40698.

[0027] Furthermore, the above-mentioned Chlorella pseudochlorella has an 18S rRNA gene sequence as shown in SEQ ID NO.3.

[0028] This application also provides the application of the above-mentioned Chlorella pseudochlorella in the treatment of acid mine wastewater (AMD), which includes: Chlorella pseudochlorella biosynthesis of sulfate-reducing organisms (such as sulfate-reducing bacteria) to treat acid mine wastewater.

[0029] Furthermore, the above application includes the following steps:

[0030] S1, Chlorella pretreatment, includes: inoculating acidic mine wastewater with Chlorella, adding Chlorella nutrients, culturing under light, and obtaining pretreated acidic mine wastewater samples; during its growth, Chlorella can assimilate and absorb 40-50% of sulfates in acidic mine wastewater, release dissolved organic carbon, and adsorb toxic heavy metals such as copper ions;

[0031] S2, sterilization treatment, includes: sterilizing the pretreated acidic mine wastewater sample to obtain sterilized acidic mine wastewater sample; during the sterilization process, the bioactive components such as organic acids, chlorophyll, and humic acid carried by Chlorella can be effectively released, which promotes the efficiency of the subsequent sulfate reduction secondary treatment in S3.

[0032] S3, the secondary treatment for sulfate reduction, includes: inoculating sludge containing sulfate-reducing bacteria into sterilized acidic mining wastewater samples, adding a carbon source, and conducting secondary biological reduction of sulfate under light; obtaining sludge and final effluent after settling; since dissolved organic carbon is released in S1, the amount of carbon source added in S3 can be reduced, saving costs; and under light treatment, the photoelectric effect (photogenerated electrons) of bioactive components such as organic acids, chlorophyll, and humic acid released during sterilization in S2 is induced by light, which significantly improves the removal efficiency of sulfate and heavy metals in the secondary treatment of sulfate reduction in acidic mining wastewater.

[0033] Furthermore, in S1 above, the inoculation density of *Chlorella vulgaris* is 1 × 10⁻⁶. 6 ~1×10 7 cells / mL.

[0034] Furthermore, in S1 above, the Chlorella pseudotrophicum nutrient includes any one or more of the following: NaNO3, K2HPO4, MgSO4·7H2O, CaCl2·2H2O, Na2CO3, and citric acid.

[0035] Further, in S1 above, the Chlorella simulans nutrient solution (g / L) includes any one or more of the following: NaNO3 0.1~1.5, K2HPO4 0.01~0.04, MgSO4·7H2O 0.01~0.075, CaCl2·2H2O 0.01~0.036, Na2CO3 0.01~0.02, and citric acid 0.001-0.01.

[0036] Furthermore, in S1 above, the Chlorella simulans nutrient solution (g / L) includes: NaNO3 1.5.

[0037] Furthermore, in S1 above, the Chlorella simulans nutrient solution (g / L) includes: K2HPO4 0.04 and CaCl2·2H2O 0.036.

[0038] Furthermore, in S1 above, the cultivation under light includes: a light intensity of 0.2~2 mW / cm². 2 Incubate at 15-30℃ for 5-20 days.

[0039] Furthermore, in the above S2, the sterilization process includes: high-temperature sterilization at 121°C for 5 min, or water bath heating at 65°C for 30 min, or ultraviolet irradiation for 60 min.

[0040] Furthermore, in S3 above, the inoculation amount of sludge containing sulfate-reducing bacteria is 5~20 gVS / L.

[0041] Furthermore, in S3 above, the carbon source includes carbon-containing organic waste, such as shrimp shell powder, corn cobs, and waste molasses.

[0042] Furthermore, in S3 above, the amount of carbon-containing organic waste added is 3~5 g / L.

[0043] Furthermore, in S3 above, the secondary treatment of sulfate biological reduction under light includes: a light intensity of 0.2~2 mW / cm². 2 20~35℃, anaerobic, stirred at 50~100 rpm, for 3~7 days.

[0044] 3. Beneficial effects

[0045] Compared with the prior art, the advantages of this application are as follows:

[0046] (1) This application provides a process for the synergistic biological treatment of acidic mine wastewater by acidophilic algae and sulfate-reducing bacteria. The process involves the synergistic biological treatment of acidic mine wastewater by acidophilic algae and sulfate-reducing bacteria. First, the acidophilic algae, during their growth in the acidic mine wastewater, assimilate and absorb sulfate, adsorb copper ions, and release organic carbon, creating favorable conditions for the subsequent sulfate reduction secondary treatment (removing some sulfate + providing a carbon source + avoiding the toxicity of copper ions). Second, through sterilization and light-assisted treatment, the bioactive components of the acidophilic algae, such as organic acids, chlorophyll, and humic acid, and their photoelectric effect (photogenerated electrons) are activated, thereby significantly improving the removal efficiency of sulfate and heavy metals in the sulfate reduction secondary treatment of acidic mine wastewater. Compared with existing sulfate reduction treatment processes for acidic mine wastewater, this process solves the problems of unstable sulfate and heavy metal removal and avoids the drawbacks of requiring large amounts of exogenous organic carbon, significantly improving the technical and economic feasibility of the treatment.

[0047] (2) A type of Chlorella pseudo-Hylocereus provided in this application ( Parachlorella AH02, obtained through screening in acidic mining wastewater, was applied to the treatment of acidic mining wastewater. It forms a synergistic biological treatment process between algae and sulfate-reducing bacteria, first using *Chlorella pseudochlorella* (sp.) Parachlorella During its growth in acidic mining wastewater, sp. AH02 exhibits multiple functions, including assimilating and absorbing sulfate, adsorbing copper ions, and releasing organic carbon, creating favorable conditions for subsequent secondary sulfate reduction treatment (removing some sulfate, providing a carbon source, and avoiding the toxicity of copper ions). Secondly, through sterilization and light-assisted treatment, it triggers the release of organic acids, chlorophyll, humic acid, and other bioactive components of Chlorella vulgaris, along with their photoelectric effect (photogenerated electrons), thereby significantly improving the removal efficiency of sulfate and heavy metals in the secondary sulfate reduction treatment of acidic mining wastewater.

[0048] (3) A type of Chlorella pseudochlorella provided in this application ( Parachlorella AH02 (sp.) was obtained by screening acidic mine wastewater and has strong adaptability to extreme acidic conditions.

[0049] (4) The present application provides a process for the synergistic treatment of acidic mine wastewater by acidophilic algae, such as Chlorella pseudoepiphyllum and sulfate-reducing bacteria. The nutrients required for the growth of acidophilic algae are widely available, inexpensive and readily available. In addition, the entire treatment process is simple to operate, green, efficient and economical. Attached Figure Description

[0050] Figure 1 It is Chlorella pseudochlorella ( Parachlorella Morphological characteristics of sp.) AH02 plate.

[0051] Figure 2 It is Chlorella pseudochlorella ( Parachlorella Phylogenetic tree of 18S rRNA of sp.) AH02.

[0052] Figure 3 It is Chlorella pseudochlorella ( Parachlorella Flowchart of the process for co-processing AMD with sulfate bioreduction (sp.).

[0053] Figure 4 It consists of the original AMD water sample, the water sample after pretreatment with Chlorella pseudochlorella, and the final water sample after secondary treatment with algae and bacteria. Detailed Implementation

[0054] The present application will be further described below with reference to specific embodiments.

[0055] It should be noted that terms such as "upper", "lower", "left", "right", and "middle" used in this specification are only for clarity of description and are not intended to limit the scope of implementation. Changes or adjustments to their relative relationships, without substantially altering the technical content, should also be considered as within the scope of this application.

[0056] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains; the term “and / or” as used herein includes any and all combinations of one or more of the associated listed items.

[0057] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0058] As used herein, the term “about” is used to provide for the flexibility and imprecision associated with a given term, measure, or value. Those skilled in the art can readily determine the degree of flexibility for a particular variable.

[0059] As used herein, the term “at least one of…” is intended to be synonymous with “one or more of…”. For example, “at least one of A, B, and C” explicitly includes only A, only B, only C, and combinations thereof.

[0060] Concentration, amount, and other numerical data may be presented in range format herein. It should be understood that such range format is used solely for convenience and brevity and should be flexibly interpreted to include not only the values ​​explicitly stated as the limits of the range, but also all individual values ​​or subranges encompassed within the range, as if each value and subrange were explicitly stated. For example, a range of values ​​from about 1 to about 4.5 should be interpreted to include not only the explicitly stated limits of 1 to 4.5, but also individual numbers (such as 2, 3, 4) and subranges (such as 1 to 3, 2 to 4, etc.). The same principle applies to ranges that describe only a single value, such as "less than about 4.5," which should be interpreted to include all the values ​​and ranges described above. Furthermore, this interpretation should apply regardless of the breadth of the range or characteristic described.

[0061] Example 1

[0062] This embodiment provides Chlorella vulgaris ( Parachlorella Screening, isolation and identification of sp.) AH02.

[0063] Culture medium (mg / L):

[0064] NaNO3 1500, K2HPO4 40, MgSO4·7H2O 75, CaCl2·2H2O 36, Citric acid 6, Ferric ammonium citrate 6, Na2CO3 20, H3BO3 2.86, MnCl2·4H2O 1.86, NaMoO4·2H2O 0.22, CuSO4·5H2O 0.08, Co(NO3)2·6H2O 0.05.

[0065] Algae screening and separation:

[0066] Take 1 L of acidic water from a metal mine in Ma'anshan, Anhui Province. Enrichment culture was carried out using the above-mentioned culture medium at 25℃ and a light intensity of 2500 lx. After visible algal growth was observed in the enrichment solution, the following steps were performed: ① 100 mL of the algal culture medium was serially diluted, and then the diluted solution was injected into the solid culture medium described above for plate spreading and incubation at 25℃ and a light intensity of 2500 lx; ​​② After new algae grew, the plates were streaked until single algae were isolated, such as... Figure 1 As shown, the purified algae was obtained and named AH02.

[0067] Algae identification:

[0068] Molecular biology techniques were used to identify the isolated algae AH02. Algal DNA was extracted using the Wzup column-based fungal genomic DNA extraction kit, with primers NS1: GTAGTCATATGCTTGTCTC (SEQ ID NO.1) and NS6: GCATCACAGACCTGTTATTGCCTC (SEQ ID NO.2). The reaction program was: 95℃ for 5 min; 94℃ for 30 s, annealing at 57℃ for 30 s, extension at 72℃ for 90 s, for a total of 30 cycles, followed by a final extension at 72℃ for 10 min. The PCR products were bidirectionally sequenced by Shanghai Sangon Biotech Co., Ltd., and the results were as follows:

[0069]

[0070] The sequencing results were entered into GenBank for homology comparison, and a phylogenetic tree of 18S rRNA was constructed using MEGA11 software. The results are as follows: Figure 2 As shown, it is *Chlorella pseudochlorella* ( Parachlorella sp.).

[0071] Chlorella vulgaris ( Parachlorella sp.) AH02, deposited at the China General Microbiological Culture Collection Center, China, Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, on June 5, 2023, with accession number CGMCC NO.40698.

[0072] Example 2

[0073] This embodiment provides the *Chlorella vulgaris* screened in Example 1 (… Parachlorella Application of AH02 (sp.) in the treatment of acidic mine wastewater. This application is for Chlorella vulgaris (sp.) Parachlorella The process of using AH02 in synergistic sulfate reduction biological treatment of acidic mine wastewater, such as... Figure 3 As shown.

[0074] In this embodiment, the water sample is acidic mine wastewater from the Jianghuai region, with a pH of 2.56 and SO4 content of [missing information]. 2- The content is 15200 mg / L, the dissolved organic carbon (DOC) content is 16 mg / L, and the contents of metal ions Mn, Cu, Zn, Pb, and Ni are 212 mg / L, 2.0 mg / L, 12 mg / L, 4.2 mg / L, and 2.5 mg / L, respectively.

[0075] A type of *Chlorella* (specifically referring to a type of algae) was found in the above water sample. Parachlorella The process of using AH02 in synergistic sulfate reduction biological treatment of acidic mine wastewater includes:

[0076] S1, Pretreatment of acidophilic algae, including: adding 1×10⁻⁶ aluminosiflora to the water sample. 7 Chlorella cells / mL Parachlorella (sp.) AH02, 1.5 g / L NaNO3 algal nutrient solution, 2 mW / cm 2 After 10 days of light cultivation, the dissolved organic carbon (DOC) content in the obtained water samples increased, the sulfate content decreased to 9160 mg / L, and the contents of Mn, Cu, Zn, Pb, and Ni decreased to 197 mg / L, 0.8 mg / L, 10 mg / L, 4.0 mg / L, and 2.2 mg / L, respectively.

[0077] S2, sterilization treatment, including: sterilizing the water sample obtained in S1 by heating it in a water bath at 65°C for 30 min. The obtained water sample contains bioactive components such as organic acids, chlorophyll, and humic substances, while the contents of sulfate and Mn, Cu, Zn, Pb, Ni, etc. remain almost unchanged.

[0078] S3, secondary treatment with sulfate reduction, includes: adding 5.0 gVS / L of sulfate-reducing bacteria-containing sludge, 3 g / L of shrimp shell powder, and 2 mW / cm³ of sulfate-reducing bacteria to the water sample obtained in S2. 2 Sulfate bioreduction was performed under light irradiation, with anaerobic treatment at 50 rpm stirring and 20°C for 7 days. During the treatment, a large amount of dark black precipitate was observed to form. XRD analysis showed that the precipitate was a metal sulfide. I-t Electrochemical detection showed that the photocurrent intensity in this treatment system was 0.3–0.5 μA / cm. 2 The treated water sample was analyzed by ICP-OES. The pH value was 6.8, the sulfate removal rate was 82%, and the removal rates of heavy metals such as Mn, Cu, Zn, Pb, and Ni were all over 90%.

[0079] S4, the water sample obtained in S3 is allowed to settle and precipitate, resulting in solid metal sulfide sludge and the final effluent, such as... Figure 4 As shown, the final effluent after treatment by this application is clear and transparent, and the heavy metal concentration meets the discharge standards.

[0080] Example 3

[0081] This embodiment provides the *Chlorella vulgaris* screened in Example 1 (… Parachlorella Application of AH02 in the treatment of acidic mine wastewater. Referring to Example 2, this application involves a species of Chlorella (sp.) Parachlorella A process for the synergistic biological treatment of acidic mine wastewater using AH02 and sulfate reduction.

[0082] In this embodiment, the water sample is acidic mine wastewater from a copper mine in Jiangxi Province, with a pH of 2.97 and SO4 content of [missing information]. 2- The content was 4970 mg / L, the dissolved organic carbon (DOC) content was 8.8 mg / L, and the metal ion contents of Cu and As were 97 mg / L and 3.6 mg / L, respectively.

[0083] A type of *Chlorella* (specifically referring to a type of algae) was found in the above water sample. Parachlorella The process of using AH02 in synergistic sulfate reduction biological treatment of acidic mine wastewater includes:

[0084] S1, Pretreatment of acidophilic algae, including: adding 1×10⁻⁶ aluminosiflora to the water sample. 6 Chlorella cells / mLParachlorella AHO2, CaCl2·2H2O (0.036 g / L) and K2HPO4 (0.04 g / L) were used as nutrients for algae, at 2 mW / cm². 2 After 20 days of light cultivation, the dissolved organic carbon (DOC) content in the obtained water samples increased, the sulfate content decreased to 2286 mg / L, and the Cu and As ion contents decreased to 22 mg / L and 3.5 mg / L, respectively.

[0085] S2, sterilization treatment, including: sterilizing the water sample obtained in S1 by ultraviolet irradiation for 60 min. The obtained water sample contains bioactive components such as organic acids, and the contents of sulfate, Cu, As and other substances are almost unchanged.

[0086] S3, secondary treatment with sulfate reduction, includes: adding 16 gVS / L of sulfate-reducing bacteria-containing sludge, 5 g / L of corn cob, and 2 mW / cm³ of [unclear - possibly a chemical formula] to the water sample obtained in S2. 2 Sulfate bioreduction was performed under light irradiation, with anaerobic treatment at 100 rpm stirring and 35°C for 3 days. During the treatment, a large amount of dark black precipitate was observed to form. XRD analysis showed that the precipitate was a metal sulfide. I-t Electrochemical detection showed that the photocurrent intensity in this treatment system was 0.6–0.7 μA / cm. 2 The treated water sample was analyzed by ICP-OES. The pH value was 7.2, the sulfate removal rate was 93%, and the removal rate of heavy metals such as Cu and As was over 95%.

[0087] S4. The water sample obtained in S3 is allowed to settle and precipitate to obtain solid metal sulfide sludge and the final effluent.

[0088] Comparative Example 1

[0089] This comparative example demonstrates the effectiveness of treating acidic mine wastewater using a traditional sulfate biological reduction process, without the addition of Chlorella vulgaris (…). Parachlorella AH02 (sp.) is used to treat acidic mine wastewater.

[0090] Referring to Example 2, the water sample was the original acidic mine wastewater sample from Example 2. The specific steps are as follows:

[0091] (1) Add 20 g / L of shrimp shell powder to the acidic mine wastewater sample to provide an organic carbon source;

[0092] (2) Add 5.0 gVS / L of sludge containing sulfate-reducing bacteria to the above acidic mine wastewater sample, and treat it for 7 days under anaerobic conditions of 50 rpm stirring and 20°C; no obvious dark black precipitate or photoelectric signal was observed during the entire treatment process.

[0093] The treated water sample had a pH of 2.86, a sulfate removal rate of less than 5%, and a heavy metal removal rate of less than 10% for Mn, Cu, Zn, Pb, and Ni.

[0094] Comparative Example 2

[0095] This comparative example demonstrates the effectiveness of treating acidic mine wastewater using a traditional sulfate biological reduction process, without the addition of Chlorella vulgaris (…). Parachlorella sp. AH02 is used to treat acidic mine wastewater.

[0096] Referring to Example 3, the water sample was the original acidic mine wastewater sample from Example 3. The specific steps are as follows:

[0097] (1) Add 20 g / L of corn cob to the acidic mine wastewater sample to provide an organic carbon source;

[0098] (2) 15.0 gVS / L of sludge containing sulfate-reducing bacteria was added to the above-mentioned acidic mine wastewater sample, and the mixture was treated for 3 days under anaerobic conditions of 100 rpm stirring and 35°C. During the treatment, a very small amount of dark black flocculents were observed to form, and no photocurrent signal was detected.

[0099] The treated water sample was tested and found to have a pH of 4.52, a sulfate removal rate of approximately 35%, and a Cu and As removal rate of approximately 45%.

[0100] Comparative Example 3

[0101] This comparative example also provides a *Chlorella* species ( Parachlorella The process of treating acidic mine wastewater with AH02 in synergistic sulfate reduction biological treatment differs in that: *Chlorella pseudochlorella* (sp.) Parachlorella The acidic mine wastewater pretreated with sp.)AH02 was not sterilized.

[0102] Referring to Example 2, the water sample was the original acidic mine wastewater sample from Example 2. The specific steps are as follows:

[0103] (1) Add a solution with a density of 1×10 to the above-mentioned acidic mine wastewater sample. 7 Chlorella cells / mL Parachlorella (sp.) AH02, 1.5 g / L NaNO3 algal nutrient solution, 2 mW / cm 2 After 10 days of light cultivation, the dissolved organic carbon (DOC) content in the obtained water samples increased, the sulfate content decreased to 9160 mg / L, and the contents of Mn, Cu, Zn, Pb, and Ni decreased to 197 mg / L, 0.8 mg / L, 10 mg / L, 4.0 mg / L, and 2.2 mg / L, respectively.

[0104] (2) Add 5.0 gVS / L of sulfate-reducing bacteria-containing sludge and 3 g / L of shrimp shell powder directly to the water sample obtained above, at 2 mW / cm 2 Sulfate bioreduction was performed under both light and non-light conditions, with anaerobic stirring at 50 rpm and treatment at 20°C for 7 days.

[0105] No photoelectric signals or obvious dark black precipitates were observed throughout the treatment process. Analysis of the treated water samples showed that the removal efficiency was essentially the same under both illuminated and non-illuminated conditions, approximately 39.7% for sulfate, and less than 30% for heavy metals such as Mn, Cu, Zn, Pb, and Ni.

[0106] Comparative Example 4

[0107] This comparative example also provides a *Chlorella* species ( Parachlorella The process of AH02 co-processing with sulfate reduction biological treatment of acidic mine wastewater differs in that the sulfate biological reduction treatment is carried out under non-light conditions.

[0108] Referring to Example 2, the water sample was the original acidic mine wastewater sample from Example 2. The specific steps are as follows:

[0109] (1) Add a solution with a density of 1×10 to the above-mentioned acidic mine wastewater sample. 7 Chlorella cells / mL Parachlorella (sp.) AH02, 1.5 g / L NaNO3 algal nutrient solution, 2 mW / cm 2 After 10 days of light cultivation, the dissolved organic carbon (DOC) content in the obtained water samples increased, the sulfate content decreased to 9160 mg / L, and the contents of Mn, Cu, Zn, Pb, and Ni decreased to 197 mg / L, 0.8 mg / L, 10 mg / L, 4.0 mg / L, and 2.2 mg / L, respectively.

[0110] (2) The water sample obtained in S1 was sterilized by heating in a water bath at 65°C for 30 min. The obtained water sample contained bioactive components such as organic acids, chlorophyll, and humic substances, while the contents of sulfate, Mn, Cu, Zn, Pb, and Ni remained almost unchanged.

[0111] (3) Add 5.0 gVS / L of sludge containing sulfate-reducing bacteria and 3 g / L of shrimp shell powder to the water sample obtained in S2, and carry out sulfate biological reduction treatment under no light conditions, anaerobic stirring at 50 rpm and 20℃ for 7 days.

[0112] No photoelectric signals or obvious dark black precipitate were observed throughout the treatment process. Analysis of the treated water sample showed a sulfate removal rate of approximately 39%, while the removal rates of heavy metals such as Mn, Cu, Zn, Pb, and Ni were all less than 33%.

[0113] Comparative Example 5

[0114] This comparative example also provides a *Chlorella* species ( Parachlorella The process of treating acidic mine wastewater with AH02 in synergistic sulfate reduction biological treatment differs in that: simultaneous inoculation with Chlorella vulgaris (sp.) Parachlorella sp.) AH02 and sludge containing sulfate-reducing bacteria.

[0115] Referring to Example 2, the water sample was the original acidic mine wastewater sample from Example 2. The specific steps are as follows:

[0116] The algae density added to the above-mentioned acidic mine wastewater sample in a single batch was 1×10⁻⁶. 7 Chlorella cells / mL Parachlorella sp.) AH02, 1.5 g / L NaNO3 algal nutrient, and 5.0 gVS / L sludge containing sulfate-reducing bacteria, 3 g / L shrimp shell powder, at 2 mW / cm 2 Simultaneous bioreduction of Chlorella and sulfate-reducing bacteria was carried out under illumination, with anaerobic conditions of 50 rpm stirring and 20°C for 17 days. No black precipitate or photoelectric signal was observed throughout the entire treatment process.

[0117] The treated water samples were tested, and the removal rates of sulfate and heavy metals such as Mn, Cu, Zn, Pb, and Ni were all less than 10%.

[0118] From the perspective of removing sulfates and heavy metals from acidic mine wastewater, the acidophilic algae *Chlorella vulgaris* (from this application) is effective. Parachlorella The process of AH02 co-processing with sulfate reduction biological treatment can achieve economical and efficient removal of pollutants from acidic mine wastewater under conditions of low pH and low exogenous carbon addition through the coupling effect of algae and bacteria.

Claims

1. A process for the synergistic biological treatment of acidic mine wastewater by acidophilic algae, characterized in that, The process includes the following steps: S1, acidophilic algae pretreatment, including: inoculating acidophilic algae into acidic mine wastewater, adding nutrients for acidophilic algae, culturing under light, and obtaining pretreated acidic mine wastewater samples; S2, sterilization treatment, including: sterilizing the pretreated acidic mine wastewater sample to obtain a sterilized acidic mine wastewater sample; S3, secondary treatment for sulfate reduction, includes: inoculating a sterilized acidic mine wastewater sample with sludge containing sulfate-reducing bacteria, adding a carbon source, and carrying out secondary treatment for sulfate biological reduction under light; after settling, sludge and final effluent are obtained; The acidophilic algae is *Chlorella vulgaris* ( Parachlorella sp.) AH02 is deposited at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC NO.40698.

2. The process for the synergistic biological treatment of acidic mine wastewater using acidophilic algae according to claim 1, characterized in that, In step S3, the inoculation amount of sludge containing sulfate-reducing bacteria is 5~20 gVS / L; the secondary sulfate reduction treatment under light includes a light intensity of 0.2~2 mW / cm². 2 20~35℃, anaerobic, stirred at 50~100 rpm, for 3~7 days.

3. The process for the synergistic biological treatment of acidic mine wastewater using acidophilic algae according to claim 1 or 2, characterized in that, In step S1, the cultivation under light includes a light intensity of 0.2~2 mW / cm². 2 Incubate at 15-30℃ for 5-20 days.

4. The process for the synergistic biological treatment of acidic mine wastewater using acidophilic algae according to claim 3, characterized in that, The Chlorella symbiontae nutrient solution includes any one or more of the following: NaNO3, K2HPO4, MgSO4·7H2O, CaCl2·2H2O, Na2CO3, and citric acid.

5. The process for the synergistic biological treatment of acidic mine wastewater using acidophilic algae according to claim 4, characterized in that, The inoculation density of the *Chlorella* species is 1 × 10⁻⁶. 6 ~1×10 7 cells / mL.

6. The process for the synergistic biological treatment of acidic mine wastewater using acidophilic algae according to claim 5, characterized in that, In step S3, the carbon source includes carbon-containing organic waste, and the amount of carbon-containing organic waste added is 3~5 g / L.

7. The process for the synergistic biological treatment of acidic mine wastewater using acidophilic algae according to claim 6, characterized in that, In S2, the sterilization process includes: high-temperature sterilization at 121°C for 5 min, or water bath heating at 65°C for 30 min, or ultraviolet irradiation for 60 min.

8. A type of Chlorella pseudo-bacteria ( Parachlorella sp.) AH02, characterized in that, It is deposited at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC NO.40698.

9. The application of *Chlorella vulgaris* as described in claim 8 in the treatment of acidic mine wastewater, characterized in that... The application includes the use of *Chlorella vulgaris* in synergistic sulfate reduction biological treatment of acidic mine wastewater.

Images