SPARC protein gene regulatory elements, functionalized albumin nanoformulations and their applications

Abstract

The present application embodiment discloses a SPARC protein gene regulatory element, a functionalized albumin nanoformulation and an application, wherein the nucleotide sequence of the gene regulatory element is shown in SEQ ID NO: 1. The functionalized albumin nanoformulation encapsulates the SPARC protein gene regulatory element and the mRNA encoding dCas9‑VP64, and the sequence of the gene regulatory element is shown in SEQ ID NO: 1. Through the SPARC protein gene regulatory element, tumor cells can be specifically identified and the content of SPARC protein in the tumor microenvironment can be upregulated, thereby improving the delivery efficiency of albumin nanoparticles to tumor cells.

Description

Technical Field

[0001] The present application relates to the field of anti-tumor drug preparations, and specifically to a gene regulatory element targeting SPARC protein, an albumin nanoparticle preparation and applications thereof. Background Art

[0002] After systemic administration through blood vessels, anti-tumor drugs are blocked by endothelial cells and other physiological barriers, making it difficult to enrich in the tumor site, resulting in insufficient drug concentration in the tumor site and inability to effectively kill tumor cells. Further increasing the systemic dosage is likely to cause extensive and serious toxic and side effects, which is not an appropriate solution. In recent decades, a large number of studies have focused on designing and optimizing the preparation process and physicochemical properties of nano drug carriers to improve the efficiency of tumor-targeted drug delivery. Many nano drug carriers, such as liposomes, micelles, dendrimers, and nanoparticles, can achieve passive targeted delivery to tumor tissues through enhanced permeability and retention (EPR), and can also actively promote binding and uptake with tumor cells by surface modification of targeting ligands or the use of stimuli-responsive materials, but these methods have limited success in clinical applications.

[0003] Serum albumin is a highly abundant plasma protein that has been widely used in the development of nano-drug carriers for the delivery of chemotherapeutic drugs, protein drugs, fluorescent dyes, and gene therapy drugs. Among them, Abraxane (ABR) is an albumin-bound paclitaxel nanoformulation that has been approved for the treatment of metastatic breast cancer and pancreatic cancer. Several clinical studies have reported that the therapeutic effect of ABR is significantly positively correlated with the expression level of secreted proteinacidic and rich in cysteine ​​(SPARC) in tumors. SPARC is a matrix cell glycoprotein that binds to albumin with high affinity. It is reported that patients with SPARC-positive tumors or high expression of SPARC have higher response rates and longer overall survival after receiving treatment containing ABR. It is generally believed that the enhanced anti-tumor efficacy of ABR is due to the binding of albumin in ABR to SPARC in tumor tissue, thereby enhancing the targeted distribution of ABR in tumors.

[0004] Clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated protein 9 (Cas9) is a widely used gene editing tool. Through the selective targeting of any DNA sequence by single-stranded guide RNA (sgRNA), Cas9 protein can be guided to regulate gene expression accordingly. In order to reduce the mis-action of CRISPR / Cas9 on non-target cells and achieve more precise spatiotemporal control of cell life activities, a large number of studies have been conducted to develop new CRISPR / Cas9 systems that can recognize and respond to exogenous molecules or signal stimuli, in order to limit gene regulation to specific conditions or specific types of cells. For example, aptamer-responsive sgRNA can be constructed, and aptamers targeting different functional proteins or transcription factors can be integrated to achieve more specific gene editing; sgRNA activity function conversion can be achieved by using ligand-dependent ribozymes to perform irreversible RNA cleavage on sgRNA; or the function of Cas9 can be modified by enzyme activation. Summary of the invention

[0005] The embodiments of the present application provide a new SPARC protein gene regulatory element, a functionalized albumin nanoformulation and its application.

[0006] The present invention provides a SPARC protein gene regulatory element, the nucleotide sequence of the gene regulatory element is shown in SEQ ID NO:1.

[0007] The present invention provides an application of the SPARC protein gene regulatory element in preparing a reagent for promoting the expression of SPARC gene in cancer cells.

[0008] The present invention provides a functionalized albumin nano-preparation, which encapsulates a SPARC protein gene regulatory element and an mRNA encoding dCas9-VP64, wherein the sequence of the gene regulatory element is shown in SEQ ID NO: 1.

[0009] In some embodiments, the albumin is selected from one or more of human serum albumin, bovine serum albumin, recombinant human serum albumin, ovalbumin, egg albumin, serum albumin, lactalbumin, myoalbumin, wheat albumin and soy albumin; and / or, the albumin is a cationized albumin obtained by cation modification.

[0010] In some embodiments, the particle size range of the preparation is 100nm-2000nm.

[0011] In some embodiments, the preparation is obtained by reducing disulfide bonds within albumin molecules, reorganizing disulfide bonds between albumin molecules, and encapsulating the gene regulatory element and the mRNA element inside the nanoparticles by a desolvation method.

[0012] The present invention provides an application of the functionalized albumin nano preparation in preparing a reagent for promoting the expression of SPARC gene in cancer cells.

[0013] In some embodiments, the cancer cells are human bladder cancer 5637 cell line, SW780 cell line, T24 cell line, TCSSUP cell line and human breast cancer MCF-7 cell line.

[0014] The present invention provides an application of the functionalized albumin nanoformulation in the preparation of a drug for treating cancer. Application of the functionalized albumin nanoformulation in a drug for treating cancer. Cancers such as bladder cancer and breast cancer.

[0015] The present invention provides an anti-tumor drug, comprising an albumin nano drug carrier and a drug, wherein the albumin nano drug carrier comprises a SPARC protein gene regulatory element and mRNA encoding dCas9-VP64, the sequence of the gene regulatory element is shown in SEQ ID NO: 1, and the drug is Abraxane.

[0016] Beneficial effects: Through the SPARC protein gene regulatory element, tumor cells can be specifically identified and the SPARC protein content in the tumor microenvironment can be upregulated, thereby improving the delivery efficiency of albumin nanoparticles to tumor cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the structures shown in these drawings without paying creative work.

[0018] Figure 1 Flow cytometry is used to detect the uptake of albumin nanoparticles by bladder cancer cell lines by functionalized albumin nanoparticle preparations, wherein (A) refers to the 5637 bladder cancer cell line pretreated with different nanoparticles (negative control nanoparticles: NC-NPs; free SPARC protein: SPARC; albumin nanoparticles encapsulating SAPRC gene regulatory elements: SP-NPs) for 48 hours, after which the supernatant was discarded and the corresponding Cy3-labeled nanoparticles were added. The uptake of the nanoparticles was detected by flow cytometry, and the coordinate values ​​of the horizontal axis are 0, 10, and 11, respectively. 1 , 10 2 , 103 , 10 4 , 10 5 , 10 6 , 10 7 , the coordinate values ​​of the ordinates in the left figure are 0, 200, 400, respectively, the coordinate values ​​of the ordinates in the middle figure are 0, 100, 200, 300, respectively, and the coordinate values ​​of the ordinates in the right figure are 0, 50, 100, respectively; (B) refers to the quantitative analysis bar graph of the average fluorescence intensity of 5637 cells taking up Cy3-labeled fluorescent nanoparticles (n=4), **P<0.01, ***P<0.001;

[0019] Figure 2 This is a fluorescence distribution observation diagram of functionalized albumin nanoparticles promoting the penetration of albumin nanoparticles into bladder cancer organoids; blue represents the cell nucleus, and red represents Cy3-labeled fluorescent nanoparticles; negative control nanoparticles: NC-NPs; albumin nanoparticles encapsulating SPARC gene regulatory elements: SP-NPs;

[0020] Figure 3 This is an in vivo imaging analysis of the fluorescence distribution of functionalized albumin nanoparticles to improve the targeting and enrichment efficiency of albumin nanoparticles for bladder cancer in vivo. The distribution of fluorescent nanoparticles in subcutaneous 5637 tumors of nude mice was compared after three consecutive injections (once every two days) of Cy5-labeled negative control nanoparticles NC-NPs and albumin nanoparticles SP-NPs encapsulating SAPRC gene regulatory elements. The images were taken 4 hours after each injection. The red arrows indicate the tumor sites. (B) Quantitative analysis of the fluorescence intensity in the tumor after three consecutive injections of Cy5-labeled NC-NPs or SP-NPs (n=3), *P<0.05, ***P<0.001.

[0021] Figure 4 This is a comparison chart of how pretreatment of functionalized albumin nanoformulations improves the anti-tumor effect of Abraxane. The tumor volume growth curves of mice in different treatment groups (n=6) are as follows: PBS: phosphate buffer control group, corresponding to broken line A; ABR: Abraxane treatment group, corresponding to broken line B; NC-NPs+ABR: negative control nanoparticles+Abraxane treatment group, corresponding to broken line C; SP-NPs+ABR: albumin nanoparticles encapsulating SAPRC gene regulatory elements+Abraxane treatment group, corresponding to broken line D; ***P<0.001. DETAILED DESCRIPTION

[0022] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] Example 1: Flow cytometry was used to detect the effect of functionalized albumin nanoformulation on the uptake of albumin nanoparticles by bladder cancer cell lines.

[0024] 1.1. Prescription and preparation process

[0025] 1.1.1. Cationic modification of human serum albumin

[0026] First, prepare the ethylenediamine solution. Take 400μl of ethylenediamine, accurately weigh 356.7mg, add 2ml of ultrapure water, then add 1.325ml of concentrated HCl, and stir continuously to accelerate the heat dissipation of the solution. At this time, the pH is about 5.5. Continue to add concentrated HCl at 2μl per drop until the pH is adjusted to 4.75, and fill up with ultrapure water to a final volume of 4.24ml (i.e., a final concentration of 1.4M). Slowly add the ethylenediamine solution (1.4M, 2ml) deep into the bottom of the test tube to the human serum albumin aqueous solution (10%, 250μl), stir evenly, divide into 3 parts, add different masses of ethyl [3-(dimethylamino) propyl] carbodiimide (N-Ethyl-N'-(3-dimethylaminopropyl)-carbodiimide, EDAC) (0.5mg / 1.25mg / 2.5mg), stir at room temperature for 2h, and add acetate buffer (4M, pH4.75, 20μl) to terminate the reaction. The sample was placed in a 10 kDa dialysis bag and dialyzed for 24 hours with stirring, wherein new sterile water was replaced every 12 hours to remove free impurities.

[0027] The number of free amino groups contained in cationized albumin was determined by the trinitrobenzenesulfonic acid method. The protein sample (25 μl, adjusted to a concentration range of 10 μM-100 μM in 0.01 M PBS) was mixed with phosphate buffer (200 μl, 0.2125 M, pH 8.2), followed by the addition of TNBS solution (200 μl, 0.10%), and the reaction mixture was heated in a 50°C water bath for 60 min. The reaction was terminated by the addition of 0.1 M HCl (400 μl), followed by standing at room temperature for 30 min, and then the absorbance at 340 nm was measured. A standard curve was prepared using a gradient dilution of L-leucine solution with 1% NaDodSO4 (sodium dodecyl sulfate) as a standard. The number of free amino groups contained in a single cationized human serum albumin was determined by this method to be 79.1±2.3.

[0028] 1.1.2. Preparation of SPARC gene regulatory elements

[0029] Shenzhen BGI Co., Ltd. was commissioned to chemically synthesize a DNA fragment of the SPARC gene regulatory element sequence (see SEQ ID NO: 1 in the sequence list) and insert it into the pUC57 vector cut by EcoRV enzyme. Subsequently, the RNA transcription product of the SPARC gene regulatory element was obtained by in vitro transcription (37°C, 12h) from the linearized plasmid using the T7 RNA polymerase kit. To ensure that the RNA product correctly forms a spiral loop structure, the SPARC gene regulatory element was denatured and annealed in a PCR instrument according to the following procedures: denaturation at 95°C for 5 minutes, and then gradually cooled from 95°C to 25°C at a rate of -0.1°C / s. The RNA was aliquoted and frozen at -80°C for later use.

[0030] The sequence of the SPARC gene regulatory element is:

[0031] 5`-GGUAAUUCCUUGCAGUCUCCGUUUUAGAGCUAGAAAUAGC AAGUUAAAAUAAGGCUAGUCCGUUCGUACACCAUCAGGGUACGCUGCAAGGAAUUACCGAAGCUUACAAGAAGGACAGCACG AAUAAAACCUGCGUAAAUCCGCCCCAUUUGUGUAAGGGUAGUGGGUCGAAUUCCGCUCAGGUAAUUCCUUUUUU-3` (SEQ ID NO: 1).

[0032] 1.1.3. Preparation of dCas9-VP64 mRNA

[0033] The commercial plasmid pcDNA-dCas9-VP64 was linearized for use as a DNA template for in vitro transcription. In order to enhance the stability of the mRNA product, an RNA cap structure analog (also known as Anti-Reverse Cap Analog, ARCA) with 3′-O-Me-m7G(5')ppp(5')G was added during the transcription process, and the molar ratio of ARCA to GTP (guanosine triphosphate) was 4:1. The reaction mixture was incubated in a PCR instrument at 42°C for 2 hours. The reaction mixture was then purified and the polyadenylic acid tail was added using Escherichia coli polyadenylic acid polymerase according to the manufacturer's instructions. All RNA products were purified using MonarchRNA Cleanup Kits and quantified by measuring the absorbance at 260 and 280 nm, and stored in aliquots at -80°C for later use.

[0034] 1.1.4. Preparation of functionalized albumin nanoformulations

[0035] Cationized albumin (20 mg / ml) was first dissolved in nuclease-free water containing 50 mM GSH at 37 °C to break the intramolecular disulfide bonds. Subsequently, the solution was processed through a Sephadex G-25 column to remove excess GSH and possible oxidized GSH (GSSG), and the purified cationized albumin was freeze-dried. The freeze-dried cationized albumin was dissolved in phosphate buffer at pH 6.0 (5 mg / ml, 75.8 μM) and incubated with SPARC gene regulatory elements (0.92 μM) and dCas9-VP64 mRNA (184 μg / ml, 0.13 μM) for 5 min at room temperature under constant stirring (550 RPM). The formation of nanoparticles was promoted by desolvation by slowly adding a methanol / ethanol mixture (7:3, volume ratio) to the reaction solution dropwise (e.g., at a rate of 1 ml / min) while stirring continuously (550 RPM) at room temperature, with the volume ratio of the former to the latter being 2:1. Subsequently, the suspension was stirred for an additional 30 min to form intermolecular disulfide bonds, and then transferred to a dialysis bag with a 300,000 molecule cutoff and dialyzed with nuclease-free water at 4°C for 24 hours. The size distribution and potential of the functionalized albumin nanoformulation were measured by dynamic light scattering and phase analysis light scattering, with an average particle size of approximately 133.2 nm and a surface potential of -10.1 mV. Among them, the mRNA sequence encoding the dCas9-VP64 protein is shown in SEQ ID NO: 2.

[0036]

[0037] TCTTGACTTTTCGAATTCCTTATTATGTTGGTCCATTGGCGCGTG

[0038] GCAATAGTCGTTTTGCATGGATGACTCGGAAGTCTGAAGAAAC

[0039] AATTACCCCATGGAATTTTGAAGAAGTTGTCGATAAAGGTGCTT

[0040] CAGCTCAATCATTTATTGAACGCATGACAAACTTTGATAAAAAT

[0041] CTTCCAAATGAAAAAGTACTACCAAAACATAGTTTGCTTTATGA

[0042] GTATTTTACGGTTTATAACGAATTGACAAAGGTCAAATATGTTAC

[0043] TGAAGGAATGCGAAAACCAGCATTTCTTTCAGGTGAACAGAAG

[0044] AAAGCCATTGTTGATTTACTCTTCAAAACAAATCGAAAAGTAAC

[0045] CGTTAAGCAATTAAGAAGATTATTTCAAAAAATAGAATGTT

[0046] TTGATAGTGTTGAAATTTCAGGAGTTGAAGATAGATTTAATGCTT

[0047] CATTAGGTACCTACCATGATTTGCTAAAAATTATTAAAGATAAAG

[0048] ATTTTTGGATAATGAAGAAAATGAAGATATCTTAGAGGATATTG

[0049] TTTTAACATTGACCTTATTTGAAGATAGGGAGATGATTGAGGAA

[0050] AGACTTAAAACATATGCTCACCTCTTTGATGATAAGGTGATGAA

[0051] ACAGCTTAAACGTCGCCGTTATACTGGTTGGGGACGTTTGTCTC

[0052] GAAAATTGATTAATGGTATTAGGGATAAGCAATCTGGCAAAACA

[0053] ATATTAGATTTTTTGAAATCAGATGGTTTTGCCAATCGCAATTTTA

[0054] TGCAGCTGATCCATGATGATAGTTTGACATTTAAAGAAGACATT

[0055] CAAAAAGCACAAGTGTCTGGACAAGGCGATAGTTTACATGAAC

[0056] ATATTGCAAATTTAGCTGGTAGCCCTGCTATTAAAAAAGGTATTT

[0057] TACAGACTGTAAAAGTTGTTGATGAATTGGTCAAAGTAATGGGG

[0058] CGGCATAAGCCAGAAAATATCGTTATTGAAATGGCACGTGAAAA

[0059] TCAGACAACTCAAAAGGGCCAGAAAAATTCGCGAGAGCGTATG

[0060] AAACGAATCGAAGAAGGTATCAAAGAATTAGGAAGTCAGATTC

[0061] TTAAAGAGCATCCTGTTGAAAATACTCAATTGCAAAATGAAAAG

[0062] CTCTATCTCTATTATCTCCAAAATGGAAGAGACATGTATGTGGAC

[0063] CAAGAATTAGATATTAATCGTTTAAGTGATTATGATGTCGATGCC

[0064] ATTGTTCCACAAAGTTTCCTTAAAGACGATTCAATAGACAATAA

[0065] GGTCTTAACGCGTTCTGATAAAAATCGTGGTAAATCGGATAACG

[0066] TTCCAAGTGAAGAAGTAGTCAAAAAGATGAAAAACTATTGGAG

[0067] ACAACTTCTAAACGCCAAGTTAATCACTCAACGTAAGTTTGATA

[0068] ATTTAACGAAAGCTGAACGTGGAGGTTTGAGTGAACTTGATAA

[0069] AGCTGGTTTTATCAAACGCCAATTGGTTGAAACTCGCCAAATCA

[0070] CTAAGCATGTGGCACAAAATTTTGGATAGTCGCATGAATACTAAAT

[0071] ACGATGAAAATGATAAACTTATTCGAGAGGTTAAAGTGATTACC

[0072] TTAAAAATCTAAATTAGTTTCTGACTTCCGAAAAGATTTCCAATTC

[0073] TATAAAGTACGTGAGATTAACAATTACCATCATGCCCATGATGCG

[0074] TATCTAAATGCCGTCGTTGGAACTGCTTTGATTAAGAAATATCCA

[0075] AAACTTGAATCGGAGTTTGTCTATGGTGATTATAAAGTTTATGAT

[0076] GTTCGTAAATGATTGCTAAGTCTGAGCAAGAAAATAGGCAAAG

[0077] CAACCGCAAAATATTTCTTTTACTCTAATATCATGAACTTCTTCA

[0078] AACAGAAATTACACTTGCAAATGGAGAGATTCGCAAACGCCC

[0079] TCTAATCGAAACTAATGGGGAAACTGGAGAAATTGTCTGGGATA

[0080] AAGGCGAGATTTTGCCACAGTGCGCAAAGTATTGTCCATGCCC

[0081] CAAGTCAATATTGTCAAGAAAACAGAAGTACAGACAGGCGGAT

[0082] TCTCCAAGGAGTCAATTTTACCAAAAAGAAAATTCGGACAAGCT

[0083] TATTGCTCGTAAAAAAGACTGGGATCCAAAAATATGGTGGTT

[0084] TTGATAGTCCAACGGTAGCTTATTCAGTCCTAGTGGTTGCTAAG

[0085] GTGGAAAGGGGAAATCGAAGAAGTTAAAATCCGTTAAGAGT

[0086] TACTAGGGATCACAATTATGGAAAGAAGTTCCTTTGAAAAAAAT

[0087] CCGATTGACTTTTTAGAAGCTAAAGGATATAAGGAAGTTAAAAA

[0088] AGACTTAATCATTAAACTACCTAAATATAGTCTTTTTGAGTTAGA

[0089] AAACGGTTCGTAAACGGATGCTGGCTAGTGCCGGAGAATTACAA

[0090] AAAGGAATTGAGCTGGCTCTGCCAAGCAATATGTGAATTTTTT

[0091] ATATTTAGCTAGTCATTATGAAAAATTTGAAGGGTAGTCCAGAAG

[0092] ATAACGAACAAAACAATTGTTTGTGGAGCAGCATAAGCATTAT

[0093] TTAGATGAGATTATTGAGCAAATCAGTGAATTTTCTAAGCGTGTT

[0094] ATTTTAGCAGATGCCAATTTAGATAAAGTTCTTAGTGCATATAAC

[0095] AAACATAGAGACAAACCAATACGTGAACAAGCAGAAAATATTA

[0096] TTCATTTATTTACGTTGACGAATCTTGGAGCTCCCGCTGCTTTTA

[0097] AATATTTTGATACAACAATTGATCGTAAACGATATACGTCTACAA

[0098] AAAGAAGTTTTAGATGCCACTCTTATCCATCAATCCATCACTGGTC

[0099] TTTATGAAACACGCATTGATTTGAGTCAGCTAGGAGGTGACCCA

[0100] ATTGCCGGATCCAAGGCTAGCCCGAAAAAGAAACGCAAAGTTG

[0101] GGCGCGCCGACGCGCTGGACGATTTCGATCTCGACATGCTGGG

[0102] TTCTGATGCCCTCGATGACTTTGACCTGGATATGTTGGGAAGCG

[0103] ACGCATTGGATGACTTTGATCTGGACATGCTCGGCTCCGATGCTCTGGACGATTTCGATCTCGATATGTTA-3' (SEQ ID NO: 2).

[0104] 1.2. Comparative analysis of the effects of functionalized albumin nanoformulations on cellular uptake

[0105] 5637 cells were inoculated in 6-well culture plates and confocal dishes 12 hours before the start of the experiment (100,000 cells per well). In the process of preparing virus-mimetic nanoparticles, Cy3 fluorescently labeled SPARC gene regulatory elements were used to replace non-fluorescent sequences to obtain fluorescently labeled nanoparticles. Cells were first co-cultured with negative control nanoparticles NC-NPs or SPARC gene regulatory element-encapsulated nanoparticles SP-NPs at a concentration of 20nM SPARC gene regulatory elements for 6 hours, and then replaced with fresh growth medium and continued to be cultured for 42 hours. For NC-NPs+SPARC treatment, exogenous recombinant human SPARC (1μg / ml) was added 1 hour before the end of the culture. Subsequently, fluorescent NC-NPs or SP-NPs (50ng / ml albumin) were added to the culture medium and cultured for another 30min. After several washes with PBS preheated at 37°C and trypsin treatment, the cells were collected for flow cytometry analysis.

[0106] Results: Figure 1 As shown, compared with 5637 cells treated with NC-NPs, cells treated with SP-NPs had a higher efficiency in taking up nanoparticles, and the average fluorescence intensity representing the content of taken-up nanoparticles increased by 46%.

[0107] Example 2: Confocal fluorescence microscopy to observe the effect of functionalized albumin nanoformulations on promoting the penetration of albumin nanoparticles into bladder cancer organoids

[0108] The preparation method of functionalized albumin nanoformulation is the same as that in section “1.1. Prescription and preparation process”.

[0109] 2.1. Bladder cancer organoid culture

[0110] Freshly obtained tumor clinical samples (from the Department of Urology, Peking University First Hospital in August 2019) were minced, placed in Advanced DMEM / F-12 medium, and collagenase type II (5 mg / ml) was added for digestion at 37°C, 5% CO2 for 45 minutes. Subsequently, the remaining undigested cell aggregates were further digested (5 minutes) at 37°C using TrypLE Express recombinase (4 ml) and Y-27632 dihydrochloride (10 μM). After the tissue was thoroughly digested and disaggregated, the digestion reaction was terminated by adding culture medium containing 20% ​​FBS. The cell suspension was filtered through a 70 μm filter to remove large cell aggregates and centrifuged at 1,500 RPM for 5 minutes. The obtained cell pellet. Resuspend in 4°C pre-cooled Matrigel basement membrane matrix and inoculate in a preheated 6-well culture plate (60 μl / drop per well, 6-7 drops / well). After solidification for 1 min, the drop was inverted and incubated for another 20 min. Finally, organoid-specific culture medium (2 ml, see Table 1 for detailed formula) was added to each well, and the culture medium was replaced every 3 days.

[0111] Table 1 Composition of bladder cancer organoid-specific culture medium

[0112] Reagent components concentration Advanced DMEM / F-12 1× Antibiotic-Antimycotic 1× GlutaMAX 1× HEPES 1× B-27Supplement 1× N-acetylcysteine 1.25mM Nicotinamide 10mM SB202190 10μM A83-01 500nM Recombinant human R-spondin1 protein 500ng / ml Human noggin 100ng / ml Recombinant human FGF-10 20ng / ml Recombinant human FGF-2 5ng / ml Human EGF 50ng / ml

[0113] 2.2. Experimental study on the penetration of functionalized albumin nanoparticles into organoids

[0114] Bladder cancer organoids in the logarithmic growth phase were transferred to a round-bottom 96-well plate, and SP-NPs (containing 100nM SPARC gene regulatory elements) or an equal amount of NC-NPs were added, respectively, and placed in an incubator for further incubation at 37°C and 5% CO2 for 48h. The supernatant was removed, washed three times with PBS, and Cy3-labeled NC-NPs or SP-NPs (containing 50ng / ml albumin) were added, followed by incubation at 4°C for 10min. Finally, the plates were washed three times with 4°C precooled PBS and observed under an inverted fluorescence microscope.

[0115] Results: Figure 2 As shown in the figure, SP-NPs have a higher penetration efficiency into bladder cancer organoids, and the red fluorescent signal representing the nanoparticles is distributed throughout the organoids. In contrast, only a small amount of nanoparticles in the control group are distributed at the edge of the organoids, indicating that the penetration efficiency of the negative control nanoparticles into the organoids is much lower than that of the SP-NPs group.

[0116] Example 3: Observation of functionalized albumin nanoformulations using in vivo imaging technology to improve the targeting and enrichment efficiency of albumin nanoparticles for bladder cancer in vivo

[0117] The preparation method of functionalized albumin nanoformulation is the same as that in section “1.1. Prescription and preparation process”.

[0118] When the tumor volume of 5637 mice subcutaneously inoculated reached 100mm 3 The experiment was started at 14:00. Cy5-labeled SP-NPs or NC-NPs (1.7 mg albumin / mouse) were intravenously injected once every two days for a total of three injections. After the mice were anesthetized with isoflurane, near-infrared in vivo imaging of the mice was performed at predetermined time points.

[0119] Results: Figure 3 As shown, after the first injection, the fluorescence intensity at the tumor site was comparable between the two groups. However, after the second and third injections, the fluorescence intensity at the tumor site of the SP-NPs-treated mice increased significantly compared to the control mice, reaching 1.4 times the intensity of the control group after the third injection.

[0120] Example 4: Comparative analysis of the effect of functionalized albumin nanoparticles on improving the anti-tumor effect of Abraxane

[0121] The preparation method of functionalized albumin nanoformulation is the same as that in section “1.1. Prescription and preparation process”.

[0122] To evaluate the effect of functionalized albumin nanoformulation on the anticancer effect of Abraxane (ABR) in vivo, mice were randomly divided into 4 groups, each with 10 mice, namely phosphate buffered saline (PBS) group, ABR treatment group, NC-NPs+ABR treatment group and SP-NPs+ABR treatment group. The day of tumor inoculation was marked as Day 0, and 5×10 6 5637 cells. To facilitate 5637 tumor formation, a determined number of 5637 cell suspensions were added to a mixture (100 μl) of chilled PBS and Matrigel (volume ratio 5:1). When the tumor formed small masses visible to the naked eye on the 4th day, different nanoparticles were injected through the tail vein. The dose of each drug is as follows: albumin, 8.62 mg / kg; SPARC gene regulatory element, 0.1 mg / kg; dCas9-VP64 mRNA, 0.32 mg / kg. NC-NPs or SP-NPs were administered on Day 4 and Day 6, and ABR (40 mg / kg paclitaxel) was administered on Day 8. After injection, tumor size and body weight were measured. The tumor volume was measured using a digital caliper. The tumor volume was calculated as follows: the maximum length of the tumor was used as the length, and the maximum width perpendicular to the length of the tumor was used as the width, then the tumor volume (mm 3 )=0.5×length(mm)×width(mm) 2 . Observe every 3 days.

[0123] Results: Figure 4 As shown, the tumors of mice treated with ABR alone or NC-NPs+ABR only slightly shrank before day 11, and then grew steadily. In contrast, the tumors treated with SP-NPs+ABR continued to shrink, showing the best anti-tumor effect, indicating that pretreatment with functionalized albumin nanoformulations can effectively enhance the anti-tumor effect of ABR in vivo.

[0124] The present application embodiment provides a functionalized albumin nanoformulation, which encapsulates the SPARC gene regulatory element responsive to the NF-κB transcription factor highly expressed in tumor cells and the mRNA encoding dCas9-VP64, and uses a multiple administration strategy to specifically recognize tumor cells and upregulate the SPARC protein content in the tumor microenvironment, thereby improving the delivery efficiency of albumin nanoparticles to tumor cells. Albumin can be selected from human serum albumin (HSA), bovine serum albumin (BSA), recombinant human serum albumin, ovalbumin, ovalbumin, serum albumin, lactalbumin, myoalbumin, wheat albumin, and soy albumin. Albumin can be a cationized albumin obtained by cation modification. The method of cation modification of albumin can be to condense 1,2-ethylenediamine or 1,6-hexanediamine with the carboxyl group of the acidic amino acid residue of albumin to form a cationized albumin.

[0125] Functionalized albumin nanoformulations can be administered via non-invasive routes such as intravenous injection, intramuscular injection, subcutaneous injection, etc. Functionalized albumin nanoformulations can be dispersed in various pharmaceutically acceptable buffer solution environments, including physiological saline, Tris buffer, phosphate buffer and other buffer solution environments.

[0126] Functionalized albumin nanoparticles are obtained by reducing the intramolecular disulfide bonds of albumin molecules, reorganizing the intermolecular disulfide bonds of albumin molecules, and encapsulating the SPARC gene regulatory elements and dCas9-VP64 mRNA in the nanoparticles by desolvation. Generally, the mass ratio of the three components can be albumin (1-100): SPARC gene regulatory elements (0.01-10): dCas9-VP64 mRNA (0.01-1). The applicant has concluded through multiple experiments that the preferred ratio is 8.62: 0.1: 0.32. At this ratio, the albumin nanoparticle has the best effect of upregulating SPARC. The particle size range of the functionalized albumin nanoparticle is 100nm-2000nm, and the preferred range is 100nm-250nm.

[0127] Although a single dose of albumin nanoparticles generally only modestly upregulated SPARC gene expression, multiple consecutive doses created a positive feedback loop that resulted in progressively more induction of SPARC gene expression, nanoparticle uptake by tumor cells, and tumor penetration in vitro, in organoids, and in subcutaneous tumors in vivo. Furthermore, pretreatment with albumin nanoparticle formulations significantly enhanced the antitumor efficacy of Abraxane, a commercial albumin-bound paclitaxel nanoformulation. Experimental data suggest that modulation of SPARC expression in the tumor microenvironment could improve the efficiency of albumin-based drug delivery to solid tumors, thereby enhancing the efficacy of cancer drugs based on the albumin nanoparticles.

[0128] The present application embodiment provides a regulatory element sequence for the SPARC gene, which has the tumor-specific regulatory function of initiating the upregulation of SPARC content under the premise of recognizing and binding to the nuclear transcription factor NF-κB, and its RNA sequence is shown in the sequence table SEQ ID NO: 1. The present application embodiment provides an mRNA element encoding dCas9-VP64 protein, and its sequence is shown in SEQ ID NO: 2.

[0129] The above description is only a preferred embodiment of the present invention, and does not limit the patent scope of the present invention. All equivalent structural changes made by using the contents of the present invention specification and drawings under the concept of the present invention, or directly / indirectly applied in other related technical fields are included in the patent protection scope of the present invention.

Claims

1. A SPARC protein gene regulatory element, characterized in that: The nucleotide sequence of the gene regulatory element is shown in SEQ ID NO:

1.

2. Use of the SPARC protein gene regulatory element according to claim 1 in the preparation of an agent for promoting SPARC gene expression in cancer cells.

3. A functionalized albumin nanoformulation, characterized in that: The SPARC protein gene regulatory element and mRNA encoding dCas9-VP64 are packaged, the sequence of the gene regulatory element is shown in SEQ ID NO: 1, and the albumin is a cationized albumin obtained by cation modification.

4. The preparation according to claim 3, characterized in that The albumin is selected from any one of human serum albumin, bovine serum albumin, ovalbumin, serum albumin, lactalbumin, myoalbumin, wheat albumin and bean albumin.

5. The preparation according to claim 3, characterized in that The particle size range of the preparation is 100 nm-2000 nm.

6. The preparation according to claim 3, characterized in that The preparation is obtained by reducing the disulfide bonds within albumin molecules, reorganizing the disulfide bonds between albumin molecules, and encapsulating the gene regulatory element and the mRNA element inside the nanoparticles through a desolvation method.

7. Use of the functionalized albumin nanoformulation according to any one of claims 3 to 6 in the preparation of an agent for promoting the expression of SPARC gene in cancer cells, wherein the cancer cells are human bladder cancer 5637 cell lines.

8. Use of the functionalized albumin nanoformulation according to any one of claims 3 to 6 in the preparation of a drug for treating bladder cancer.

9. An anti-tumor drug, characterized in that: It comprises an albumin nano drug carrier and a drug, wherein the albumin nano drug carrier comprises a SPARC protein gene regulatory element and mRNA encoding dCas9-VP64, the sequence of the gene regulatory element is shown in SEQ ID NO: 1, the drug is Abraxane, and the tumor is a bladder tumor.

Images