A tumor treatment and efficacy prediction target and its application

Abstract

The present invention discloses a target for tumor treatment and efficacy prediction and its application. The target for tumor treatment and efficacy prediction is MDA5, and also provides the application of MDA5 as a target in treating tumors and as a marker for predicting patient prognosis. The invention proves that MDA5 is an important immunomodulatory factor for colorectal cancer, liver cancer cells, etc. In subcutaneous tumor models of colorectal cancer and liver cancer cell lines in mice, knocking out MDA5 can block and inhibit the occurrence and progression of colorectal cancer and liver cancer, and significantly prolong the survival of tumor-bearing mice. At the same time, targeting MDA5 and combining it with chemotherapy or immune checkpoint inhibitors can more effectively treat and eliminate tumors. MDA5 can be used as a biomarker for poor clinical prognosis of various tumors and can be used to predict patient survival. It provides new ideas for clinical tumor treatment and efficacy prediction, and is expected to provide patients with more acceptable and clinically feasible diagnostic and treatment plans.

Description

Technical Field

[0001] The present invention relates to the technical field of cancer treatment, and in particular to a tumor treatment and efficacy prediction target and application thereof. Background Art

[0002] Cancer is a large group of diseases that can develop in almost any organ or tissue in the body when abnormal cells grow uncontrollably, expand beyond their usual boundaries, invade neighboring parts of the body, and / or spread to other organs. This latter process, known as metastasis, is the leading cause of cancer death. Tumor and malignancy are other common names for cancer. Lung, prostate, colorectal, stomach, and liver cancers are the most common types of cancer in men, while breast, colorectal, lung, cervical, and thyroid cancers are the most common types of cancer in women. The burden of cancer continues to grow worldwide, placing enormous physical, emotional, and financial strains on individuals, families, communities, and health systems. Although our understanding of the mechanisms of cancer has improved over the past few decades, effective treatments for cancer remain lacking. Therefore, the discovery of new and more effective targeted therapies is a key strategy in treating cancer.

[0003] Melanoma differentiation-associated protein 5 (MDA5), encoded by the IFIH1 gene, is one of the most widely studied RNA signaling sensors. MDA5 comprises 1,025 amino acids and is primarily composed of three domains: two tandem caspase activation and recruitment domains (2CARDs) at the N-terminus, a DExD / Hbox RNA helicase domain, and a C-terminal domain (CTD). The 2CARD, located at positions 1-207, is also known as the effector domain. It initiates downstream signaling by cognate binding to the MAVS CARD, a critical first step. The central DExD / H helicase domain, located at positions 298-833, belongs to the DExD / H family of RNA helicases and is composed of Hel1, Hel2i, and Hel2. The DExD / H helicase domain, also known as the regulatory domain, hydrolyzes ATP and binds and unwinds RNA. Both the DExD / H helicase domain and the CTD function to sense or recognize invading viral RNA. RNA recognition plays a crucial role in innate immune activation within human cells. It senses the presence of non-self RNA (such as viral RNA) and activates downstream signaling pathways, ultimately stimulating interferon (IFN) expression. IFNs can then trigger the expression of interferon-stimulating genes (ISGs), many of which inhibit exogenous pathogens. MDA5 is not only an initiator of IFN production but also an effector of IFN activation (i.e., IFNs can also promote MDA5 expression). This suggests that, in addition to RNA sensing, MDA5 may have certain post-activation functions in innate immunity. Therefore, it is not surprising that abnormal MDA5 function could lead to innate immune imbalance. MDA5 mutations are currently associated with an autoimmune disease called Aicardi-Goutières syndrome (AGS). Genetic analysis of AGS has revealed that several gain-of-function mutations in MDA5 lead to a spectrum of neuroinflammatory phenotypes characteristic of type I IFN production. These mutations overstabilize the filamentous structure formed by MDA5 and dsRNA in vitro (by impairing ATP hydrolysis or increasing dsRNA affinity), allowing MDA5 to increase its basal signaling activity in the absence of viral infection. This suggests that endogenous dsRNA stimulates these mutants to activate the innate immune system.

[0004] The key to cancer treatment is to increase the infiltration of immune cells within the tumor. For example, chemotherapy and radiotherapy, which are commonly used today, can directly damage the DNA of tumor cells while directly killing them. This allows the tumor cells to produce new immunogenicity, increasing the immune system's recognition and clearance of the tumor. The role of MDA5 in the development and progression of tumors is currently unclear. Based on existing reports on the function of MDA5, knocking out MDA5 in tumor cells should reduce the level of innate immunity, thereby promoting tumor growth. However, it was found that tumor cells with MDA5 knockout showed worse growth, indicating that MDA5 plays an important role in the tumor microenvironment. This discovery is expected to provide new therapeutic ideas and solutions for the treatment of tumors.

[0005] In view of this, we conducted in-depth research on the above issues, which led to the emergence of this case. Summary of the Invention

[0006] The purpose of the present invention is to provide a tumor treatment and efficacy prediction target and its application to solve the problems raised in the above background technology.

[0007] To achieve the above-mentioned purpose, the present invention provides the following technical solutions: a target for tumor treatment and efficacy prediction and its application, wherein the target for tumor treatment and efficacy prediction is MDA5.

[0008] The present invention also provides the application of MDA5 as a target in treating tumors and as a marker for predicting patient prognosis.

[0009] Furthermore, the application is the use of an agent for inhibiting the expression or activity of MDA5 in the preparation of a drug for treating tumors, specifically for the preparation of a drug or composition for treating cancer.

[0010] Preferably, the drug or composition is an MDA5 inhibitor, which refers to a substance that can reduce the activity of MDA5, including: a polypeptide that binds to MDA5, a chemical small molecule that binds to MDA5, an MDA5-modified polypeptide, a modified enzyme, or a combination thereof.

[0011] Preferably, the drug or composition is an inhibitor of MDA5 expression, and the inhibitor of MDA5 expression refers to an MDA5-specific genome editing or mRNA molecule inhibitor or a combination thereof, including but not limited to CRISPR / Cas protein-mediated gene knockout (CRISPR / Cas9 and CRISPR / CasRX, etc.), siRNA molecular interference, and shRNA molecular interference.

[0012] Preferably, the drug or composition is a combination of an MDA5 inhibitor or an MDA5 expression inhibitor and a small molecule or polypeptide drug, wherein the small molecule drug includes but is not limited to:

[0013] a. Chemotherapeutic drugs used to treat and prevent tumors, including but not limited to:

[0014] i. Alkylating agents, such as cyclophosphamide, nimustine, etc.;

[0015] ii. Antimetabolites, such as methotrexate, fluorouracil, capecitabine, gemcitabine, pemetrexed, S-1, fludarabine, etc.;

[0016] iii. Antibiotics, such as doxorubicin, bleomycin, etc.;

[0017] iv. Herbal drugs, such as vinorelbine, paclitaxel, docetaxel, irinotecan, etc.; hormones, such as tamoxifen, letrozole, exemestane, fulvestrant, goserelin, medroxyprogesterone, etc.;

[0018] v. Platinum drugs, such as cisplatin, carboplatin, oxaliplatin, nedaplatin, oxaliplatin, etc.;

[0019] b. Targeted drugs, such as gefitinib, cetuximab, nimotuzumab, nimatinib, everolimus, decitabine, bevacizumab, sorafenib, axitinib, etc.

[0020] Preferably, the drug or composition is an MDA5 inhibitor or a combination of an MDA5 expression inhibitor and an immune checkpoint antibody, wherein the immune checkpoint inhibitor includes but is not limited to PD1 monoclonal antibody, PDL1 monoclonal antibody, CTLA4 monoclonal antibody, LAG3 monoclonal antibody, TIGIT monoclonal antibody, etc.

[0021] Furthermore, the tumor includes any one of colorectal cancer, liver cancer, lung cancer, prostate cancer, breast cancer, esophageal cancer, pancreatic cancer, gastric cancer, thyroid cancer, thymic cancer, brain cancer, endometrial cancer, sarcoma and melanoma.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] 1. This study demonstrates for the first time that MDA5 is a key immunomodulatory factor for colorectal and liver cancer cells. In subcutaneous mouse models of colorectal and liver cancer cell lines, knockout of MDA5 blocked and inhibited the development and progression of these cancers and significantly prolonged the survival of tumor-bearing mice. This confirms that MDA5 is an effective target for the treatment and prevention of colorectal and other cancers, providing new insights into the diagnosis and treatment of these cancers.

[0024] 2. Discover and identify that targeting MDA5 in combination with chemotherapy (fluorouracil, oxaliplatin, etc.) or immune checkpoint inhibitors (such as Anti-PD1, Anti-PDL1, Anti-CTLA4, etc.) can more effectively treat and regress tumors. By using reagents that inhibit MDA5 expression or activity in the preparation of tumor therapeutics, it is hoped that more acceptable and clinically feasible diagnostic and treatment options will be provided to patients.

[0025] 3. MDA5 was discovered and identified as a biomarker for poor clinical prognosis in colorectal cancer, lung adenocarcinoma, low-grade glioma of the brain, pancreatic cancer (PAAD), etc., and can be used to predict patient survival. The biomarker proposed in this invention has high accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 , is a schematic diagram showing that MDA5 knockout can significantly inhibit the growth of a mouse subcutaneous tumor model in an embodiment of the present invention, wherein a, d, and g. Western blot was used to verify the knockout of MDA5 in Mc38, Ct26, and Hepa1-6 cell lines. b, e, and h. CCK8 was used in vitro to detect the proliferation of cells after MDA5 knockout. c, f, and i. Subcutaneous tumor models were constructed using C57BL / 6, BALB / c, and C57BL / 6 mice, respectively, to evaluate the subcutaneous tumor formation of MDA5-knockout cell lines.

[0027] Figure 2 , is a schematic diagram showing that MDA5 knockout does not affect the growth of a subcutaneous tumor model in immunodeficient mice in an embodiment of the present invention, wherein a, b, and c represent the subcutaneous tumor formation of Mc38, Ct26, and Hepa1-6 MDA5 knockout cell lines in BALB / c-Nude mice, respectively;

[0028] Figure 3 , is a schematic diagram of the verification that Cd8+ T cells are key effector cells mediating the clearance of MDA5 knockout cell lines in the embodiments of the present invention, wherein a and b respectively represent the subcutaneous tumor formation of Mc38 and Ct26 MDA5 knockout cell lines in immune-competent C57BL / 6 and BALB / c mice after the Cd8+ T lymphocytes in the mice were knocked out using antibodies against Cd8a;

[0029] Figure 4, is a schematic diagram of the verification that MDA5 knockout combined with chemotherapy or immunosuppressant treatment can achieve better therapeutic effects in the embodiments of the present invention, wherein a. The expression level of MDA5 was knocked down in the Mc38 cell line using the shRNA method, and the knockdown effect was verified using qPCR. b. The tumor growth of the subcutaneous tumor model of C57BL / 6 mice with Mc38 control cell line and MDA5 knockdown cell line after chemotherapy, Anti-PDL1 treatment, or chemotherapy combined with Anti-PDL1 treatment. c. The response of the chemotherapy group, Anti-PDL1 treatment group, and chemotherapy combined with Anti-PDL1 treatment group in the control group and MDA5 knockout group was statistically analyzed according to the final tumor volume less than 600mm3 as the treatment response. d, e: Anti-PDL1 was used to treat subcutaneous tumors of MDA5 knockout and control groups in the Ct26 cell line, and the tumor volume at different time points;

[0030] Figure 5 , , are schematic diagrams showing disease-specific survival outcomes for patients with high and low MDA5 expression levels in different cancers according to the present invention. a. MDA5 mRNA expression levels and survival outcomes in lung adenocarcinoma (LUAD), lower-grade glioma (LGG), thymoma (THYM), colorectal cancer (COADREAD), uterine endometrioid carcinoma (UCEC), pancreatic cancer (PAAD), and renal papillary renal cell carcinoma (KIRP). b. Comparison of survival between patients with MDA5 deletion mutations and those without MDA5 deletions.

[0031] Figure 6 , represents the reagent of the present invention;

[0032] Figure 7 , is a schematic representation of the consumables of the instrument and equipment of the present invention;

[0033] Figure 8 , is a schematic diagram of the enzymatic digestion system prepared in the present invention;

[0034] Figure 9 , is a schematic diagram of the preparation method of the separation gel and the stacking gel of the present invention;

[0035] Figure 10 , is a schematic diagram of the reaction system and reaction conditions for preparing and synthesizing cDNA of the present invention;

[0036] Figure 11 , is a schematic diagram of the real-time quantitative polymerase chain reaction reaction system and reaction conditions of the present invention. Implementation Method

[0037] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0038] See also Figure 1-11 The present invention provides the following technical solutions, and the materials and methods used in the examples are as follows:

[0039] 1. Reagents and consumables

[0040] The reagents and consumables and instrument consumables tables are as follows Figure 6-7 As shown;

[0041] DMEM complete medium: Add 50 ml FBS and 5 ml 100x double-antibody to every 500 ml DMEM medium and mix well.

[0042] RPMI-1640 complete medium: Add 50 ml of FBS and 5 ml of 100x double-antibody to every 500 ml of RPMI-1640 medium and mix well.

[0043] Puromycin: Prepare a 10 mg / mL stock solution in deionized water and store at -20°C. Add a volume of puromycin to the desired working concentration into eukaryotic cell culture medium and mix thoroughly before use.

[0044] 2. Mouse

[0045] The BALB / c, C57BL / 6, and BALB / c-Nude mice used in this example were purchased from Gempharmatech-GD. All mice were housed in an SPF environment, and all experimental procedures were approved by the Ethics Committee of the Sixth Affiliated Hospital of Sun Yat-sen University.

[0046] 3. Cell culture methods:

[0047] Mc38 and HEK293T cells used in the experiments were cultured in complete DMEM medium. Ct26 and Hepa1-6 cells were cultured in complete RPMI-1640 medium. Unless otherwise specified, all cell cultures were maintained at 37°C and 5% CO2.

[0048] 4. Construction of MDA5 knockout cell lines

[0049] a. Plasmid construction based on CRISPR / Cas9 knockout strategy

[0050] i. Enzyme digestion of Lenti-CRISPR-Puro plasmid

[0051] Follow the steps below Figure 8 Prepare the enzyme digestion system in the amount of 100 μg / mL.

[0052] Mix the above system on a vortex shaker and centrifuge. Then, perform the enzyme digestion reaction on a PCR instrument. The PCR instrument settings are: 55°C for 2 hours, 85°C for 20 minutes, and 4°C for 5 minutes. After the digestion is completed, the digestion product is recovered.

[0053] ii. Plasmid gel recovery after enzyme digestion

[0054] This experiment was performed according to the instructions of the Promega gel recovery kit. The gel box and electrophoresis tank used to prepare the gel should be cleaned in advance, and the gel used in the gel recovery process should be freshly prepared and used immediately.

[0055] (1) Prepare 1.5% agarose gel;

[0056] (2) Add the DNA sample to be recovered to the loading buffer and then add it to the agarose gel loading well for horizontal electrophoresis;

[0057] (3) After electrophoresis, cut the gel containing the target band under the development of gel imaging instrument, place it in a pre-weighed 1.5mL Eppendorf tube, and weigh it again;

[0058] (4) Add the corresponding volume of MBS solution according to the weight of the gel, place it on a 55°C heating block, and heat it for 7 minutes to dissolve the gel. Vortex mix it approximately every 2 minutes during the dissolution process until the gel is completely dissolved.

[0059] (5) The completely dissolved mixed liquid is aspirated and added to the recovery column;

[0060] (6) Centrifuge at 10,000 g for 1 min and discard the waste liquid in the collection tube;

[0061] (7) Add 500 μl of MWS solution, centrifuge at 10,000 g for 1 min, and discard the waste liquid in the collection tube;

[0062] (8) Add 700 μl of MWS solution to the recovery column, centrifuge at 10,000 g for 1 min, and discard the waste liquid in the collection tube; repeat the above operation once;

[0063] (9) Centrifuge the empty tube at 13,000 g for 2 min, discard the collection tube, and place the recovery column in a new 1.5 mL Eppendorf tube.

[0064] (10) Add 50 μl of sterilized water to the center membrane of the recovery column and let it stand at 56°C for 2 minutes;

[0065] (11) Centrifuge the recovery column and Eppendorf tube at 12000g for 1 min to recover the target DNA;

[0066] (12) Verify the gel recovery effect of the target DNA using 1% agarose gel electrophoresis.

[0067] iii. Plasmid ligation

[0068] The gene knockout sequences used in this example are as follows:

[0069] Mice-sgMDA5#1:

[0070] Forward sequence caccgTGGGCCACTTCCATTTGGTA

[0071] Backward sequence aaacTACCAAATGGAAGTGGCCCAc

[0072] Mice-sgMDA5#2

[0073] Forward sequence caccgGGTTATCGTTCTTGTCAATA

[0074] Backward sequence aaacTATTGACAAGAACGATAACCc

[0075] Mice-sgMDA5#3

[0076] Forward sequence caccgCGTAGACGACATATTACCAG

[0077] Backward sequence aaacCTGGTAATATGTCGTCTACGc

[0078] Mice-sgMDA5#4:

[0079] Forward sequence caccgACATAACAGCAACATGGGCA

[0080] Backward sequence aaacTGCCCATGTTGCTGTTATGTc

[0081] The knockout sequence designed above was synthesized at Sangon Biotechnology with a forward sequence and a reverse complement. The synthesized sequences were then mixed in equal volumes at a 50 μM concentration to produce a 25 μM mixed forward and reverse oligos. A 1.5 ml centrifuge tube containing the oligos was placed in boiling water and slowly cooled to obtain the annealed, double-stranded DNA fragment to be inserted.

[0082] The specific steps for plasmid ligation are as follows:

[0083] (1) Use T4 rapid ligase to add the digested and purified DNA fragment and vector into the ligation system at a molar ratio of 3:1, and carry out the ligation reaction at room temperature for 2 hours.

[0084] (2) Add the ligation product to Stbl3 competent cells, place on ice for 30 minutes, heat shock on a 42°C heating block for 60 seconds, then place the competent cells on ice for 2 minutes, add 500ul of resistance-free LB medium, and culture at 37°C, 190rpm, and shake for 1 hour.

[0085] (3) Take out the transformed bacterial solution, centrifuge at 3000 rpm for 3 min at room temperature, discard most of the supernatant, leaving only 100 μl, and resuspend the competent cells;

[0086] (4) Use a disposable coating rod to evenly spread the bacterial solution on a solid culture plate with resistance;

[0087] (5) Incubate the cells upside down at 37°C overnight. Observe the growth of the plaques the next day and select 4-6 clones to inoculate into 5 mL of LB medium containing resistance for expansion.

[0088] (6) On the third day, the amplified bacteria were collected and plasmids were extracted using a plasmid miniprep kit. After the plasmids were purified, their concentrations were measured and identified by enzyme digestion. The plasmids were then verified by 1% agarose gel electrophoresis. Successful plasmids were sequenced. Successful plasmids were selected by comparing the sequencing results.

[0089] b. shRNA-based MDA5 gene knockout strategy

[0090] This knockout protocol is similar to the plasmid construction protocol for CRISPR / Cas9-based knockout protocols. Both steps involve enzymatic digestion of the cloned plasmid and ligation of the targeting sequence. In this protocol, the knockout plasmid used is plko.1. This plasmid is digested with EcoRI and AgeI, and the product is recovered. The knockout sequences used in this protocol are as follows:

[0091] Mice-shMDA5#1

[0092] Forward sequence CCGGCCACAGAATCAGACACAAGTTCTCGAGAACTTGTGTCTGATTCTGTGGTTTTTG

[0093] Backward sequence aattcaaaaaCCACAGAATCAGACACAAGTTCTCGAGAACTTGTGTCTGATTCTGTGG

[0094] Mice-shMDA5#2

[0095] Forward sequence CCGGCCCATGAGGTATTGTCCTAAACTCGAGTTTAGGACAATACCTCATGGGTTTTTG

[0096] Backward sequence aattcaaaaaCCCATGAGGTATTGTCCTAAACTCGAGTTTAGGACAATACCTCATGGG

[0097] Mice-shMDA5#3

[0098] Forward sequence CCGGGCAAAGCAATACAACGACAATCTCGAGATTGTCGTTGTATTGCTTTGCTTTTTG

[0099] Backward sequence aattcaaaaaGCAAAGCAATACAACGACAATCTCGAGATTGTCGTTGTATTGCTTTGC

[0100] Mice-shMDA5#4

[0101] Forward sequence CCGGCCTACAAATCAACGACACGATCTCGAGATCGTGTCGTTGATTTGTAGGTTTTTG

[0102] Backward sequence aattcaaaaaCCTACAAATCAACGACACGATCTCGAGATCGTGTCGTTGATTTGTAGG

[0103] c. Lentivirus packaging

[0104] The specific steps are as follows:

[0105] (1) 5% poly-lysine was used to coat a 6-well plate 30 min in advance, and then the poly-lysine was removed and HEK293T cells were plated at a density of 7.5×10 5 The amount of cells was plated.

[0106] (2) After 24 hours, the constructed Lenti-CRISPR-MDA5KO plasmid, pSpAX2 and pMD2.G plasmids were mixed in a ratio of 2ug, 2ug and 1ug, and vortexed using 250ul of optimMEM.

[0107] (3) Prepare a new 1.5ml centrifuge tube, add 250ul of optimMEM, then add 8ul of lipo2000, use a 200ul pipette tip to mix thoroughly, and let it stand at room temperature for 3 minutes. Then add the plasmid prepared in step (2) to the lipo2000, mix evenly, and let it stand at room temperature for 20 minutes.

[0108] (4) During the waiting time, replace HEK293T with optimEME medium. After 20 minutes, add the mixed transfection plasmid dropwise into HEK293T, shake gently to mix evenly, and place in the incubator for 6 hours.

[0109] (5) After 6 h, the HEK293T cells were replaced with DMEM medium containing 10% FBS and cultured.

[0110] (6) Collect HEK293T culture medium 48h and 72h after transfection, filter it with a 0.45um filter, and freeze the supernatant in a -80℃ refrigerator.

[0111] d. Infection of target cells and screening

[0112] The specific steps are as follows:

[0113] (1) Mc38, Ct26, Hepa1-6 and other cells were cultured at a rate of 1×10 5 The cells were plated in 12-well plates at a certain density.

[0114] (2) After the cells have adhered for 12 hours, the virus solution and complete culture medium are mixed in a 1:1 ratio and added to the cell culture wells for infection. The concentration of the infection aid Polybrene is 8ug / ml.

[0115] (3) 48 hours after cell infection, cells were removed from the 12-well plate and inoculated into new 6 cm culture dishes. After the cells adhered for 8 hours, they were screened with puromycin. After all cells in the uninfected group died, puromycin screening was continued for 7 days.

[0116] 5. Western Blot verification of MDA5 knockout effect

[0117] a. Preparation of vertical electrophoresis gel:

[0118] Select the appropriate concentration according to the situation of your sample separation, and first prepare the SDS-PAGE separation gel. Add the mixed separation gel solution to the clamped gel plate and isolate it from the air with isopropyl alcohol. After the separation gel solidifies, discard the isopropyl alcohol on the upper layer and prepare the concentrated gel. Add the mixed concentrated gel to the gel plate and quickly insert the matching sample comb. After about 20 minutes, the SDS-PAGE gel can be solidified. The preparation method of separation gel and concentrated gel is as follows: Figure 9 As shown:

[0119] b. Preparation of protein samples:

[0120] (1) Collect the cell suspension into a 1.5 mL EP tube, centrifuge at 1000 rpm for 5 min, and discard the supernatant;

[0121] (2) Wash twice with 1× PBS (containing 137mM NaCl, 2.7mM KCl, 10mM Na2HPO4, 2mM KH2PO4, pH 7.4), and suspend in 80ul RIPA lysis buffer. Lyse on ice for 2h, then centrifuge at 4°C for 15min, collect the supernatant, and quantify the protein concentration of the sample using a protein quantification kit. Take 20ug of protein sample, add 5x loading buffer, mix well, and heat at 99°C for 10min;

[0122] (3) The heated sample was vortexed and centrifuged at room temperature and 12000g for 1 min;

[0123] (4) The prepared samples are directly added to the gel electrophoresis channel. If they need to be stored for a short period of time, they can be stored in a 4°C refrigerator. For long-term storage, they can be stored in a -20°C refrigerator.

[0124] 6. RNA Extraction

[0125] Promega's Eastep® Super Total RNA Extraction Kit was used for RNA extraction from cells. The specific steps were performed strictly according to the company's instructions. The following example illustrates the specific experimental steps using a 12-well plate as an example:

[0126] (1) Add RNA lysis buffer to the treated sample and invert the centrifuge tube 3-4 times to mix thoroughly.

[0127] (2) Add diluent and mix well with a pipette.

[0128] (3) After mixing, centrifuge the cells at 12,000-14,000 g for 5 minutes.

[0129] (4) Add 0.5 times the volume of anhydrous ethanol to the cell supernatant after centrifugation, and pipette quickly 20-25 times to make the liquid light blue and turbid with white foam.

[0130] (5) Transfer the mixture to a centrifuge column, centrifuge at 12000-14000g for 1 minute, and discard the filtrate.

[0131] (6) Add 600ul RNA washing solution for washing, centrifuge at 12000-14000g for 45 seconds, and discard the filtrate.

[0132] (7) Add 50 μl of DNase I incubation solution and incubate for 15 minutes. Then add 600 μl of RNA wash solution, centrifuge at 12,000-14,000 g for 45 seconds, and discard the filtrate.

[0133] (8) Add 600 μl of washing solution and centrifuge at 12,000-14,000 g for 45 seconds. Discard the filtrate. Replace the centrifuge column in the collection tube and centrifuge at 12,000-14,000 g for 2 minutes.

[0134] (9) Place the centrifuge column on the elution tube, add 50-200 μl of nuclease-free water, centrifuge at 12,000-14,000 g for 1 minute, and store the collected RNA at -70°C.

[0135] 7. Preparation of cDNA

[0136] cDNA synthesis (i.e., reverse transcription of RNA) was performed using the high-capacity cDNA reverse transcription kit KIT produced by Invitrogen. The specific procedures of the experiment were carried out strictly according to the instructions provided by the company. The synthesized cDNA was used for the next experiment or frozen at -20°C for future use. The specific synthesis reaction system and reaction conditions of the experiment are as follows: Figure 10 As shown;

[0137] 8. Real-time quantitative polymerase chain reaction (qRT-PCR)

[0138] Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using KAPA SYBRFAST Universal. The specific procedures of the experiment were strictly in accordance with the instructions provided by the company. Figure 11 As shown;

[0139] The primer sequences used are as follows:

[0140] Mice-MDA5

[0141] Upstream primer TGCGGAAGTTGGAGTCAAAGCG

[0142] Downstream primer CACCGTCGTAGCGATAAGCAGA

[0143] ACTB

[0144] Upstream primer CATTGCTGACAGGATGCAGAAGG

[0145] Downstream primer TGCTGGAAGGTGGACAGTGAGG

[0146] 9. CCK8 assay to determine cell proliferation rate

[0147] (1) Add 5000 cells to each well of a 96-well plate (leave two blank groups without cells and add the same volume of culture medium). Incubate the cells in a 5% CO2 cell culture incubator at 37°C for 24 h.

[0148] (2) After the cells have adhered for 6 hours, add 10 μl of CCK-8 solution to the wells in the first column and incubate at 37°C in a 5% CO2 incubator for 1 hour.

[0149] (3) Measure the absorbance at 450 nm using an enzyme-labeled instrument.

[0150] (4) Then, on different days, add 10 μl of CCK-8 solution to different wells. Incubate in a 37°C, 5% CO2 incubator for 1 hour. Measure the absorbance at 450 nm to obtain the cell growth status on different days.

[0151] 10. Tumor cell subcutaneous tumor model and CD8+ T cell clearance in immunocompetent mice

[0152] Mice aged 6-8 weeks were selected and randomly divided into groups according to their body weight. Then, the MDA5 knockout cell lines of Mc38, Ct26, and Hepa1-6 and the corresponding control cell lines were cultured at a rate of 2×10 6 The number of cells was subcutaneously injected into the left and right sides of mice (Mc38 and Hepa1-6 cells were C57BL / 6 mice, and Ct26 was BALB / c mice). For the in vivo knockout experiment of Cd8+T cells, the mice were randomly divided into groups according to their weight. The mice in the Cd8+T cell knockout group were intraperitoneally injected with 100ug of Anti-Cd8a antibody (Bio Xcell InVivo Mab anti-mouse CD8α) one day before tumor inoculation, and then administered once every 3 days. Flow cytometry was then used to analyze and detect the knockout of Cd8+T cells in mice on the 3rd and 12th day after tumor inoculation. For the treatment experiment with chemotherapy drugs, cells of the knockout group and the control group were inoculated subcutaneously into mice, respectively. When the tumor grew to about 150mm 3The tumor-bearing mice were randomly divided into groups when the tumor size reached approximately 150 mm. The tumor-bearing mice in the chemotherapy group received a combination of 5-fluorouracil (5-FU) and oxaliplatin (Oxaliplatin) (intraperitoneal injection, 5FU: 30 mg / kg, Oxaliplatin: 0.75 mg / kg, once every 4 days, for a total of 4 times). For the immunosuppressant treatment experiment, when the tumor size reached approximately 150 mm, the tumor-bearing mice were randomly divided into groups when the tumor size reached approximately 150 mm. 3 Tumor-bearing mice were randomly divided into groups. The immunosuppressant-treated group received 100 μg of anti-PDL1 antibody (Bio Xcell InVivo Mab anti-mouse PD-L1 (B7-H1)) via intraperitoneal injection every four days for a total of five doses. Tumor size was measured every three days using a vernier caliper. Tumor size was calculated using the following formula: Tumor volume = tumor long diameter × tumor short diameter 2 ÷2.

[0153] 11. Analysis of MDA5 expression levels and disease-specific survival in patients with different cancers in the TCGA database

[0154] Gene expression data for different cancer types and corresponding patient survival data were downloaded from the Xena website. Within each cancer type, samples were divided into high- and low-expression groups based on MDA5 expression levels. The optimal cutoff values ​​for high and low expression groups were calculated using the surv_cutpoint function in the "survival" R package. Patients with MDA5 expression levels below the cutoff were classified as low-expression, while those with MDA5 expression levels above the cutoff were classified as high-expression. Survival differences between groups were compared using the log-rank method, with p-values ​​less than 0.05 considered significant.

[0155] 12. Analysis of different MDA5 mutation types and survival in TCGA-PAN cancer

[0156] To identify samples harboring MDA5 mutations, we batch-downloaded the MAF files corresponding to all sample mutation information from the TCGA database. We then used command tools to screen samples harboring MDA5 mutations. A total of 177 samples harboring MDA5 mutation information were identified. Among these samples, samples harboring the following mutation types were classified as MDA5 loss-of-function mutations: "Frame_Shift_Del," "Frame_Shift_Ins," "In_Frame_Del," "In_Frame_Ins," "Silent," "Splice_Site," and "Translation_Start_Site."

[0157] The remaining mutation types and samples without mutations were classified as the wild-type group. The survival differences between different groups were compared using the log-rank method, and a p-value less than 0.05 was considered significant.

[0158] In order to gain a deeper understanding of the specific function of MDA5 in cells, this example constructed an MDA5 gene knockout cell line based on the CRISPR / Cas9 method in the mouse colorectal cancer cell line Mc38, and verified the knockout effect of MDA5 using the Western blot method ( Figure 1 a). The cells were then cultured in vitro and the cell proliferation was measured using the CCK8 method. The results showed that there was no difference in growth and proliferation rate between the cell lines with MDA5 gene knockout and the control cell lines in the in vitro culture environment ( Figure 1 b). Then, in this example, the MDA5 knockout cell line and the control cell line were cultured at 2.0×10 6 The number of cells was injected subcutaneously into mice to conduct an in vivo subcutaneous tumor formation experiment. This example found that in the in vivo environment, the growth rate, tumor size, and weight of the MDA5 knockout cell line were significantly lower than those of the control cell line ( Figure 1 c). This indicates that MDA5 plays a vital role in the growth of tumor cells in vivo. Furthermore, this example constructed an MDA5 gene knockout cell line based on another colorectal cancer cell line Ct26 and a liver cancer cell line Hepa1-6 ( Figure 1 d, g), similarly, this example found that, under in vitro culture conditions, there was no difference in the growth and proliferation rates between the Ct26 and Hepa1-6 MDA5 knockout cell lines and the control cell lines ( Figure 1 e, h), however, when conducting subcutaneous tumor formation experiments, this example found that the tumor formation, growth rate, and size of the MDA5-knockout Ct26 and Hepa1-6 cell lines were slower than those of the control cell lines ( Figure 1 f, i).

[0159] To further explore the reasons for the poor tumorigenicity of MDA5 knockout cell lines, this example used Mc38, Ct26, and Hepa1-6 cell lines to conduct subcutaneous tumorigenicity experiments in BALB / c-Nude mice. Nude mice are mutant mice with congenital thymus defects and therefore lack T lymphocytes. This model can be used to evaluate the role of T cells in the immune system in the development of tumors in mice. The results of the subcutaneous tumorigenicity experiments in nude mice showed that in the absence of T cells, there was no difference in tumorigenicity between the knockout group and the control group ( Figure 2 This suggests that the suppression of tumor growth seen in the knockout group in immunocompetent mice is primarily due to T cells.

[0160] Previous literature reports indicate that CD8+ T cells play a crucial role in tumor immunity. To further validate the role of CD8+ T cells, this example used in vivo antibody injection to knock out CD8+ T cells in immunocompetent mice. MDA5 knockout cell lines were then subcutaneously inoculated in these mice, and compared with immunocompetent mice without CD8+ T knockout. The results showed that the MDA5 knockout cell lines formed subcutaneous tumors in CD8+ T knockout mice at the same rate as the control group ( Figure 3 a, b) This means that the key factor in the poor tumorigenesis and slow growth caused by MDA5 knockout is the host's CD8+ T cells. This suggests that MDA5 knockout can enhance CD8+ T cell-mediated specific anti-tumor immunity. Therefore, targeting MDA5 on tumor cells can enhance the host's anti-tumor effect.

[0161] Chemotherapy is one of the main methods of treating tumors in modern medicine. To evaluate the efficacy of combined treatment with chemotherapy and targeting MDA5, this example conducted a subcutaneous tumor formation experiment in an animal model. In the Mc38 cell line, an MDA5 knockdown cell line was constructed using the shRNA method ( Figure 4 a) Then the cell lines were inoculated into the subcutaneous tissues of mice for tumor formation experiments. When the tumor volume was larger than 150 mm 3 The cells were then divided into two groups based on tumor size. One group was treated with Chemo (5-fluorouracil combined with oxaliplatin) and the other group was treated with a placebo. This example found that the tumor size of the MDA5 knockdown group was smaller than that of the control group. Under Chemo treatment, the tumor size was smaller than that of the corresponding cell line not treated with chemotherapy. However, when comparing the response of the MDA5 knockdown group and the control group to chemotherapy, the tumors in the MDA5 knockdown group were significantly smaller than those in the control group ( Figure 4 b) Comparing the responses of the MDA5 knockout group and the control group to Chemo treatment, it was found that the response rate of the placebo group to Chemo was 2 / 10, and the response rate of the MDA5 knockout group was 7 / 10, which was significantly higher than that of the control group ( Figure 4 c). This suggests that MDA5 knockout can significantly enhance the efficacy of chemotherapy. Therefore, combining chemotherapy with MDA5 inhibitors can enhance the tumor-killing effect!

[0162] The development of immunotherapy has brought about a huge leap in cancer treatment. Immune checkpoint inhibitor (ICB) therapy, represented by anti-PD-1 and anti-CTLA-4, has extended the lives of many cancer patients, but this type of therapy also has serious drawbacks: a large number of patients either do not respond to treatment or quickly develop drug resistance, allowing tumor cells to make a comeback. Taking melanoma as an example, anti-PD-1 and anti-CTLA-4 therapy are ineffective for nearly half of the patients. The infiltration level of Cd8+T cells in tumors formed by MDA5 knockout cell lines is significantly increased, so this example infers that combined ICB treatment will be able to improve the therapeutic effect of tumors. The subcutaneous tumor formed by Mc38 MDA5 knockout cell lines has the smallest tumor volume after treatment with Anti-PDL1 antibodies ( Figure 4 b) The same effect was also observed in the Ct26 MDA5 knockout cell line ( Figure 4 These results indicate that inhibiting MDA5 in conjunction with ICB treatment can significantly enhance the tumor killing effect.

[0163] The above examples show that knocking out MDA5 in tumor cells can significantly enhance the immune system's ability to kill tumors. Therefore, the mRNA expression level of MDA5 can be used to assess the prognosis of tumor patients. To this end, this example analyzed the relationship between the overall survival of patients in the TCGA database and the expression level of MDA5. This example found that the low-level MDA5 group had better disease-specific survival in lung adenocarcinoma (LUAD), low-grade glioma (LGG), thymoma (THYM), colorectal cancer (COADREAD), endometrioid carcinoma (UCEC), pancreatic cancer (PAAD), and renal papillary cell carcinoma (KIRP). Figure 5 a). This example further analyzed the difference in overall survival between patients with MDA5 inactivation mutations and other patients. This example also found that patients with MDA5 deletion mutations had a better survival period ( Figure 5 b). These results indicate that MDA5 is a potential tumor marker that can be used to predict patient survival.

[0164] Experimental methods for which specific conditions are not specified in the examples are generally carried out under conventional conditions such as those described in the third edition of the Molecular Cloning Guide or in accordance with the conditions specified in the instructions for reagents and instruments. The contents not described in detail in this specification belong to the prior art known to those skilled in the art. Although embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the present invention, and the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. Use of an agent for inhibiting MDA5 expression in the preparation of a drug for treating tumors, characterized in that: The reagent is sgMDA5#1 or sgMDA5#4 or shMDA5#3, and the specific sequence is as follows: sgMDA5#1: Forward sequence caccgTGGGCCACTTCCATTTGGTA Backward sequence aaacTACCAAATGGAAGTGGCCCAc sgMDA5#4: Forward sequence caccgACATAACAGCAACATGGGCA Backward sequence aaacTGCCCATGTTGCTGTTATGTc shMDA5#3: Forward Sequence CCGGGCAAAGCAATACAACGACAATCTCGAGATTGTCGTTGTATTGCTTTTGCTTTTTG Backward Sequence aattcaaaaaGCAAAGCAATACAACGACAATCTCGAGATTGTCGTTGTATTGCTTTGC The tumor is colon cancer, liver cancer, or melanoma.

2. The use according to claim 1, characterized in that: The drug is a gene editing drug mediated by the CRISPR / Cas9 system, comprising one of sgMDA5#1 and sgMDA5#4 and Cas9 protein.

3. The use according to claim 1, characterized in that: The drug is a combination of 5-fluorouracil and oxaliplatin with the shMDA5#3, and the tumor is colon cancer.

4. The use according to claim 1, characterized in that: The drug is a combination of one of sgMDA5#1 and sgMDA5#4 and an immune checkpoint antibody, the immune checkpoint antibody is a PDL1 monoclonal antibody, and the tumor is colon cancer.

5. The use according to claim 1, characterized in that: The drug is a combination of one of sgMDA5#1 and sgMDA5#4 and an immune checkpoint antibody, the immune checkpoint antibody is a PD1 monoclonal antibody, and the tumor is melanoma.

Images