Preparation and application of a nanounit vaccine of eimeria maxima

Abstract

The application relates to preparation and application of a giant Eimeria nanosubunit vaccine. The nanosubunit vaccine PLGA-rEmLPL is prepared by coating E. maxima Treg-induced molecule EmLPL recombinant protein (rEmLPL) with PLGA nanoparticles. The immunoprotective effects of the subunit vaccine rEmLPL and the nanosubunit vaccine PLGA-rEmLPL are evaluated through animal immunoprotection tests, and the results show that both the vaccines can produce good immunoprotective effects on E. maxima infection. After the recombinant protein subunit vaccine rEmLPL is coated with the PLGA nanoparticles, the immunoprotective effect of the nanosubunit vaccine PLGA-rEmLPL on animals is improved compared with that of the subunit vaccine rEmLPL.

Description

Technical Field

[0001] This invention relates to the field of biological veterinary medicine technology, and specifically to the preparation and application of a chicken giant Eimeria subunit vaccine. Background Technology

[0002] Coccidiosis in chickens is an intestinal parasite that lives in the epithelial cells of the chicken intestine. It can cause diarrhea, bleeding, and malabsorption in chickens, leading to slow growth and even death in severe cases. Therefore, coccidiosis is one of the important parasitic diseases affecting the development of the poultry industry. Among the seven recognized species of coccidiosis in chickens, Eimeria maxima is the most serious and widespread, distributed throughout the world.

[0003] Chicken coccidiosis is primarily controlled through medication and vaccines. While anticoccidial drugs effectively suppress the harm caused by coccidiosis, long-term and excessive use has led to the emergence of drug-resistant strains, reducing the efficacy of these drugs. Furthermore, the use of anticoccidial drugs can cause drug residues, raising concerns about food safety and public health, and even threatening the environment and human health. Therefore, the use of anticoccidial drugs has been restricted. Under these circumstances, vaccination has become an effective way to control chicken coccidiosis. Currently, the main vaccines used for chicken coccidiosis are live vaccines. While the widespread use of live vaccines has reduced the incidence of coccidiosis, it has also exposed some shortcomings. For example, virulent live vaccines have the risk of virulence reversion, increasing the likelihood of disease outbreaks after vaccination. Although attenuated live vaccines have improved safety, their preparation process is complex, production costs are high, immunogenicity is low, and the immune protection provided to animals is not satisfactory.

[0004] The development of subunit vaccines offers a solution to these problems. Subunit vaccines utilize molecular biology techniques to insert protective antigen gene fragments into expression vectors, constructing recombinant expression vectors, and then producing vaccines through expression and purification of recombinant proteins. Compared to live vaccines, subunit vaccines offer higher safety, larger yields, lower production costs, and are easier to transport and store. Furthermore, they eliminate the risk of viral shedding and drug residues, making them a promising alternative strategy for disease control and attracting attention from scholars both domestically and internationally. Currently, the only subunit vaccine available for chicken coccidiosis is the E. maxima subunit vaccine from Israel. It is also the only commercially available subunit vaccine for chicken coccidiosis, made by purifying proteins using E. maxima gametophyte antigens. The production and application of this vaccine have validated its feasibility and practicality.

[0005] A key challenge in controlling coccidiosis in chickens is the immune evasion of coccidia, in which regulatory T cells (Tregs) play a crucial role. Tregs are a subset of T cells that function in maintaining homeostasis and regulating immune responses, and they also have the ability to suppress immune responses. In chickens, CD4+... + CD25 + The cells were identified as chicken regulatory T cells. When chicken coccidia invade, the parasite can induce Treg proliferation. Tregs secrete IL-10 to suppress the host's immune response, thus facilitating the parasite's evasion of the immune response and allowing it to survive and reproduce within the host. However, there is a lack of research on which molecules induce Treg proliferation, and no reports have been found on the design and development of subunit vaccines targeting chicken coccidia's immune evasion problem. In our previous research, the Treg-inducing molecule *E. maximalysophospholipase* (EmLPL), screened from a *E. maximalysophospholipase* sporulated oocyst cDNA expression library, can promote Treg proliferation. Based on this research, this invention develops a subunit vaccine targeting Empls to conduct animal protection experiments and evaluate its immunoprotective effect on animals.

[0006] The rapid development of nanotechnology has also provided excellent auxiliary materials for vaccine research and development. Poly(D,L-Lactide-Co-Glycolide), PLGA, is a biodegradable biopolymer whose degradation products are lactic acid and glycolic acid. It exhibits good biocompatibility and has been approved by the US Food and Drug Administration (FDA) and the European Medicines Agency (EMA) for drug delivery, finding wide application in pharmaceuticals and medical materials. In chicken coccidiosis vaccine research, the nanovaccine PLGA-rEtTA4 was prepared by coating Eimeria tenella recombinant protein rEtTA4 with PLGA nanoparticles. Immunization of animals showed that it induced high levels of specific antibodies and cytokines in mice, indicating that PLGA-coated rEtTA4 nanoparticles have great potential in enhancing immune responses and improving immunoprotective effects. Summary of the Invention

[0007] The purpose of this invention is to provide a nanosubunit vaccine, PLGA-rEmLPL, that can prevent E. maxima infection.

[0008] Another object of the present invention is to provide a method for preparing the nano-subunit vaccine.

[0009] The objective of this invention can be achieved through the following technical solutions:

[0010] The E. maxima nanosubunit vaccine is prepared by coating E. maximaTreg inducer molecule EmlPl recombinant protein (rEmLPL) with PLGA nanoparticles. The recombinant protein rEmLPL is E. maxima lysophospholipase, and its encoding gene sequence is shown in SEQ ID NO.1, and its protein amino acid sequence is shown in SEQ ID NO.2.

[0011] The recombinant protein rEmLPL was obtained by transforming the E. maxima recombinant expression plasmid pET-28a-EmLPL into BL21 Escherichia coli for induced expression, and the expressed recombinant protein rEmLPL was purified using a His protein purification kit.

[0012] The prepared E. maxima nanosubunit vaccine was irregularly spherical with a diameter of approximately 50 nm to 300 nm.

[0013] The method for preparing E. maxima nano-subunit vaccines according to the present invention includes the following steps:

[0014] (1) Prepare recombinant plasmid pET-28a-EmLPL containing the gene sequence encoding hemophospholipase from Eimeria giantiformis;

[0015] (2) The recombinant expression plasmid pET-28a-EmLPL was transformed into BL21 Escherichia coli to obtain bacteria containing the recombinant expression plasmid pET-28a-EmLPL.

[0016] (3) Bacteria containing the pET-28a-EmLPL recombinant expression plasmid were inoculated into LB liquid medium and cultured. When the bacterial culture OD 600 When the value reaches 0.4-0.6, IPTG is added to the bacterial culture to induce the expression of recombinant protein. After culturing for another 6 hours, the bacteria are collected, washed with PBS, and then the precipitate is resuspended with an appropriate amount of PBS. The bacteria are lysed by sonication, and the supernatant is collected by centrifugation. The recombinant protein is purified using a His-tagged protein purification kit.

[0017] (4) The preparation method of the nano subunit vaccine is as follows: Weigh PLGA and dissolve it in dichloromethane, add 5% polyvinyl alcohol, vortex and mix well, sonicate under ice bath conditions, add recombinant protein rEmLPL dropwise to the mixture, vortex and mix well, sonicate under ice bath conditions, at this time the liquid is milky white, add 5% PVA, vortex and mix well, sonicate under ice bath conditions, evaporate the organic solvent, collect the liquid, centrifuge with a refrigerated ultracentrifuge, collect the supernatant and precipitate, resuspend the precipitate with deionized water, place it in a -80℃ freezer for 1 to 3 hours, and then freeze dry it with a vacuum freeze dryer. Take out the freeze-dried sample, which is the prepared nano subunit vaccine.

[0018] As a preferred embodiment of the present invention, the recombinant expression plasmid pET-28a-EmLPL in step (1) is obtained by inserting the coding sequence of Eimeria giant coccidia lysophospholipase shown in SEQ ID NO.1 between the EcoRI and XhoI restriction sites of the pET-28a vector.

[0019] As a preferred embodiment of the present invention, the preparation method of the nano-subunit vaccine in step (4) is as follows: Weigh PLGA and dissolve it in dichloromethane, add 5% polyvinyl alcohol, vortex to mix, and sonicate for 3-8 minutes under ice bath conditions. Add recombinant protein rEmLPL dropwise to the mixture, vortex to mix, and sonicate for 3-8 minutes under ice bath conditions. At this time, the liquid is milky white. Add 2mL Mix 5% PVA by vortexing, sonicate under ice bath conditions for 3-8 minutes, place in a fume hood for about 4 hours to evaporate the organic solvent, collect the liquid, centrifuge for 30 minutes using a refrigerated ultracentrifuge at a speed of 25000-32000 r / min, collect the supernatant and precipitate separately, resuspend the precipitate in deionized water, place in a -80℃ freezer for 2 hours, and then freeze-dry for 18-22 hours using a vacuum freeze dryer. Take out the freeze-dried sample, which is the prepared nano-subunit vaccine; wherein the mass-to-volume ratio of PLGA to dichloromethane is 40-100 mg:1 mL, the volume ratio of 5% polyvinyl alcohol to dichloromethane is 1-5:1, and the mass-to-volume ratio of recombinant protein rEmLPL to dichloromethane is 3-5 mg:1 mL.

[0020] As a further preferred embodiment of the present invention, the ultrasonic conditions are: ultrasonic power 40W, ultrasonic time 5s, interval 5s.

[0021] Application of recombinant expression vectors containing the gene sequence encoding Eimeria giantis lysophospholipase in the preparation of vaccines for the prevention and treatment of Eimeria giantis infection in chickens.

[0022] As a preferred embodiment of the present invention, the recombinant expression vector containing the Eimeria giant coccidia lysophospholipase encoding gene sequence is obtained by inserting the Eimeria giant coccidia lysophospholipase encoding sequence shown in SEQ ID NO.1 between the EcoRI and XhoI restriction sites of the pET-28a vector.

[0023] As a preferred embodiment of the present invention, the vaccine is a nano-subunit vaccine.

[0024] The present invention has the following advantages and effects:

[0025] (1) There are currently no reports on the development of subunit vaccines using immune evasion-related antigen molecules as targets, nor are there any reports on EmlPL promoting Treg proliferation. This invention is the first to use the Treg inducing molecule EmlPL to develop an E. maxima subunit vaccine. The nano-subunit vaccine PLGA-rEmLPL significantly enhances the immunoprotective effect in animals, demonstrating significant innovation.

[0026] (2) There are few studies and reports on E. maxima nanosubunit vaccines at present. This invention enhances the feasibility of developing chicken E. maxima nanosubunit vaccines and provides candidate vaccines for the prevention and control of chicken coccidiosis.

[0027] (3) The PLGA-rEmLPL nanosubunit vaccine prepared by coating recombinant protein rEmLPL with PLGA nanomaterials can improve the stability of the antigen, enhance the antigen presentation ability, enable the antigen to be released slowly, and enhance the immune response. Attached Figure Description

[0028] Figure 1 Screening for Treg-induced molecules.

[0029] A: In the first round of screening, the cDNA library was divided into three primary sub-libraries. After immunizing the animals, CD4 counts were detected. + CD25 + / CD4 + Cell ratio B: In the second round of screening, the primary sub-library was divided into three secondary sub-libraries. After immunizing the animals, CD4 was detected. + CD25 + / CD4 + Cell ratio C: In the third round of screening, single colonies were isolated from secondary sub-libraries 3-7, and plasmids were extracted to immunize animals before CD4 detection. + CD25 + / CD4 + Cell percentage. (*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001)

[0030] Figure 2PCR amplification of the Treg-induced molecule EmPL.

[0031] M: DL 2000 DNA Marker 1: PCR amplification results of EmPL

[0032] Figure 3 Double enzyme digestion identification of recombinant plasmid pET-28a-EmLPL.

[0033] M: DL 5000 DNA Marker 1: pET-28a-EmLPL double enzyme digestion identification results

[0034] Figure 4 Recombinant protein rEmLPL was induced to express and purified.

[0035] M: Protein standard marker 1: pET-28a empty vector before induction 2: pET-28a empty vector after induction 3: rEmLPL before induction 4: rEmLPL after induction 5: Supernatant after sonication 6: Inclusion bodies after sonication 7: rEmLPL after purification

[0036] Figure 5 Scanning electron microscope image of nano-subunit vaccine PLGA-rEmLPL Detailed Implementation

[0037] Basic materials:

[0038] 1. Sporulated oocysts of Eimeria giantiformis: Sporulated oocysts of Eimeria giantiformis from Jiangsu strain were preserved in the Parasitology Laboratory of the College of Veterinary Medicine, Nanjing Agricultural University. They were rejuvenated in chickens every 3 months. Oocysts were collected using the saturated saline flotation method and sporulated, with a sporulation rate of over 80%. They were then preserved in a solution containing 2.5% potassium dichromate (Suo Xun, Li Guoqing. Chicken Coccidiosis [M]. Beijing: China Agricultural University Press, 1998). The cDNA expression library of sporulated oocysts of Eimeria giantiformis was preserved in the Parasitology Laboratory of the College of Veterinary Medicine, Nanjing Agricultural University.

[0039] 2. Experimental animals: 0-day-old Hy-Line Brown chicks were purchased from Nanjing Tegeli Planting Professional Cooperative. From hatching to the end of the experiment, they were raised in a coccidiostat-free environment and were allowed free access to food and water without anticoccidial drugs during the experiment.

[0040] 3. Bacterial strain: The E. maxima recombinant expression plasmid pET-28a-EmLPL was transformed into BL21 Escherichia coli to obtain a strain containing the pET-28a-EmLPL recombinant expression plasmid.

[0041] 4. Tools, enzymes, and reagents: The large-scale plasmid extraction kit was purchased from Nanjing Novizan Biotechnology Co., Ltd.; lymphocyte separation medium was purchased from Tianjin Haoyang Biotechnology Co., Ltd.; Mouse Anti-Chicken CD4:PE was purchased from Southern Biotech; Human Anti-Chicken CD25:FITC was purchased from Bio-Rad; protein standard markers were purchased from Thermo Fisher Scientific; His protein purification kit was purchased from GE Healthcare; polyacrylamide, N,N′-methylenebisacrylamide, and Coomassie Brilliant Blue were purchased from Shanghai Chemical Reagent Packaging Plant; BCA protein quantification kit was purchased from Shanghai Beyotime Biotechnology Co., Ltd.; poly(D,L-Lactide-Co-Glycolide), PLGA, and polyvinyl alcohol (PVA) were purchased from Sigma Aldrich; the remaining reagents were domestically produced analytical grade.

[0042] 5. Major Instruments and Equipment: Flow cytometer (Beckman Coulter, USA); Refrigerated benchtop centrifuge (Eppendorf centrifuge 5417R); Constant temperature shaker (THZ, Taicang Experimental Equipment Factory, Jiangsu Province); Digital display constant temperature water bath (Changzhou Nuoji Instrument Co., Ltd.); Electrophoresis apparatus (DYY-11B, Beijing Liuyi Instrument Factory); Refrigerated ultracentrifuge (Beckman Coulter, USA); Vacuum freeze dryer (LABCONCO, USA); Scanning electron microscope (JEOL JSM-IT100, Japan).

[0043] Example 1. Screening of Treg-inducible molecule EmPL

[0044] 1. cDNA library grouping and immunization

[0045] The bacterial culture for the cDNA expression library of sporulated oocysts of *Eimeria giantis* was divided into three primary sub-libraries and inoculated into LB medium. The sub-libraries were incubated at 37°C and 220 rpm for 14–16 h in a constant-temperature shaking incubator. The plasmids for the cDNA library were extracted using an endotoxin-free plasmid extraction kit. The cDNA library plasmids were injected into 14-day-old chicks via intramuscular injection in the leg, 100 μg per chick. Equal amounts of empty pVAX1 plasmid and sterile PBS were injected into the chicks as controls, with 5 chicks per group.

[0046] 2. Lymphocyte isolation and detection

[0047] Blood was collected from chicks on days 3, 7, 11, and 14 post-immunization. Lymphocytes were isolated from the blood, and CD4+ levels in the lymphocytes were detected by flow cytometry.+ CD25 + / CD4 + Cell proportions. The blood lymphocyte detection method is as follows: Collect anticoagulated blood and dilute it with an equal volume of PBS. Slowly add 5 ml of the diluted blood to a 15 ml centrifuge tube containing an equal volume of lymphocyte separation medium. Centrifuge at 2200 rpm for 20 min to observe liquid separation. Carefully aspirate the milky white middle layer of lymphocytes into a new 15 ml centrifuge tube, add PBS to 10 ml, centrifuge at 1800 rpm for 10 min, and repeat this washing step twice. Adjust the cell concentration to 1x10⁻⁶. 7 Cells / ml were collected, and 100 μl was transferred to a 1.5 ml centrifuge tube. 2 μl of Mouse Anti-Chicken CD4:PE and 2 μl of Human Anti-Chicken CD25:FITC were added, and the cells were incubated at 4°C in the dark for 30 min. Simultaneously, three equal aliquots of cell samples were taken as controls: the first aliquot contained only 2 μl of Mouse Anti-Chicken CD4:PE, the second contained only 2 μl of Human Anti-Chicken CD25:FITC, and the third contained no antibodies. All samples were incubated under the same conditions. After incubation, 500 μl of PBS was added for washing, and the cells were centrifuged at 2500 rpm for 5 min. This process was repeated once. Finally, 500 μl of PBS was added to resuspend the samples, and after thorough repositioning, they were analyzed by flow cytometry. Results are as follows: Figure 1 As shown in Figure A, CD4 in sub-library 3 on day 11 post-immunization. + CD25 + / CD4 + The proportion of cells is showing an upward trend.

[0048] 3. Screening of Treg-inducible molecules

[0049] A second round of screening will be conducted based on the test results (e.g.) Figure 1 As shown in B), the sub-library was divided into three sub-libraries, and plasmids were extracted to immunize 14-day-old chicks. Blood was collected from the chicks on day 11 post-immunization, and CD4 counts in lymphocytes were detected. + CD25 + / CD4 + The proportion of cells, and the results showed that CD4 in secondary sublibraries 3-7 and 3-8 + CD25 + / CD4 + The proportion of cells increased significantly in the second round of screening. CD4 cells were observed in this second round of screening. + CD25 + / CD4 +Single colonies were isolated from secondary sub-libraries 3-7, where the cell proportion increased significantly, for a third round of screening. Plasmids were extracted and used to immunize 14-day-old chicks. Blood was collected from the chicks on day 11 post-immunization, and CD4 counts in lymphocytes were detected. + CD25 + / CD4 + The proportion of cells, the results are as follows Figure 1 As shown in C, CD4 after immunization with plasmid 313 + CD25 + / CD4 + The proportion of cells increased significantly, which is the Treg-inducing molecule that can induce Treg proliferation.

[0050] 4. Identification of Treg-inducible molecules

[0051] The selected inducible molecules were sent to Sangon Biotech for sequencing, and the resulting sequences were compared using online software (https: / / blast.ncbi.nlm.nih.gov). The results showed that the inducible molecule sequence had 96.82% similarity to Eimeria maxima lysophospholipase (sequence ID: XM_013479799.1), and it was named EmLPL.

[0052] Example 2. Induced expression and purification of recombinant protein rEmLPL from Eimeria giantiformis

[0053] 1. Construction of pET-28a-EmLPL recombinant plasmid

[0054] Primers were designed based on the EmpL sequence. The primer sequences are EmpL-F: CCGGAATTCATGCAACAATGGCTATCTG, and EmpL-R: CCGCTCGAGCTAAAACTTAGCAGCAATTG. The EmpL sequence was amplified by PCR. The PCR reaction program was as follows: 95℃ denaturation for 5 min, followed by 95℃ denaturation for 50 s, 55℃ annealing for 50 s, and 72℃ extension for 1 min, for 35 cycles. A final extension at 72℃ for 5 min was performed. After the reaction, the results were observed by 2% agarose gel electrophoresis. Figure 2 As shown, EmLPL amplified the target band, which was 522 bp in size, consistent with the expected result. The target fragment was recovered after double enzyme digestion and ligated into the linearized vector pET-28a to construct the pET-28a-EmLPL recombinant plasmid. The constructed recombinant plasmid was validated using restriction enzymes, and the results are shown below. Figure 3 As shown, after double enzyme digestion, the plasmids showed two bands, namely the pET-28a vector and the inserted gene EmLPL, indicating that the plasmids were successfully constructed.

[0055] 2. Preparation of genetically engineered bacteria

[0056] The E. maxima recombinant expression plasmid pET-28a-EmLPL was transformed into BL21 Escherichia coli and cultured and identified to obtain strains containing the pET-28a-EmLPL recombinant expression plasmid.

[0057] 3. Induction and purification of rEmLPL recombinant protein

[0058] Bacteria containing the pET-28a-EmLPL recombinant expression plasmid were inoculated into LB liquid medium and cultured in a constant temperature shaker at 37°C and 200 rpm. When the bacterial culture OD... 600 When the concentration reached 0.4-0.6, IPTG was added to the bacterial culture to induce recombinant protein expression. After culturing for another 6 hours, the bacteria were collected, washed three times with PBS to remove the surface culture medium, and then the precipitate was resuspended in an appropriate amount of PBS. The bacteria were lysed by sonication, centrifuged at 8000 rpm for 20 min, and the supernatant and precipitate were collected for recombinant protein solubility analysis. The recombinant protein was purified using a His-tagged protein purification kit, identified by SDS-PAGE gel electrophoresis, and its concentration was determined using a BCA protein quantification kit. This constitutes the recombinant protein subunit vaccine for *Eimeria tenella*. Results (attached) Figure 4 The results showed that the recombinant protein rEmLPL was approximately 23.14 kDa, consistent with the expected result. The purified band was single, indicating that the recombinant protein was purified effectively.

[0059] 4. Preparation of the nano-subunit vaccine PLGA-rEmLPL

[0060] Weigh 50 mg of PLGA and dissolve it in 1 mL of dichloromethane. Add 2 mL of 5% polyvinyl alcohol, vortex to mix, and sonicate for 5 min in an ice bath (40 W, 5 s, 5 s interval). Add 4 mg of recombinant protein rEmLPL dropwise to the mixture, vortex to mix, and sonicate for 5 min in an ice bath (40 W, 5 s, 5 s interval). The liquid will be milky white at this point. Slowly add 2 mL of 5% PVA to the liquid, vortex to mix, and sonicate for 5 min in an ice bath (40 W, 5 s, 5 s interval). Place the mixture in a fume hood for about 4 h to evaporate the organic solvent, and centrifuge for 30 min in a refrigerated ultracentrifuge at 30,000 rpm. After centrifugation, the supernatant and precipitate were collected. The total volume of the supernatant was measured, and the protein concentration in the supernatant was determined using a BCA protein quantification kit. The embedding efficiency of the PLGA-coated recombinant protein was calculated (embedding efficiency = (total amount of added protein - total amount of protein in the supernatant) / total amount of added protein × 100%). The precipitate was resuspended in deionized water, placed in a -80℃ freezer for 2 hours, and then freeze-dried in a vacuum freeze dryer for approximately 20 hours. The freeze-dried sample was then removed; this is the PLGA-coated nanosubunit vaccine. A small amount of the nanosubunit vaccine was observed using a scanning electron microscope, while the remainder was stored at 4℃ for later use. Calculations showed that the embedding efficiency of the PLGA-coated recombinant protein was 86.5%. Scanning electron microscopy revealed that the nanosubunit vaccine was irregularly spherical (see attached image). Figure 5 The diameter is approximately 50nm-300nm.

[0061] Example 3. Observation on the immunoprotective effect of Eimeria giant subunit vaccine and nano subunit vaccine

[0062] 1. Experimental Design

[0063] Hy-Line Brown chicks aged 0 days were raised under coccidiosis-free conditions until 14 days of age, at which point they were weighed and grouped. Individuals with significant weight differences were removed, and the chicks were randomly divided into 5 groups of 20 each: a subunit vaccine rEmLPL immunization group, a nanosubunit vaccine PLGA-rEmLPL immunization group, and a PLGA immunization group. The control group consisted of an uninfected and unimmunized group and an infected and unimmunized group. The immunized groups received an intramuscular injection of 200 μg of the corresponding subunit vaccine or nanosubunit vaccine via the leg, respectively. The PLGA immunization group received the same dose of PLGA, and the control group received the same volume of sterile PBS. A booster immunization was administered at 21 days of age, with the same dose as the first immunization. At 28 days of age, the chicks were weighed again. Except for the uninfected and unimmunized group, all other groups were orally infected with Eimeria giantiformis sporulated oocysts, 1 x 10 mm per chick. 5 All chicks were euthanized after being raised for 35 days. The anticoccidial index was calculated by statistically analyzing the weight gain, survival rate, lesion score, and oocyst production of each group.

[0064] 2. Observation of immune protection effect

[0065] 2.1 Weight Changes

[0066] Chicks at 14 days old (at first vaccination), 28 days old (at infection), and 35 days old (at euthanasia) were weighed and their weights recorded. The weight changes of the chicks in different groups were observed, and the average weight gain and relative weight gain rate were calculated. The weight changes are shown in Table 1.

[0067] Average weight gain = Weight at dissection - Weight at insect attack

[0068] Relative weight gain rate (%) = (Average weight gain of the experimental group / Average weight gain of the non-infected and non-immunized group) × 100

[0069] Table 1. Weight changes of chickens at different days in the experiment.

[0070]

[0071] Note: Different lowercase letters in the same column of the table indicate significant differences (P<0.05), while the same letter indicates no significant differences (P>0.05).

[0072] 2.2 Intestinal lesion scoring

[0073] After necropsy, the intestines of the animals were cut open to observe the lesions. Intestinal lesions were scored according to the lesion scoring method of Johnson et al. (Suo Xun, Li Guoqing. Chicken Coccidiosis [M]. Beijing: China Agricultural University Press, 1998, 297-298). The specific criteria were: 0 points, no lesions; +1 point, a few faint hemorrhages are visible on the serosa of the mid-section of the small intestine, a small amount of orange-yellow mucus is visible in the intestinal lumen, and the shape of the intestinal tube is normal; +2 points, numerous hemorrhages are visible on the serosa of the mid-section of the small intestine, a large amount of orange-yellow mucus is visible in the intestinal lumen, and the intestinal wall is thickened; +3 points, the small intestine is distended with gas, the intestinal wall is thickened, the mucosa is rough, and the contents of the small intestine contain small blood clots and mucus; +4 points, the small intestine is significantly distended with gas, the intestinal wall is thickened, and the intestinal contents contain a large number of blood clots and reddish-brown blood; dead chickens were scored 4 points.

[0074] Lesion score = average lesion score × 10.

[0075] 2.3 Oocyte count

[0076] Intestinal contents were collected, and the McMaster method was used to count the number of oocysts in the intestine. The specific procedure was as follows: 2g of the intestinal contents was mixed and placed in a small beaker. 10ml of saturated saline was added and gently stirred. Then, saturated saline was added to bring the volume to 60ml. After mixing, the mixture was filtered, and the filtrate was poured into both counting chambers of a McMaster counting chamber. After standing for 2 minutes, the oocysts were counted under a microscope. The number of oocysts per gram of intestinal contents (OPG) = the average number of oocysts in the two counting chambers × 200.

[0077] The oocyst ratio was calculated based on the OPG values ​​of each group, and then converted into an oocyst value. If the oocyst ratio was 0%-1%, the oocyst value was 0; if it was 1%-25%, the oocyst value was 5; if it was 26%-50%, the oocyst value was 10; if it was 51%-75%, the oocyst value was 20; and if it was 76%-100%, the oocyst value was 40. Oocyst ratio (%) = OPG of experimental group / OPG of infected / unimmunized group × 100.

[0078] 2.4 Anticoccidial Index (ACI)

[0079] Based on the above statistical results, the relative weight gain rate, lesion count, oocyst count, and survival rate of each group were obtained. The anticoccidial index (ACI) of each group was calculated to evaluate the protective efficacy of the subunit vaccine rEmLPL and the nanosubunit vaccine PLGA-rEmLPL against E. maxima infection. The formula for calculating ACI is: ACI = (Survival rate + Relative weight gain rate) - (Lesion count + Oocyst count)

[0080] Survival rate (%) = (Number of surviving chickens in the group / Total number of chickens in the group) × 100

[0081] Relative weight gain rate (%) = (Average weight gain of the experimental group / Average weight gain of the non-infected and non-immunized group) × 100

[0082] Lesion score = average lesion score × 10.

[0083] The criteria for determining ACI are as follows: an ACI of 180 or above indicates excellent protection, 160-180 indicates good protection, 120-160 indicates poor protection, and below 120 indicates ineffective protection.

[0084] 3. Analysis of immune protection effect

[0085] Data from different groups were analyzed using one-way ANOVA in GraphPad Prism 8 statistical analysis software. Table 1 shows that at 14 days of age (first immunization), there was no significant difference in body weight among the groups (P>0.05), indicating reasonable grouping and laying a good foundation for subsequent animal immunization and challenge experiments. Animals were immunized with the subunit vaccine rEmLPL and the nanosubunit vaccine PLGA-rEmLPL at 14 and 21 days of age, respectively. At 28 days of age, except for the uninfected and unimmunized group, all other groups were orally infected with sporulated oocysts of *Eimeria giantiformis*. After treatment with the parasite, the animals were raised until 35 days of age. Significant differences were observed in body weight and relative weight gain among the different groups. Compared with the unvaccinated group, the subunit vaccine rEmLPL and the nano subunit vaccine PLGA-rEmLPL immunized groups showed significant differences in body weight (P<0.05) and significantly increased relative weight gain (P<0.05), indicating that the subunit vaccine rEmLPL and the nano subunit vaccine PLGA-rEmLPL can resist the weight loss in chickens caused by Eimeria giantiformis infection.

[0086] As shown in Table 2, intestinal lesion scores revealed lesions in the intestines of chickens in all groups after E. maxima infection, although the severity of the lesions varied. Compared with the unimmunized group, the intestinal lesions in the subunit vaccine rEmLPL and nanosubunit vaccine PLGA-rEmLPL immunized groups were significantly milder (P<0.05), and the number of oocysts was significantly reduced (P<0.05). This indicates that immunization with subunit vaccine rEmLPL and nanosubunit vaccine PLGA-rEmLPL can reduce the intestinal lesions and the number of oocysts excreted in E. maxima-infected animals to varying degrees, mitigating the harm caused by E. maxima infection and reducing the risk of disease transmission. The ACI values ​​of the subunit vaccine rEmLPL and the nano-subunit vaccine PLGA-rEmLPL were 162.51 and 167.73, respectively, indicating that both subunit vaccines rEmLPL and nano-subunit vaccines PLGA-rEmLPL could produce good immune protection against E. maxima infection. Moreover, the ACI value of the nano-subunit vaccine PLGA-rEmLPL was slightly higher than that of the subunit vaccine rEmLPL, indicating that PLGA nanoparticle-coated subunit vaccines can enhance the immune response and improve the immune protection effect.

[0087] Table 2 Evaluation of the immunoprotective efficacy of subunit and nanosubunit vaccines against E. maxima infection.

[0088]

[0089] Note: Different lowercase letters in the same column of the table indicate significant differences (P<0.05), while the same letter indicates no significant differences (P>0.05).

Claims

1. A giant Eimeria coccidia ( E. maxima Nano-subunit vaccine, characterized by The giant Eimeria nanosubunit vaccine is prepared by coating recombinant protein rEmLPL with PLGA nanoparticles. The recombinant protein rEmLPL is giant Eimeria lysophospholipase, and its encoding gene sequence is shown in SEQ ID NO.

1.

2. The giant Eimeria coccidia as described in claim 1 ( E. maxima Nano-subunit vaccine, characterized by The recombinant protein rEmLPL was obtained by transforming the giant Eimeria coccidia recombinant expression plasmid pET-28a-EmLPL into BL21 Escherichia coli for induced expression, and the expression product was purified using a His protein purification kit.

3. The giant Eimeria coccidia as described in claim 1 ( E. maxima Nano-subunit vaccine, characterized by The giant Eimeria coccidia ( E. maxima The nano-subunit vaccine is an irregular sphere with a diameter of 50 nm - 300 nm.

4. The giant Eimeria coccidia as described in claim 1 ( E. maxima The preparation method of the nano-subunit vaccine includes the following steps: (1) Prepare recombinant plasmid pET-28a-EmLPL containing the gene sequence encoding hemophospholipase from Eimeria giantiformis; (2) Transform BL21 Escherichia coli with the recombinant expression plasmid pET-28a-EmLPL to obtain bacteria containing the recombinant expression plasmid pET-28a-EmLPL; (3) Bacteria containing the pET-28a-EmLPL recombinant expression plasmid were inoculated into LB liquid medium and cultured. When the bacterial culture OD 600 When the value reaches 0.4-0.6, IPTG is added to the bacterial culture to induce the expression of recombinant protein. After culturing for another 6 h, the bacteria are collected, washed with PBS, and then the precipitate is resuspended with an appropriate amount of PBS. The bacteria are lysed by sonication, and the supernatant is collected by centrifugation. The recombinant protein is purified using a His-tagged protein purification kit. (4) The preparation method of the nano subunit vaccine is as follows: Weigh PLGA and dissolve it in dichloromethane, add 5% polyvinyl alcohol, vortex and mix well, sonicate under ice bath conditions, add recombinant protein rEmLPL dropwise to the mixture, vortex and mix well, sonicate under ice bath conditions, at this time the liquid is milky white, add 5% PVA, vortex and mix well, sonicate under ice bath conditions, evaporate the organic solvent, collect the liquid, centrifuge with a refrigerated ultracentrifuge, collect the supernatant and precipitate, resuspend the precipitate with deionized water, place it in a -80 ℃ freezer for 1~3h, and then freeze dry it with a vacuum freeze dryer. Take out the freeze-dried sample, which is the prepared nano subunit vaccine.

5. The giant Eimeria coccidia as described in claim 4 ( E. maxima The method for preparing a nano-subunit vaccine is characterized by: The recombinant expression plasmid pET-28a-EmLPL described in step (1) is formed by inserting the coding sequence for the lysophospholipase of *Eimeria tenella* (SEQ ID NO. 1) into the pET-28a vector. EcoR I and Xho Obtained between I restriction sites.

6. The giant Eimeria coccidia as described in claim 4 ( E. maxima The method for preparing a nano-subunit vaccine is characterized by: Step (4) The preparation method of the nano-subunit vaccine is as follows: Weigh PLGA and dissolve it in dichloromethane, add 5% polyvinyl alcohol, vortex to mix, and sonicate for 3-8 min under ice bath conditions. Add recombinant protein rEmLPL dropwise to the mixture, vortex to mix, and sonicate for 3-8 min under ice bath conditions. At this time, the liquid is milky white. Add 2 mL of 5% PVA, vortex to mix, and sonicate for 3-8 min under ice bath conditions. Place it in a fume hood for 4 h to evaporate the organic solvent. Collect the liquid and centrifuge it for 30 min using a refrigerated ultracentrifuge at a speed of 25000-32000 r / min. After centrifugation, collect the supernatant and precipitate separately. Resuspend the precipitate in deionized water, place it in a -80 ℃ refrigerator for 2 h, and then freeze-dry it for 18-22 minutes using a vacuum freeze dryer. h, take out the lyophilized sample, which is the prepared nano-subunit vaccine; wherein the mass-volume ratio of PLGA to dichloromethane is 40~100mg:1mL, the volume ratio of 5% polyvinyl alcohol to dichloromethane is 1~5:1, and the mass-volume ratio of recombinant protein rEmLPL to dichloromethane is 3~5mg:1mL.

7. The giant Eimeria coccidia as described in claim 6 ( E. maxima The method for preparing a nano-subunit vaccine is characterized by: The ultrasound conditions were as follows: ultrasound power 40W, ultrasound duration 5 seconds, interval 5 seconds.

8. Application of a recombinant expression vector containing the gene sequence encoding the lysophospholipase of Eimeria giantiformis as shown in SEQ ID NO.1 in the preparation of a vaccine for the prevention and treatment of Eimeria giantiformis infection in chickens.

9. The application according to claim 8, characterized in that... The recombinant expression vector containing the Eimeria giant coccidia lysophospholipase coding gene sequence is constructed by inserting the Eimeria giant coccidia lysophospholipase coding sequence shown in SEQ ID NO.1 into the pET-28a vector. EcoR I and Xho Obtained between I restriction sites.

10. The application according to claim 8 or 9, characterized in that... The vaccine in question is a nano-subunit vaccine.

Images