A specific target gene for Psoralea corylifolia and its application in the detection of Psoralea corylifolia and Psoralea corylifolia disease
By designing specific sequences of Ralstonia solanacearum and its primer pairs, a specific PCR detection method was established, which solved the detection problem of the existing technology that was unable to distinguish between Ralstonia solanacearum and Ralstonia pseudosolanacearum, and achieved rapid and reliable detection of Ralstonia solanacearum, which is suitable for mulberry tree quarantine and disease monitoring.
Patent Information
- Application Number
- CN202410376838.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-29
- Publication Date
- 2025-09-23
- Estimated Expiration
- 2044-03-29
AI Technical Summary
Existing universal detection primers for Ralstonia solanacearum cannot distinguish between Ralstonia solanacearum and Ralstonia pseudosolanacearum, resulting in misdetection of Ralstonia solanacearum and causing economic losses.
A specific sequence of Pseudomonas solanacearum and its primer pair were designed for specific detection of Pseudomonas solanacearum, and a PCR detection method based on the primer pair was established, including the specific sequence, primer pair, kit and detection method.
It realizes the rapid and specific detection of mulberry wilt, and can detect whether mulberry wilt exists in plants at an early stage, thereby improving the reliability of healthy mulberry production and the sensitivity of detection, and is suitable for mulberry quarantine and disease monitoring.
Smart Images

Figure CN118127198B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of pathogen detection, and more specifically, relates to a specific target gene for Pseudomonas solanacearum and its application in the detection of Pseudomonas solanacearum and mulberry wilt disease. Background Art
[0002] Ralstonia solanacearum species complex (RSSC) is the pathogen that causes plant bacterial wilt (also known as Ralstonia solanacearum). Ralstonia solanacearum is considered one of the most important plant pathogens in the world due to its wide geographical distribution, large host range, invasiveness, genetic diversity, and long-term persistence in soil and water (Bragard C, Katharina Dehnenchmutz, Serio FD, et al. Pest categorisation of the Ralstonia solanacearum species complex [J]. EFSA Journal, 2019, 17 (2).). With the deepening of research, Ralstonia solanacearum has been divided into four phylotypes: phylotypes I and II correspond to the Asian and American branches, respectively; phylotype III includes strains from Africa; and phylotype IV includes strains from Indonesia and the closely related species R. syzygii and B. dapoxetine. In 2014, the study suggested that strains of phylotype I and phylotype III be classified as one species, named Ralstonia pseudosolanacearum sp.nov., phylotype II strains be classified as one species, retaining the original species name of Ralstonia solanacearum, and phylotype IV strains be included in Ralstonia syzygii, and the Latin name is no longer unified as Ralstonia solanacearum (Progress in Research on Bacterial Wilt of Crop[J]. Guangdong Agricultural Sciences, She Xiaoman, He Zifu. 2020, 47(12):8.). In the latest classification system, Ralstonia solanacearum is divided into three new species, namely Ralstonia solanacearum, Ralstonia pseudosolanacearum, and Ralstonia syzygii. Among them, R. solanacearum and R. pseudosolanacearum are difficult to distinguish by molecular biological methods due to their high genomic homology.
[0003] Among mulberry trees in China, R. pseudosolanacearum is the causative agent of mulberry bacterial wilt, a major disease of mulberry trees. In recent years, it has become widespread in mulberry gardens in southern China's silkworm-producing areas, with a rapid onset and spread, causing serious losses to the sericulture industry. While R. solanacearum is not pathogenic to mulberry trees, it is a soil-borne pathogen. Because it is difficult to distinguish between R. solanacearum and R. pseudosolanacearum, misdiagnosis of R. solanacearum is prone to occur. Among the prevention and control measures for R. solanacearum, it is crucial to detect the pathogen in the soil or mulberry tissue as early as possible, and then take measures such as applying pesticides and cutting down infected plants. Misdiagnosis of R. solanacearum can result in huge economic losses. Therefore, accurate identification and differentiation of R. solanacearum and R. pseudosolanacearum is of great significance for the prevention and control of mulberry wilt disease.
[0004] Existing universal detection primers for Ralstonia solanacearum cannot distinguish between R. solanacearum and R. pseudosolanacearum.
[0005] Therefore, research on rapid and specific diagnostic technology for the mulberry wilt fungus R. pseudosolanacearum provides an important technical basis for the systematic prevention and control of mulberry wilt, improves the quality of mulberry quarantine, and is of great significance for the prevention and control of mulberry wilt. Summary of the Invention
[0006] The technical problem to be solved by the present invention is to overcome the defects and shortcomings of existing detection and diagnosis technologies of Pseudomonas aeruginosa and mulberry wilt disease, provide a Pseudomonas aeruginosa-specific sequence, and design primers based on the sequence to obtain a primer pair for specific detection of Pseudomonas aeruginosa.
[0007] The first object of the present invention is to provide a Ralstonia solanacearum-specific sequence and its application.
[0008] The second object of the present invention is to provide a primer pair for detecting Ralstonia solanacearum.
[0009] The third object of the present invention is to provide a kit for specifically detecting Ralstonia solanacearum or bacterial wilt.
[0010] The fourth object of the present invention is to provide a method for detecting Pseudomonas aeruginosa or mulberry wilt disease.
[0011] The fifth object of the present invention is to provide the above primer pair, kit, and application of the above method.
[0012] The above-mentioned purpose of the present invention is achieved through the following technical solutions:
[0013] The invention provides a specific sequence of Ralstonia solanacearum, the nucleotide sequence of which is shown in SEQ ID NO.1. The Ralstonia solanacearum is Ralstonia pseudosolanacearum.
[0014] The above-mentioned Ralstonia solanacearum-specific sequence is used as a detection target in detecting Ralstonia solanacearum or mulberry wilt disease.
[0015] The use of a reagent for detecting the above-mentioned bacterial wilt-specific sequence in the preparation of a detection product for detecting bacterial wilt or mulberry wilt disease.
[0016] The present invention provides a primer pair for detecting R. solanacearum, comprising a primer pair for detecting the R. solanacearum specific sequence.
[0017] As one of the solutions, the primer pair includes primer 877-1F and primer 877-1R, the sequence of primer 877-1F is shown as SEQ ID NO.2, and the sequence of primer 877-1R is shown as SEQ ID NO.3.
[0018] Based on this, the present invention also provides a kit for specifically detecting Ralstonia solanacearum or bacterial wilt, which contains a reagent for detecting the Ralstonia solanacearum-specific sequence, or contains the above-mentioned primer pair.
[0019] In addition, the present invention provides a method for detecting Pseudomonas aeruginosa or mulberry wilt disease, which uses the above-mentioned Pseudomonas aeruginosa-specific sequence as a target to detect a sample to be tested, and determines whether the sample to be tested contains Pseudomonas aeruginosa or is infected with Pseudomonas aeruginosa based on the result; if the test result is positive, the sample to be tested contains Pseudomonas aeruginosa or is infected with Pseudomonas aeruginosa; if the test result is negative, the sample to be tested does not contain Pseudomonas aeruginosa or is not infected with Pseudomonas aeruginosa.
[0020] Specifically, as a preferred embodiment, the method for detecting Pseudomonas aeruginosa or mulberry wilt disease is to take the DNA of the sample to be tested, use the above-mentioned primer pair or the above-mentioned kit to detect it, and judge whether the sample to be tested contains Pseudomonas aeruginosa or is infected with mulberry wilt disease based on the result; if the test result is positive, the sample to be tested contains Pseudomonas aeruginosa or is infected with mulberry wilt disease; if the test result is negative, the sample to be tested does not contain Pseudomonas aeruginosa or is not infected with mulberry wilt disease.
[0021] As an optional embodiment, the detection is a PCR detection, and whether the sample to be detected contains mulberry wilt or is infected with mulberry wilt disease is determined based on whether the PCR amplification product is positive.
[0022] Preferably, the annealing temperature of the PCR amplification is 48.5-52.5° C., and the number of cycles is 28-29 times.
[0023] Preferably, the annealing temperature of the PCR amplification is 52.2° C., and the number of cycles is 28 times.
[0024] As an optional embodiment, the PCR amplification reaction program is: pre-denaturation at 95°C for 3 minutes, denaturation at 94°C for 25 seconds, annealing at 48.5-52.5°C for 25 seconds, extension at 72°C for 30 seconds, 28-29 cycles, and extension at 72°C for 5 minutes.
[0025] Preferably, the PCR reaction system is: 2×HiFi Mix 10-15 μL, 10 μmol / L primer 877-1F 0.5-1.5 μL, 10 μmol / L primer 877-1R 0.5-1.5 μL, test sample DNA 1-5 μL, and water to 25 μL.
[0026] As an optional embodiment, the method for determining the PCR amplification product is gel electrophoresis. If a band with a size of 400 to 500 bp appears, the detected material contains Ralstonia solanacearum or is infected with bacterial wilt.
[0027] Application of the primer pair, the kit or the detection method in mulberry quarantine, identification of mulberry bacterial wilt and identification of mulberry bacterial wilt fungus.
[0028] The present invention has the following beneficial effects:
[0029] The present invention provides a specific sequence for Pseudomonas solanacearum, and primers are designed based on the sequence to obtain a primer pair for specific detection of Pseudomonas solanacearum. The primer pair can specifically detect Pseudomonas solanacearum and quickly distinguish other mulberry tree diseases, especially Pseudomonas solanacearum from other host species. The primer pair provides important technical support value in the practical detection and application of Pseudomonas solanacearum, can ensure the healthy production and resource utilization of mulberry trees, and has a good application prospect in the detection of Pseudomonas solanacearum.
[0030] Furthermore, a PCR detection method for mulberry bacterial wilt was established based on the primer pair. The detection results of this detection method are reliable, easy to operate (simple and fast), highly specific, and highly sensitive. In addition, the PCR amplification templates applicable to this detection method are very diverse and have a wide range of applications. Total DNA extracted from mulberry stems, branches, and soil can be used as a template, greatly increasing the range of detection objects.
[0031] In addition, this detection method can specifically detect mulberry wilt fungus in the early stage of infection. It can detect whether mulberry wilt fungus exists in the plants before obvious symptoms of mulberry wilt disease appear and the disease breaks out on a large scale. Then, the occurrence of the disease can be monitored in real time in the mulberry garden in preparation for taking corresponding methods and measures, thereby realizing the prediction, monitoring and prevention of mulberry wilt disease, and has good prospects for practical promotion and application. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] Figure 1 Schematic diagram of the specific gene sequence obtained for Ralstonia solanacearum.
[0033] Figure 2 The electrophoresis results of the primer pair screening PCR are shown in Figure 2. Figure 2 Lane M is 500Marker; in Figure a, lanes 1-13 are the amplification results of primers 877-1F / R, lanes 1-7: DNA amplification results of Ralstonia solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk and HJqk, respectively, lane 8: DNA amplification results of RSM, lane 9: DNA amplification results of RSH, lane 10: DNA amplification results of DQQ, lane 11 is the DNA amplification results of 33-24 (negative control), lane 12: DNA amplification results of XCqk (positive control), lane 13: water amplification results (blank control);
[0034] In Figure a, lanes 14-24 are the amplification results of primers 877-2F / R, lanes 14-20: DNA amplification results of Ralstonia solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk and HJqk, respectively; lane 21: DNA amplification results of RSM; lane 22: DNA amplification results of RSH; lane 23: DNA amplification results of DQQ; lane 24: DNA amplification results of 33-24 (negative control); lane 25: DNA amplification results of XCqk (positive control); lane 26 is the amplification result of water (blank control);
[0035] In Figure a, lanes 25-39 are the amplification results of primers 877-3F / R, lanes 27-33: DNA amplification results of Ralstonia solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk and HJqk, respectively; lane 34: DNA amplification results of RSM; lane 35: DNA amplification results of RSH; lane 36: DNA amplification results of DQQ; lane 37: DNA amplification results of 33-24 (negative control); lane 38: DNA amplification results of XCqk (positive control); lane 39: water amplification results (blank control);
[0036] In Figure a, lanes 40-48 are the amplification results of primers 877-4F / R, lanes 40-46: DNA amplification results of Ralstonia solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk, and HJqk, respectively; lane 47: DNA amplification results of RSM; lane 48: DNA amplification results of RSH;
[0037] Lanes 1-4 in Figure b are the amplification results of primers 877-4F / R, lane 1: DNA amplification result of DQQ, lane 2: DNA amplification result of 33-24 (negative control), lane 3: DNA amplification result of XCqk (positive control), lane 4: water amplification result (blank control);
[0038] In Figure b, lanes 5-17 are the amplification results of primers 877-5F / R, lanes 5-11: DNA amplification results of Ralstonia solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk and HJqk, respectively, lane 12: DNA amplification results of RSM, lane 13: DNA amplification results of RSH, lane 14: DNA amplification results of DQQ, lane 15: DNA amplification results of 33-24 (negative control), lane 16: DNA amplification results of XCqk (positive control), lane 17: water amplification results (blank control);
[0039] In Figure b, lanes 18-30 are the amplification results of primers 877-6F / R, lanes 18-24: the amplification results of DNA of Ralstonia solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk and HJqk, respectively; lane 25: the amplification results of DNA of RSM, lane 26: the amplification results of DNA of RSH, lane 27: the amplification results of DNA of DQQ, lane 28: the amplification results of DNA of 33-24 (negative control), lane 29: the amplification results of DNA of XCqk (positive control), lane 30: the amplification results of water (blank control);
[0040] In Figure b, lanes 31-43 are the amplification results of primers 877-7F / R, lanes 31-37: DNA amplification results of Ralstonia solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk and HJqk, respectively, lane 38: DNA amplification results of RSM, lane 39: DNA amplification results of RSH, lane 40: DNA amplification results of DQQ, lane 41: DNA amplification results of 33-24 (negative control), lane 42: DNA amplification results of XCqk (positive control), lane 43: water amplification results (blank control);
[0041] In Figure b, lanes 44-48 are the amplification results of primers 877-8F / R, and lanes 44-48 are the DNA amplification results of Ralstonia solanacearum LKqk, LZqk, XCqk, XZqk and YDqk, respectively.
[0042] Figure 3 The electrophoresis results of the primer pair screening PCR are shown in Figure 2. Figure 3 The middle lane M is 500Marker;
[0043] In Figure a, lanes 1-8 are the amplification results of primers 877-8F / R, lanes 1 and 2: DNA amplification results of Ralstonia solanacearum YLqk and HJqk, respectively, lane 3: DNA amplification result of RSM, lane 4: DNA amplification result of RSH, lane 5: DNA amplification result of DQQ, lane 6: DNA amplification result of 33-24 (negative control), lane 7: DNA amplification result of XCqk (positive control), lane 8: water amplification result (blank control);
[0044] In Figure a, lanes 9-21 are the amplification results of primers 877-9F / R, lanes 9-15: DNA amplification results of R. solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk and HJqk, respectively, lane 16: DNA amplification results of RSM, lane 17: DNA amplification results of RSH, lane 18: DNA amplification results of DQQ, lane 19: DNA amplification results of 33-24 (negative control), lane 20: DNA amplification results of XCqk (positive control), lane 21: water amplification results (blank control);
[0045] In Figure a, lanes 22-24 are the amplification results of primers 877-10F / R, and lanes 22-24 are the amplification results of DNA of Ralstonia solanacearum LKqk, LZqk, and XCqk, respectively;
[0046] In Figure b, lanes 1-10 are the amplification results of primers 877-10F / R, lanes 1-4: DNA amplification results of Ralstonia solanacearum XZqk, YDqk, YLqk and HJqk, respectively, lane 5: DNA amplification results of RSM, lane 6: DNA amplification results of RSH, lane 7: DNA amplification results of DQQ, lane 8: DNA amplification results of 33-24 (negative control), lane 9: DNA amplification results of XCqk (positive control), lane 10: water amplification results (blank control);
[0047] In Figure b, lanes 11-23 are the amplification results of primers 877-11F / R, lanes 11-17: DNA amplification results of Ralstonia solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk and HJqk, respectively, lane 18: DNA amplification results of RSM, lane 19: DNA amplification results of RSH, lane 20: DNA amplification results of DQQ, lane 21: DNA amplification results of 33-24 (negative control), lane 22: DNA amplification results of XCqk (positive control), lane 23: water amplification results (blank control);
[0048] In Figure b, lane 24 is the amplification result of primer 877-12F / R, and lane 24 is the DNA amplification result of Ralstonia solanacearum LKqk;
[0049] In Figure c, lanes 1-12 are the amplification results of primers 877-12F / R, lanes 1-6: DNA amplification results of R. solanacearum LZqk, XCqk, XZqk, YDqk, YLqk and HJqk, respectively, lane 7: DNA amplification results of RSM, lane 8: DNA amplification results of RSH, lane 9: DNA amplification results of DQQ, lane 10: DNA amplification results of 33-24 (negative control), lane 11: DNA amplification results of XCqk (positive control), lane 12: water amplification results (blank control);
[0050] In Figure c, lanes 13-25 are the amplification results of primers 877-13F / R, lanes 13-19: DNA amplification results of Ralstonia solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk and HJqk, respectively, lane 20: DNA amplification results of RSM, lane 21: DNA amplification results of RSH, lane 22: DNA amplification results of DQQ, lane 23: DNA amplification results of 33-24 (negative control), lane 24: DNA amplification results of XCqk (positive control), lane 25: water amplification results (blank control);
[0051] In Figure c, lanes 26-38 are the amplification results of primers 877-14F / R, lanes 26-32: the DNA amplification results of Ralstonia solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk and HJqk, respectively, lane 33: the DNA amplification results of RSM, lane 34: the DNA amplification results of RSH, lane 35: the DNA amplification results of DQQ, lane 36: the DNA amplification results of 33-24 (negative control), lane 37: the DNA amplification results of XCqk (positive control), lane 38: the water amplification results (blank control).
[0052] Figure 4 The electrophoresis results of the primer pair 877-1F / R amplifying the R. solanacearum DNA template at different cycle numbers are shown, where M in the figure is 500 marker;
[0053] Lanes 1-8 in Figure a are the amplification results of 29 cycles, lanes 1-7: DNA amplification results of R. solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk and HJqk, respectively, lane 8: water amplification result (blank control), lane 9: blank;
[0054] In Figure a, lanes 10-18 are the amplification results of 27 cycles, lane 10: 500 marker, lanes 11-17: DNA amplification results of Ralstonia solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk and HJqk, lane 18: water amplification result (blank control), lanes 19-24: blank;
[0055] In Figure a, lanes 25-32 are the amplification results of 26 cycles, lanes 25-31: DNA amplification results of Ralstonia solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk and HJqk, respectively, lane 32: water amplification result (blank control), lane 33: blank;
[0056] Lanes 34-42 in Figure a are the amplification results of 25 cycles, lane 34: 500 Marker, lanes 35-41: DNA amplification results of Ralstonia solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk and HJqk, lane 42: water amplification result (blank control), lanes 43-48: blank;
[0057] In Figure b, lanes 1-8 are the amplification results of 28 cycles, lanes 1-7: the DNA amplification results of Ralstonia solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk and HJqk, respectively, and lane 8: water amplification result (blank control).
[0058] Figure 5 The electrophoresis results of primer pair 877-1F / R amplifying the R. solanacearum DNA template at different annealing temperatures are shown, where M: 500Marker;
[0059] In Figure a, at 55.0°C, lanes 1-7: DNA amplification results of Ralstonia solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk, and HJqk, respectively; lane 8: water amplification result (blank control);
[0060] 54.4°C, lanes 9-15: DNA amplification results of R. solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk, and HJqk, respectively; lane 16: water amplification result (blank control);
[0061] 53.6°C, lanes 17-23: DNA amplification results of R. solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk, and HJqk, respectively; lane 24: water amplification result (blank control);
[0062] 52.2°C, lanes 25-31: DNA amplification results of R. solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk, and HJqk, respectively; lane 32: water amplification result (blank control);
[0063] 50.8°C, lanes 33-39: DNA amplification results of R. solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk, and HJqk, respectively; lane 40: water amplification result (blank control);
[0064] 49.4°C, lanes 41-47: DNA amplification results of Ralstonia solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk, and HJqk, respectively; lane 48: water (blank control);
[0065] In Figure b, at 48.6°C, lanes 1-7: DNA amplification results of Ralstonia solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk, and HJqk, respectively; lane 8: water (blank control); lanes 9-13: blank;
[0066] 48.0℃: Lanes 14-20: DNA amplification results of Ralstonia solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk and HJqk, respectively; Lane 21: Water amplification result (blank control).
[0067] Figure 6The figure shows the electrophoresis results of the amplification of DNA of different pathogens by primer pair 877-1F / R, wherein M: 500Marker; lanes 1-7: DNA amplification results of Ralstonia solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk and HJqk respectively; lane 8: DNA amplification result of RSM strain; lane 9: DNA amplification result of RSH strain; lane 10: DNA amplification result of DQQ strain; lane 11: DNA amplification result of 33-24 strain; lane 12: DNA amplification result of acidogenic-KL strain; lane 13: DNA amplification result of pneumonia-KL strain; lane 14: DNA amplification result of YD-KL strain; lane 15: DNA amplification result of 02-LC strain; lane 16: DNA amplification result of 03-AK strain Results; Lane 17: 283-Intestinal strain DNA amplification results; Lane 18: XC-Intestinal strain DNA amplification results; Lane 19: YD-Intestinal strain DNA amplification results; Lane 20: Willow-Intestinal strain DNA amplification results; Lane 21: 00-XC strain DNA amplification results; Lane 22: 04-KQ strain DNA amplification results; Lane 23: E27 strain DNA amplification results; Lane 24: FJ-01 strain DNA amplification results; Lane 25: Polymyxa strain DNA amplification results; Lane 26: Cereus strain DNA amplification results; Lane 27: Subtilis strain DNA amplification results; Lane 28: Giant strain DNA amplification results; Lane 29: K3-11 strain DNA amplification results; Lane 30: Copper Lv strain DNA amplification results; Lane 31: XCqk DNA (positive control); Lane 32: Healthy mulberry tree DNA amplification results (negative control); Lane 33: Water (blank control).
[0068] Figure 7 The electrophoresis results of the 877-1F / R primer pair sensitivity PCR test (DNA concentration) are shown, where M is 500Marker; XCqk DNA: Lane 1: DNA amplification results of 100 ng / μL Pseudomonas solanacearum; Lane 2: DNA amplification results of 10 ng / μL Pseudomonas solanacearum; Lane 3: DNA amplification results of 1 ng / μL Pseudomonas solanacearum; Lane 4: DNA amplification results of 100 pg / μL Pseudomonas solanacearum; Lane 5: DNA amplification results of 10 pg / μL Pseudomonas solanacearum; Lane 6: DNA amplification results of 1 pg / μL Pseudomonas solanacearum; Lane 7: DNA amplification results of 100 fg / μL Pseudomonas solanacearum; Lane 8: DNA amplification results of 10 fg / μL Pseudomonas solanacearum; Lane 9: DNA amplification results of 1 fg / μL Pseudomonas solanacearum; Lane 10: DNA amplification results of 100 ag / μL Pseudomonas solanacearum; Lane 11: DNA amplification results of XCqk (positive control); Lane 12: water (blank control).
[0069] Figure 8 This is the electrophoresis result of PCR detection (bacterial concentration) of 877-1F / R primer pair sensitivity, where M: 500 Marker; XCqk bacterial solution: Lane 1: dilution factor is 10 0 Bacteria amplification results (1×10 8 CFU / mL); Lane 2: dilution factor is 10 -1 Bacteria amplification results (1×10 7 CFU / mL); Lane 3: dilution factor is 10 -2 Bacteria amplification results (1×10 6 CFU / mL); Lane 4: dilution factor is 10 -3 Bacteria amplification results (1×10 5 CFU / mL); Lane 5: dilution factor is 10 -4 Bacteria amplification results (1×10 4 CFU / mL); Lane 6: dilution factor is 10 -5 Bacteria amplification results (1×10 3 CFU / mL); Lane 7: dilution factor is 10 -6 Bacteria amplification results (1×10 2 CFU / mL); Lane 8: dilution factor is 10 -7 Bacteria amplification results (1×10 1 CFU / mL); Lane 9: dilution factor is 10 -8 Bacterial amplification results (1×100 CFU / mL); Lane 10: dilution factor is 10 -9 Bacteria amplification results (1×10 -1 CFU / mL); Lane 11: DNA amplification result of XCqk (positive control); Lane 12: water amplification result (blank control).
[0070] Figure 9 This is a picture of the symptoms of mulberry wilt in the field.
[0071] Figure 10 This is a picture of the stem of a mulberry tree affected by mulberry wilt.
[0072] Figure 11 A diagram of healthy mulberry trees in the field.
[0073] Figure 12 The electrophoresis results of primer pair 877-1F / R PCR detection of various materials are shown, where M: 500Marker;
[0074] Lane 1: diseased sample from Fengshan Town, Liucheng, Liuzhou City, Guangxi, stem of Qiangsang No. 1;
[0075] Lane 2: diseased sample from Fengshan Town, Liucheng, Liuzhou City, Guangxi, root of Qiangsang No. 1;
[0076] Lane 3: diseased sample from Fengshan Town, Liucheng, Liuzhou City, Guangxi, stem of Guisang No. 12;
[0077] Lane 4: diseased sample from Wenhua Primary School, Huanjiang County, Hechi City, Guangxi, stem of Nongsang No. 14;
[0078] Lane 5: Banlie disease sample from Changmei Township, Huanjiang County, Hechi City, Guangxi, root of Nongsang No. 14;
[0079] Lane 6: Diseased sample from Poliangtun, Wenhua Village, Huanjiang County, Hechi City, Guangxi, root of Qiangsang No. 5;
[0080] Lane 7: Diseased sample from Poliangtun, Wenhua Village, Huanjiang County, Hechi City, Guangxi, stem of Qiangsang No. 5;
[0081] Lane 8: Diseased sample from Wenhua Primary School, Huanjiang County, Hechi City, Guangxi, root of Nongsang No. 14;
[0082] Lane 9: diseased sample from Fengshan Town, Liucheng District, Liuzhou City, Guangxi Province, soil Nongsang No. 14;
[0083] Lane 10: diseased sample from Fengshan Town, Liucheng, Liuzhou City, Guangxi, stem of Nongsang 14;
[0084] Lane 11: Banlie disease sample from Changmei Township, Huanjiang County, Hechi City, Guangxi, soil No. Nongsang 14;
[0085] Lane 12: Banlie disease sample from Changmei Township, Huanjiang County, Hechi City, Guangxi, soil Qiangsang No. 5;
[0086] Lane 13: XCqk DNA (positive control);
[0087] Lane 14: Healthy mulberry DNA. DETAILED DESCRIPTION
[0088] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.
[0089] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.
[0090] HiFi Mix was purchased from Guangzhou Xinkailai Biotechnology Co., Ltd. with the catalog number: XKL0211.
[0091] The pathogen information used in the following examples is shown in Table 1:
[0092] Table 1 Strain information
[0093]
[0094]
[0095] Note: “-”: deposited in the inventor’s laboratory; “*”: donated by Professor Wang Guoping’s team at the College of Horticulture, South China Agricultural University; all other strains were provided by the laboratory of the Asia-Pacific Sericulture Training Center, South China Agricultural University; GDMCC: Guangdong Microbial Culture Collection Center; WHG: Whole Genome Sequence.
[0096] Example 1 Obtaining the specific gene sequence of Ralstonia solanacearum
[0097] The mulberry wilt fungi XCqk, XZqk and Ylqk were found in the branches and root soil of diseased mulberry trees.
[0098] The high-throughput whole-genome sequencing method was used to sequence the solanacearum XCqk, XZqk and Ylqk to obtain their genome sequences.
[0099] Based on the comparative analysis of the whole genome of Ralstonia solanacearum in Table 1, specific fragments were found and verified by electrophoresis to obtain their specific gene sequences, as shown in the schematic diagram. Figure 1 The specific sequence is as follows:
[0100] ATGCGCAGGGACACACAGAAGCGAACCGAGCCCAAGGGCACCTATCGCGTCAAGAACTGGGCGGCGTACAACGCTGGCCTGATTGCCAGGGGAGACGTCACGATGTGGATTGACCAAAGCGTGTTGGCATCGTCCGACGTGGGCGTGTCCAGGCGCGGTCGCCCGTGCGTCTATCCGGATGCTGTCATCCAGATGTTGCTTGGCCTCAAGCAGGTGTTCCGCCTGCCGCTGCGCGCGCTGCAAGGTTTTGCCATGAGCTTGCGCAAGCTTGCCTTCGCGGACCTGCCAGTGCCGAACTACACGACCTTGAGCAGACGTGCGCAGGACTTGGCGGTCATCCTGCCCGCGCTGCGCACCGGCGAGCCTATGCACCTGGTCGTTGACAGCACCGGTCTGAAGGTCTTCGGTGAAGGCGAGTGGAAGGTGCGCAAGCACGGTTATTCCAAGCGCCGCACCTGGCGCAAGGTCCATCTGGCGATGGACGCCAAGAGCGGTCAGATATGCGCTGCACTGATGACGCATCAGGATGTCGGCGACGCCGACGTGTTGCCTGACTTGCTCGACCAGTTGCCGCCCGGCACGTCCGTGGACGTCGTTGGCGGTGACGGCGCATACGACACCAAGTCGTGTCATGCGGCGATTGCCGCCGCAGACGCGCAGCCCTCGATTCCGCCGCGCGAGGGTGCAATGCGATGGCCGAAGACCGCCCCCGGTGCGGCATGGCGCAATGCGGCCATCGACGCCATCGCAACGAGCAGCAGACGCGAATGGAAGAAGGCCAGCGGCTATCACTGCCGCTCGCTGGTCGAGAACCTGATGTATCGGCTCAAGACGCTCACGGGTCAATCCCTGTGGGCGCGCAAGGTCGGCTCCCAGGCCACCGAGGTGGCCATCCGCGCTGGCGTGCTCAACCGCATGGCCGCGCTCGCTCGCCCTCAGTCCGTCCGCGTCGCCTGA。
[0101] Example 2 Design of primers for detecting Ralstonia solanacearum and establishment of PCR amplification method
[0102] (1) Experimental methods
[0103] 1. Primer design and screening
[0104] A large number of primers were designed based on the R. solanacearum specific gene obtained in Example 1 (sequence shown in SEQ ID NO. 1). The names and sequences of the designed primers are shown in Table 2.
[0105] After analysis and screening, a primer pair with excellent specificity and sensitivity was obtained and named 877-1F / R. Primer pair 877-1F / R includes primers 877-1F and 877-1R, whose nucleotide sequences are shown in SEQ ID NOs. 2 and 3, respectively, and are shown in Table 2 below.
[0106] Table 2 Primer pair 877-1F / R sequence
[0107]
[0108]
[0109] 2. Result judgment
[0110] The 14 designed primer pairs were used for amplification using the DNA of mulberry solanacearum LKqk, LZqk, XCqk, XZqk, YDqk, YLqk, and HJqk; the DNA of tomato-derived solanacearum RSM and RSH; and the DNA of eggplant-derived solanacearum DQQ as templates. The DNA template of Ralstonia pilosula 33-24 from pepper was used as a negative control, the DNA template of mulberry solanacearum XCqk was used as a positive control, and water was used as a blank control. After amplification, agarose gel electrophoresis was performed.
[0111] After the PCR reaction is completed, the presence of the amplified target band according to agarose gel electrophoresis is positive, and the absence of the amplified target band is negative, which can determine the presence of the pathogen of mulberry wilt disease, R. solanacearum, in the sample.
[0112] (2) Experimental results
[0113] The electrophoresis results of PCR screening with 14 primer pairs are shown in the figure below. Figure 2 and Figure 3 As shown, the results show that:
[0114] (1) Primer pairs 877-1F / R, 877-2F / R, and 877-3F / R were able to detect seven strains of R. solanacearum, but primers 877-2F / R and 877-3F / R also produced amplified fragments for R. solanacearum RSM ( Figure 2(a in Figure 1), therefore, only 877-1F / R had the specific detection ability for the seven strains of R. solanacearum;
[0115] (2) Primer pair 877-4F / R had no detection capability for R. solanacearum YLqk, but had detection capability for the other 6 strains of R. solanacearum. However, it also produced amplified fragments for R. solanacearum RSM ( Figure 2 Figures a and b in Figure 3);
[0116] (3) Primer pairs 877-5F / R and 877-6F / R were able to detect 7 strains of R. solanacearum, but produced weak amplified fragments for R. solanacearum RSM. Figure 2 (Figure b in the figure);
[0117] (4) Primer pair 877-7F / R had no detection capability for 7 strains of R. solanacearum ( Figure 2 (Figure b in the figure);
[0118] (5) Primer pairs 877-8F / R and 877-9F / R were able to detect 7 strains of R. solanacearum, but also produced amplified fragments for R. solanacearum RSM ( Figure 2 Figure b and Figure 3 Figure a in the figure);
[0119] (6) Primer pairs 877-10F / R and 877-11F / R were able to detect 7 strains of R. solanacearum, but also produced weak amplified fragments for R. solanacearum RSM ( Figure 3 Figures a and b in Figure 3);
[0120] (7) Primer pair 877-12F / R had the ability to detect 7 strains of R. solanacearum, but also produced weak amplified fragments for R. solanacearum RSM, R. solanacearum DQQ, and R. solanacearum 33-24. Figure 3 Figures b and c in Figure 3);
[0121] (8) Primer pairs 877-13F / R and 877-14F / R were able to detect 7 strains of R. solanacearum. However, primer pair 877-13F / R also produced weak amplified fragments for R. solanacearum DQQ of eggplant and R. solanacearum 33-24 of pepper. Primer pair 877-14F / R also produced amplified fragments for R. solanacearum RSM of tomato, R. solanacearum DQQ of eggplant and R. solanacearum 33-24 of pepper. Figure 3 Figure c in the figure).
[0122] Considering the primer specificity and band clarity, the 877-1F / R primer pair was selected as the specific detection primer for R. solanacearum and was used in subsequent studies.
[0123] The sequence of the product amplified by the 877-1F / R primer pair is shown in SEQ ID NO.1.
[0124] SEQ ID NO.1:
[0125] GCCGAACTACACGACCTTGAGCAGACGTGCGCAGGACTTGGCGGTCATCCTGCCCGCGCTGCGCACCGGCGAGCCTATGCACCTGGTCGTTGACAGCACCGGTCTGAAGGTCTTCGGTGAAGGCGAGTGGAAGGTGCGCAAGCACGGTTATTCCAAGCGCCGCACCTGGCGCAAGGTCCATCTGGCGATGGACGCCAAGAGCGGTCAGATATGCGCTGCACTGATGACGCATCAGGATGTCGG CGACGCCGACGTGTTGCCTGACTTGCTCGACCAGTTGCCGCCCGGCACGTCCGTGGACGTCGTTGGCGGTGACGGCGCATACGACACCAAGTCGTGTCATGCGGCGATTGCCGCCGCAGACGCGCAGCCCTCGATTCCGCCGCGCGAGGGTGCAATGCGATGGCCGAAGACCGCCCCCGGTGCGGCATGGCGCAATGCGGCCATCGACGCCATCGCAACGAGCAGCAGACGCGAATGGAAGAA.
[0126] Example 3 Establishment of PCR Detection Method for Primer Pair 877-1F / R
[0127] (1) Experimental methods
[0128] 1. Optimization of PCR amplification reaction cycle number 2 ng / μL R. solanacearum DNA was used as template and 877-1F / R primer pair was used as amplification primer. PCR amplification was performed at 29, 28, 27, 26, and 25 different reaction cycle numbers. The amplification system was 25 μL. The specific PCR reaction system is shown in Table 3.
[0129] 2. Optimization of PCR amplification reaction annealing temperature Using 2 ng / μL Pseudomonas solanacearum DNA as template and 877-1F / R primer pair as amplification primers, PCR amplification was performed at 8 different reaction annealing temperatures of 55.0°C, 54.4°C, 53.6°C, 52.2°C, 50.8°C, 49.4°C, 48.6°C, and 48.0°C. The amplification system was 25 μL. The specific PCR reaction system is shown in Table 3.
[0130] Table 3 PCR reaction system
[0131] 2×HiFi Mix 12.5μL Primer 877-1F (10 μmol / L) 1 μL Primer 877-1R (10 μmol / L) 1 μL Template DNA 2μL <![CDATA[ddH2O]]> Add to 25 μL
[0132] (2) Experimental results
[0133] The electrophoresis results of the primer pair 877-1F / R for amplifying the R. solanacearum DNA template at different cycle numbers are shown in the figure below. Figure 4 As shown in the figure, the results show that when the 877-1F / R primer pair was used at cycle 29, the amplified band had the highest clarity but showed dragging, but no amplified band was found at cycles 27, 26, and 25. Considering the primer specificity and band clarity, 28 cycles were selected as the optimal number of amplification cycles for the 877-1F / R primer pair.
[0134] The electrophoresis results of primer pair 877-1F / R for amplifying the DNA template of R. solanacearum at different annealing temperatures are shown in the figure. Figure 5 As shown in the figure, the results showed that the detection effect of primer 877-1F / R on R. solanacearum was slightly different at different annealing temperatures. When the annealing temperature was 54.4℃, the specificity was good, but the detection ability for HJqk was lost, and the amplification band for YLqk was unclear. The results of annealing temperatures of 55.0℃ and 53.6℃ were basically consistent with the results of annealing temperature of 54.4℃ ( Figure 5 When the annealing temperature was 52.2℃, 50.8℃, 49.4℃ and 48.6℃, the 7 strains of R. solanacearum were all specifically detected, but when the annealing temperature was 52.2℃, there were fewer non-specific bands ( Figure 5 Figure a and b in the figure); when the annealing temperature is 48.0℃, the detection ability of Ralstonia solanacearum is lost ( Figure 5 Considering the primer specificity and band clarity, 52.2°C was selected as the optimal annealing temperature.
[0135] Example 4 Specificity Detection of 877-1F / R Primer Pair
[0136] (1) Experimental methods
[0137] The primer pair 877-1F / R was used to amplify the different pathogens shown in Table 1. Specifically, PCR amplification was performed using the DNA of these pathogens as the amplification template. After amplification, agarose gel electrophoresis was performed. The amplification conditions were pre-denaturation at 95°C for 3 minutes, denaturation at 94°C for 25 seconds, annealing at 52.2°C for 25 seconds, extension at 72°C for 30 seconds, 28 cycles, and extension at 72°C for 5 minutes. The reaction system was the same as Table 3 of Example 3.
[0138] (2) Experimental results
[0139] The electrophoresis results of the primer pair 877-1F / R for amplifying DNA from different pathogens are as follows: Figure 6As shown, the results showed that the primer pair 877-1F / R could only amplify bands with the Ralstonia solanacearum DNA template, and could not amplify bands with the Ralstonia solanacearum DNA templates of other mulberry pathogens, nor could it amplify bands with the Ralstonia solanacearum DNA templates of other hosts, indicating that this primer pair can specifically detect Ralstonia solanacearum.
[0140] Example 5 Sensitivity Detection of 877-1F / R Primer Pair
[0141] (1) Experimental methods
[0142] 1. Extract the DNA of R. solanacearum XCqk and adjust the original concentration to 100 ng / μL.
[0143] The above DNA was diluted with 1×TE Buffer to 10 and 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 times. That is, the concentration gradient of the DNA template was 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL, 1 fg / μL, and 100 ag / μL.
[0144] Using the above-mentioned DNA at different concentrations as a template, PCR amplification was performed using the 877-1F / R primer pair. The amplification conditions were: pre-denaturation at 95°C for 3 min, denaturation at 94°C for 25 s, annealing at 52.2°C for 25 s, extension at 72°C for 30 s, 28 cycles, and extension at 72°C for 5 min. The reaction system was the same as Table 3 of Example 3. After the PCR amplification reaction, detection was performed by agarose gel electrophoresis.
[0145] 2. Extract the bacterial solution based on the specific gene of R. solanacearum and adjust the original concentration of the bacterial solution to 10 8 CFU / mL.
[0146] The bacterial solution concentration was diluted with ddH20 to 10 and 10 respectively. 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 times. That is, the concentration gradient is 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2, 10 CFU / mL of bacterial solution.
[0147] The above-mentioned bacterial suspensions of different concentrations were used as templates, and PCR amplification was performed using the 877-1F / R primer pair. The amplification conditions were pre-denaturation at 95°C for 3 min, denaturation at 94°C for 25 s, annealing at 52.2°C for 25 s, extension at 72°C for 30 s, 28 cycles, and extension at 72°C for 5 min. The reaction system was the same as Table 3 of Example 3. After the PCR amplification reaction, detection was performed by agarose gel electrophoresis.
[0148] (2) Experimental results
[0149] The results of PCR sensitivity test (DNA concentration) using primer pair 877-1F / R are as follows: Figure 7 As shown, the 877-1F / R primer pair can detect pathogen DNA at a concentration of 10 -4 ng / μL, with good detection sensitivity.
[0150] The electrophoresis results of the 877-1F / R primer pair sensitivity PCR test (bacterial concentration) are as follows Figure 8 As shown, the primer pair 877-1F / R can detect the bacterial concentration of 10 4 CFU / mL, with good detection sensitivity.
[0151] The specificity and sensitivity experimental results of Examples 4 and 5 above fully demonstrate that the primer pair 877-1F / R can not only specifically detect R. solanacearum, but also has good detection sensitivity.
[0152] Example 6 Detection of pathogens in mulberry branches and stems infected with mulberry bacterial wilt, soil, and bacterial wilt in various locations
[0153] (1) Experimental methods
[0154] 1. Material selection
[0155] The experimental materials selected included mulberry stems and branches, soil from diseased mulberry gardens in Fengshan Town, Liucheng District, Liuzhou City, Guangxi; Wenhua Primary School, Huanjiang County, Hechi City, Guangxi; Banlie, Changmei Township, Huanjiang County, Hechi City, Guangxi; and Poliangtun, Wenhua Village, Huanjiang County, Hechi City, Guangxi; as well as Racina fusarum isolated from Xincheng County, Laibin District, Guangxi, and disease-free mulberry stems, branches and fresh leaves, a total of 12 test material samples.
[0156] Symptoms of mulberry wilt in the field Figure 9 As shown in the figure, the stem of the mulberry tree affected by mulberry wilt is as follows: Figure 10 As shown, the state of healthy mulberry trees in the field is as follows Figure 11 shown.
[0157] 2. Extraction of total DNA from materials
[0158] The total DNA of materials containing mulberry components was extracted by the boiling method. The specific steps are as follows: 0.5 g of plant tissue material was selected and ground into powder using liquid nitrogen. Then, 150 μL of sterile water was added to a 1.5 mL centrifuge tube, and then the powder sample after liquid nitrogen grinding was added. After sufficient shaking, the mixture was placed in a constant temperature metal bath at 100°C for 10 to 15 minutes, and then centrifuged at 12,000 r / min for 10 minutes to obtain the supernatant to obtain the total DNA.
[0159] The total DNA of the rhizosphere soil of mulberry trees was extracted by the boiling method. The specific steps are as follows: 0.5 g of rhizosphere soil of the diseased plant was weighed and added to a 1.5 mL centrifuge tube. Then 500 μL of sterile water was added. After sufficient shaking, the solution was placed in a constant temperature metal bath at 100°C for 10 to 15 minutes and then centrifuged at 12,000 r / min for 10 minutes to obtain the supernatant to obtain the total DNA.
[0160] 3. PCR amplification
[0161] Total DNA extracted from different materials was used as a template and PCR amplification was performed with the 877-1F / R primer pair. The amplification conditions were pre-denaturation at 95°C for 3 min, denaturation at 94°C for 25 s, annealing at 52.2°C for 25 s, extension at 72°C for 30 s, 28 cycles, and extension at 72°C for 5 min. The reaction system was the same as Table 3 of Example 3. After the PCR amplification reaction, agarose gel electrophoresis was performed to determine whether P. solanacearum was present in the test sample.
[0162] (2) Experimental results
[0163] The results of PCR detection of each material by primer pair 877-1F / R are as follows Figure 12 As shown in the figure, the results showed that the mulberry branches, roots and soil samples of the mulberry orchards where mulberry bacterial wilt had occurred were all positive (lanes 1-12), while the fresh healthy mulberry branches used as the control were not detected with the pathogen (lane 14). This proved that the pathogen was present in the mulberry branches, roots and soil of the mulberry orchards where mulberry bacterial wilt had occurred. It also showed that the primer pair 877-1F / R can be used for disease diagnosis of mulberry bacterial wilt.
[0164] Depend on Figure 6 、 Figure 12The electrophoresis result shows that the primer pair 877-1F / R of the present invention can distinguish mulberry solanacearum from various mulberry pathogens such as Klebsiella sp., Enterobacter sp., Pantoea ananatis, etc., which are pathogens of mulberry bacterial wilt, as well as tomato source solanacearum, eggplant source solanacearum, pepper source solanacearum, polymyxa bacillus, cereus bacillus, subtilis, megaterium, terquila bacillus, and Pseudomonas aeruginosa. The results show that the primer pair 877-1F / R of the present invention can distinguish mulberry solanacearum from various mulberry pathogens such as Klebsiella sp., Enterobacter sp., and Pantoea ananatis, which are pathogens of mulberry bacterial wilt, and tomato source solanacearum, eggplant source solanacearum, pepper source solanacearum, polymyxa bacillus, cereus bacillus, subtilis bacillus, megaterium, terquila bacillus, and Pseudomonas aeruginosa, and the detection result is reliable, easy to operate (simple and rapid), highly specific, and highly sensitive. It can be used for the rapid detection of mulberry solanacearum, especially for quickly distinguishing other mulberry diseases. It has important technical support value in the actual detection application of solanacearum, and can provide guarantee for the healthy production and resource utilization of mulberry trees. When preventing and controlling mulberry diseases, the role of mulberry branches in the pathogen transmission cycle should be considered. When managing mulberry gardens, the processing work of mulberry branches should be carried out.
[0165] The above embodiments are preferred implementations of the present invention, but the implementations of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered equivalent replacement methods and are included in the scope of protection of the present invention.
Claims
1. A specific sequence of Ralstonia solanacearum, characterized in that The nucleotide sequence is shown in SEQ ID NO. 1, and the Ralstonia pseudosolanacearum is Ralstonia pseudosolanacearum.
2. Use of the Pseudomonas aeruginosa specific sequence according to claim 1 as a detection target in detecting Pseudomonas aeruginosa or mulberry wilt disease.
3. Use of a reagent for detecting the specific sequence of Pseudomonas aeruginosa according to claim 1 in the preparation of a detection product for detecting Pseudomonas aeruginosa or mulberry wilt disease.
4. A primer pair for detecting Ralstonia solanacearum, characterized in that: It comprises a primer pair for detecting the specific sequence of Ralstonia solanacearum according to claim 1.
5. The primer pair according to claim 4, characterized in that The primer comprises primer 877-1F and primer 877-1R, wherein the sequence of primer 877-1F is shown as SEQ ID NO.2, and the sequence of primer 877-1R is shown as SEQ ID NO.
3.
6. A kit for specifically detecting Ralstonia solanacearum or bacterial wilt, characterized in that: A reagent containing the specific sequence for detecting the Ralstonia solanacearum according to claim 1, or containing the primer pair according to claim 4 or 5.
7. A method for detecting Solanacearum spp. or mulberry wilt disease, characterized in that: The specific sequence of Pseudomonas aeruginosa described in claim 1 is used as a target to detect the sample to be tested, and whether the sample to be tested contains Pseudomonas aeruginosa or is infected with Pseudomonas aeruginosa is determined based on the result; if the test result is positive, the sample to be tested contains Pseudomonas aeruginosa or is infected with Pseudomonas aeruginosa; if the test result is negative, the sample to be tested does not contain Pseudomonas aeruginosa or is not infected with Pseudomonas aeruginosa.
8. The method according to claim 7, characterized in that: Take the DNA of the sample to be tested, and perform PCR detection using the primer pair described in claim 4 or 5 or the kit described in claim 6, and judge whether the sample to be tested contains Pseudomonas aeruginosa or is infected with mulberry wilt according to the result; if the test result is positive, the sample to be tested contains Pseudomonas aeruginosa or is infected with mulberry wilt; if the test result is negative, the sample to be tested does not contain Pseudomonas aeruginosa or is not infected with mulberry wilt.
9. The method according to claim 8, characterized in that The annealing temperature of the PCR amplification is 48.5-52.5° C., and the number of cycles is 28-29 times.
10. Use of the primer pair according to any one of claims 4 to 5, the kit according to claim 6, or the detection method according to any one of claims 7 to 9 in the identification of mulberry bacterial wilt or identification of Ralstonia spp.
Citation Information
Patent Citations
Pseudomonas L40-14 and application thereof in prevention and treatment of mulberry diseases
CN116083309A
Bacillus subtilis, biocontrol inoculant and application of bacillus subtilis and biocontrol inoculant
CN116640679A