Fluorescent quantitative PCR primer probe set, kit and application for detecting pathogen related to swine reproductive disorder disease
By designing fluorescent quantitative PCR primer probe sets and kits, efficient and sensitive detection of PRRSV, PCV2 and PCV3 was achieved, solving the problem of difficulty in simultaneously detecting multiple porcine reproductive and reproductive viruses in existing technologies, and having good detection effects and clinical application value.
Patent Information
- Application Number
- CN202410440647.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-12
- Publication Date
- 2025-10-21
- Estimated Expiration
- 2044-04-12
AI Technical Summary
Existing technologies make it difficult to simultaneously and efficiently detect porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus type 2 (PCV2) and porcine circovirus type 3 (PCV3), resulting in low diagnostic and detection efficiency and inability to meet clinical needs.
A fluorescent quantitative PCR primer-probe set containing specific primers and probes was designed and synthesized, which can simultaneously detect PRRSV, PCV2 and PCV3. It was combined with a fluorescent quantitative PCR kit for detection, and the reaction conditions were optimized to achieve triple detection.
It achieves efficient and sensitive detection of PRRSV, PCV2 and PCV3, with a detection limit of 10 copies/μL. It has good specificity and repeatability and is suitable for clinical sample testing.
Smart Images

Figure CN118127241B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a fluorescent quantitative PCR primer probe set, a kit and applications for detecting pathogens related to porcine reproductive disorders. Background Art
[0002] Porcine reproductive and respiratory syndrome virus (PRRSV) is an enveloped, linear, single-stranded, positive-sense RNA virus belonging to the family Arteriviridae of the order Nidovirales. Porcine reproductive and respiratory syndrome (PRRS) is an acute, highly contagious disease caused by infection with PRRSV, characterized by respiratory disease at all stages of gestation and reproductive failure in sows. The primary manifestations include abortion, mummification, and stillbirth in sows, respiratory disease in piglets, and extremely high mortality.
[0003] Porcine circovirus (PCV) is a single-stranded, circular, non-enveloped DNA virus. It is the smallest known mammalian virus capable of autonomous replication and belongs to the genus Circovirus in the family Circoviridae. Porcine circovirus disease (PCVD) is a general term for a series of symptoms such as organ dysfunction or reproductive disorders caused by porcine circovirus. PCV often co-infects with other porcine pathogens, aggravating the symptoms of PCVD and causing immeasurable economic losses to the pig industry in various countries. PCV has a high genetic variability and is currently divided into four genotypes: PCV1, PCV2, PCV3, and PCV4. Currently, the prevalent strains of PCV in my country are mostly PCV2 and PCV3.
[0004] The main target organs infected by the three viruses PRRSV, PCV2 and PCV3 are reproductive organs, causing diseases related to reproductive disorders. A one-time test for the presence of the three viruses in fetal samples is of great significance for clinical diagnosis. Summary of the Invention
[0005] In order to overcome the deficiencies and shortcomings of the prior art, the primary purpose of the present invention is to provide a fluorescent quantitative PCR primer probe set for detecting pathogens related to porcine reproductive diseases. The primer probe set can detect three porcine reproductive disease-related pathogens at one time, specifically: porcine reproductive and respiratory syndrome virus (PRRSV), circovirus type 2 (PCV2) and circovirus type 3 (PCV3).
[0006] Another object of the present invention is to provide a fluorescent quantitative PCR kit for detecting pathogens related to porcine reproductive disorders.
[0007] Another object of the present invention is to provide applications of the above primer probe set and kit.
[0008] The purpose of the present invention is achieved through the following technical solutions:
[0009] A fluorescent quantitative PCR primer and probe set for detecting pathogens related to porcine reproductive disorders, comprising primer and probe combinations for detecting PRRSV, PCV2, and PCV3; wherein:
[0010] The primer and probe combination used to detect PRRSV is PRRSV-QF, PRRSV-QR and PRRSV-P, and their nucleotide sequences are shown below:
[0011] PRRSV-QF: CAGAGTACAAACAAGGTC;
[0012] PRRSV-QR:CTGGAGGTGAATGAATTCTC;
[0013] PRRSV-P:ROX-CAGTAGTCGCTCTCCTCTGG-BHQ1;
[0014] The primer and probe combinations used to detect PCV2 are PCV2-QF, PCV2-QR, and PCV2-P, and their nucleotide sequences are shown below:
[0015] PCV2-QF: GGCAACTTACTGATAGAATG;
[0016] PCV2-QR:CTCTCCAACAAGGTACTC;
[0017] PCV2-P: HEX-TCTCAAGGACAACGGAGTGACC-BHQ2;
[0018] The primer and probe combination used to detect PCV3 is PCV3-QF, PCV3-QR, and PCV3-P, and their nucleotide sequences are shown below:
[0019] PCV3-QF:ACCCTCAGAATAACAAG;
[0020] PCV3-QR: GAGTGTAACTTTCATCTTTAGTA;
[0021] PCV3-P: FAM-CACGCCAACCACTTCATTACC-BHQ1;
[0022] Application of the fluorescent quantitative PCR primer probe set in the preparation of a product for detecting pathogens related to porcine reproductive disorders;
[0023] The pathogens related to porcine reproductive disorders are porcine reproductive and respiratory syndrome virus (PRRSV), circovirus type 2 (PCV2) and circovirus type 3 (PCV3);
[0024] A fluorescent quantitative PCR kit for detecting pathogens related to porcine reproductive disorders, comprising the above-mentioned fluorescent quantitative PCR primer probe set;
[0025] Preferably, the fluorescent quantitative PCR kit further comprises 2×Premix Ex Taq TM (Probe qPCR);
[0026] Use of the fluorescent quantitative PCR primer probe set or kit in the preparation of a product for detecting pathogens related to porcine reproductive disorders;
[0027] A method for detecting pathogens related to porcine reproductive disorders, comprising the following steps:
[0028] (1) extracting nucleic acid from the sample to be tested;
[0029] (2) using the nucleic acid obtained in step (1) as a template, and performing a triple TaqMan fluorescent quantitative PCR reaction using the above-mentioned fluorescent quantitative PCR primer probe set or the fluorescent quantitative PCR primer probe set in the kit;
[0030] Preferably, the detection system of the triple TaqMan fluorescent quantitative PCR reaction is as follows:
[0031] 2×Premix Ex Taq TM (Probe qPCR) 10 μl, 10 μM PRRSV-QF 0.6 μl, 10 μM PRRSV-QR 0.6 μl, 10 μM PCV2-QF 0.4 μl, 10 μM PCV2-QR 0.4 μl, 10 μM PCV3-QF 0.6 μl, 10 μM PCV3-QR 0.6 μl, 10 μM PRRSV-P 0.8 μl, 10 μM PCV2-P 0.8 μl, 10 μM PCV3-P 0.6 μl, nucleic acid 2 μl, sterile water 2.6 μl, total 20 μl.
[0032] Preferably, the reaction conditions of the triple TaqMan fluorescent quantitative PCR reaction are:
[0033] 95℃30s; 95℃5s, 54℃34s, 40 cycles;
[0034] The pathogens related to porcine reproductive disorders are porcine reproductive and respiratory syndrome virus (PRRSV), circovirus type 2 (PCV2) and circovirus type 3 (PCV3);
[0035] The application or method does not include the purpose of treating or diagnosing a disease;
[0036] Compared with the prior art, the present invention has the following beneficial effects:
[0037] The present invention discloses a fluorescent quantitative PCR kit that can detect three pathogens related to porcine reproductive disorders at one time. The method established by the present invention has good versatility and can detect all known sequences of PRRSV, PCV2 and PCV3 strains included in GenBank. Sensitivity test results show that the minimum detection limit of PRRSV, PCV2 and PCV3 standard plasmids using the kit of the present invention is 10 copies / μL. The invention provides a new technical means for detecting porcine reproductive and respiratory syndrome virus, circovirus type 2 and circovirus type 3. BRIEF DESCRIPTION OF THE DRAWINGS
[0038] Figure 1 The following are the results of PCR identification of plasmid standard solutions; a: PCR identification of PRRSV ORF6 plasmid standard solution, M: DL2000 DNA Marker, N: negative control, 1-4: different PRRSV ORF6 single colony PCR samples; b: PCR identification of PCV2 ORF1 plasmid standard solution, M: DL1000 DNA Marker, 1-4: different PCV2 ORF1 single colony PCR samples, N: negative control; c: PCR identification of PCV3 ORF2 plasmid standard solution, M: DL2000 DNA Marker, N: negative control, 1-4: different PCV3 ORF2 single colony PCR samples.
[0039] Figure 2 This is a graph of the optimized amplification curves for single-plex TaqMan fluorescent quantitative PCR primers and probe concentrations; among them, a: the amplification curves when the concentrations of the three primers for PRRSV, PCV2 and PCV3 are set to 0.1μM, 0.2μM, 0.3μM and 0.4μM, respectively; the concentrations of the three probes are set to 0.2μM, 0.3μM, 0.4μM and 0.5μM, respectively; b: the amplification curves when the optimal primer and probe concentrations for PRRSV, PCV2 and PCV3 are selected.
[0040] Figure 3The figure shows the amplification curves of the triple qPCR detection method when the annealing temperature is optimized. a) The amplification curves are obtained when the annealing temperatures are 52°C, 54°C, 56°C, 58°C, 60°C, and 62°C. b) The amplification curve is obtained when the optimal temperature is 54°C.
[0041] Figure 4 This is the standard curve of the triple TaqMan fluorescence quantitative PCR detection method.
[0042] Figure 5 This is a specific amplification curve diagram of the triple TaqMan fluorescence quantitative PCR detection method. The numbers in the figure represent the different templates added, 1: mixed template of PRRSV-2, PCV2 and PCV3, 2: PRRSV-2, 3: PCV2, 4: PCV3, and 5 to 14 are CSFV, JEV, PPV, PEDV, TGEV, PDCoV, ASFV, PRV, SVV and ddH2O, respectively.
[0043] Figure 6 The following is an analysis of the plasmid sensitivity results of the triple TaqMan fluorescence quantitative PCR detection method; a: PRRSV, PCV2, and PCV3 triple qPCR detection results of plasmid sensitivity; b: PCV2 plasmid sensitivity test results, 1 to 8 are the PCV2 plasmid concentration dilution ratios of 1×10 8 ~1×10 1 copies / μL, 9: 1×10 0 copies / μL, 10: negative control; c: PCV3 plasmid sensitivity test results, 1 to 8 are PCV3 plasmid concentrations diluted to 1×10 8 ~1×10 1 copies / μL, 9: 1×10 0 copies / μL, 10: negative control; d: PRRSV plasmid sensitivity test results, 1 to 8 are PRRSV plasmid concentrations diluted to 1×10 8 ~1×10 1 copies / μL, 9: 1×10 0 copies / μL, 10: negative control. DETAILED DESCRIPTION
[0044] The present invention will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the present invention are not limited thereto.
[0045] Example 1 Establishment of a Fluorescence Quantitative PCR Method for Detecting Three Pig Reproductive Disease-Related Pathogens at One Time
[0046] 1 Materials and Methods
[0047] 1.1 Source of the strain
[0048] The PRRSV (GenBank: JN654459.1), PCV2 (GenBank: MZ995484.1), and PCV3 (GenBank: MF405272.1) strains used for method establishment were all stored in our laboratory.
[0049] 1.2 Main reagents and instruments
[0050] Escherichia coli DH5α, pMD19-T vector, Takara Taq TM Enzyme, Premix Ex Taq TM (Probe qPCR) and DNA Marker DL2000 were purchased from TaKaRa; nucleic acid extraction kits (Viral RNA Kit, Viral DNA Kit), agarose gel DNA purification and recovery kit, and common plasmid mini-extraction kit were all purchased from Omega Bio-Tek; fluorescence quantitative PCR instrument was purchased from Bio-Rad; and UV spectrophotometer was purchased from Eppendorf.
[0051] 1.3 PRRSV, PCV2, and PCV3 nucleic acid extraction
[0052] Viral nucleic acids were extracted from Marc-145 cells inoculated with PRRSV (GenBank: JN654459.1) and PK-15 cells inoculated with PCV2 (GenBank: MZ995484.1) and PCV3 (GenBank: MF405272.1) using the following methods:
[0053] (1) Obtaining PRRSV cDNA: After harvesting the cells, centrifuge at 4°C at maximum speed for 10 min, aliquot the supernatant according to the number, and store at -80°C. Extract PRRSV RNA from the cell sample supernatant using the Omega Viral RNA Kit (R6872-02). Reverse transcribe the extracted RNA using the following system to obtain PRRSV cDNA: 1.0 μg RNA; 4.0 μL 5× MMV Buffer; 0.4 μL dNTP Mixture; 1.0 μL Random Primer; 0.5 μL RNase Inhibitor; 1.0 μL M-MLV; and add DEPC water to 20 μL. Reaction procedure: 42°C water bath for 1 h; 75°C water bath for 15 min.
[0054] (2) Obtaining DNA of PCV2 and PCV3 strains: PCV2 and PCV3 DNA were extracted from the supernatant of cell samples using the Omega Viral DNA Kit (D3892-02) according to the manufacturer's instructions.
[0055] All products were stored at -80°C until use.
[0056] 1.4 Preparation of positive plasmid standards
[0057] Based on the genome sequences of PRRSV (GenBank: JN654459.1), PCV2 (GenBank: MZ995484.1), and PCV3 (MF405272.1), standard primers (Table 1) were designed. The nucleic acids of PRRSV, PCV2, and PCV3 strains obtained in step 1.3 were used as templates to amplify the target fragments using the standard primers. PCR amplification was performed using the following system: Takara Taq TM 0.25μL; 5μL 10× PCR Buffer; 4μL dNTP Mixture; 1μL upstream primer (10μM); 1μL downstream primer (10μM); 1μL template genome; ddH2O to 50μL; reaction conditions were set according to the manufacturer's instructions: 98°C initial denaturation for 2 minutes; 32 cycles of denaturation at 98°C for 10 seconds, denaturation at 55°C for 30 seconds, and extension at 72°C for 1 minute; final extension at 72°C for 5 minutes. Amplified products were purified using an agarose gel DNA purification kit and ligated into the pMD19-T cloning vector according to conventional methods. The ligated products were then transformed into competent E. coli DH5α cells. The transformed cells were spread on LB agar plates containing ampicillin resistance and cultured in a 37°C incubator for 12 to 16 hours. After selecting single clones and incubating them on LB culture plates containing ampicillin resistance at 37°C and 180r / min for 12 hours, the bacterial solution was used as a template and PCR identification of the bacterial solution was performed using universal primers M13-R / F. The bacterial solution with positive identification results was sequenced. The sequencing results were compared using SnapGene software, and the bacterial solution with completely correct sequence was selected to preserve the strain. The recombinant plasmid was extracted using a common plasmid mini-extraction kit, and the plasmid concentration was determined using an ultraviolet spectrophotometer. The plasmid copy number was calculated according to the following formula: DNA copy number (copies / μL) = plasmid concentration (ng / μL) × 6.02 × 1023 × 10 -9 / (660×plasmid length (bp)), and diluted with ddH2O to a concentration of 1×10 9copies / μL, and the positive plasmid standards were obtained, marked as pMD19-T-PRRSV, pMD19-T-PCV2 and pMD19-T-PCV3, and stored at -20°C for future use.
[0058] Table 1 Primer sequences for amplification of PRRSV, PCV2 and PCV3 target genes
[0059]
[0060] 1.5 Design and synthesis of primers and probes
[0061] Conserved regions of the ORF6 gene from multiple lineages of PRRSV genotypes reference strains included in GenBank, namely NADC30 (Genbank: JN654459), IA / 2014 / NADC34 (Genbank: MF326985), QYYZ (Genbank: JQ308798), VR2332 (Genbank: EF536003), CH-1a (Genbank: AY032626), JXA1 (Genbank: EF112445), and Lelystad virus (Genbank: M96262), were selected. Primers and probes for PRRSV were designed using Primer Premier 5.0 and BeaconDesigner 7. The PRRSV TaqMan probes were labeled with a ROX fluorescent reporter at the 5' end and a BHQ1 fluorescent quencher at the 3' end.
[0062] The conserved regions of the ORF1 genes of the reference strains of various PCV2 genotypes included in GenBank, namely pmwsPCV (Genbank: AF027217.1), S2 (Genbank: AY288133.1), DK1990PMWSfree (Genbank: EU148505.1), TJ (Genbank: AY181946.1), MEX / 41238 / 2014 (Genbank: KT795287.1), YN-8 (Genbank: HM776452.1), 10BJ-2 (Genbank: HQ395060.1) and 10QH (Genbank: HQ395058.1), were selected. Primer Premier 5.0 and Beacon Designer 7 were used to design primers and probes for PCV2. The 5' end of the PCV2 TaqMan probe was labeled with a HEX fluorescent reporter group, and the 3' end was labeled with a BHQ2 fluorescent quencher group.
[0063] Conserved regions of the ORF2 gene of PCV3 reference strains of various genotypes included in GenBank were selected, namely PCV3-US / MO2015 (Genbank: KX778720), PCV3 / CN / Fujian-5 / 2016 (Genbank: KY075986), PCV3-Chian / GX2016-2 (Genbank: MF155642), and PCV3 / CN / Guangdong-HZ4 / 2015 (Genbank: MF589103). PCV3 primers and probes were designed using Primer Premier 5.0 and Beacon Designer 7. The PCV3 TaqMan probe was labeled with a FAM fluorescent reporter at the 5' end and a BHQ1 fluorescent quencher at the 3' end.
[0064] In summary, the designed primers and probes are shown in Table 2 , and their specificity was analyzed by NCBI BLAST and then synthesized by Sangon.
[0065] Table 2 Fluorescence quantitative PCR primer or probe sequences
[0066] Primer or probe name Primer or probe sequence (5'-3') Primer PRRSV-QF CAGAGTACAAACAAGGTC; Primer PRRSV-QR CTGGAGGTGATGAATCTC; Probe PRRSV-P ROX-CAGTAGTCGCTCTCCTCTGG-BHQ1; Primer PCV2-QF GGCAACTTACTGATAGAATG; Primer PCV2-QR CTCTCCAACAAGGTACTC; Probe PCV2-P HEX-TCTCAAGGACAACGGAGTGACC-BHQ2; Primer PCV3-QF ACCCCTCAGAATAACAAG; Primer PCV3-QR GAGTGTAACTTTCATCTTTAGTA; Probe PCV3-P FAM-CACGCCAACCACTTCATTACC-BHQ1;
[0067] 1.6 Optimization of primer and probe concentrations
[0068] First, clean the clean bench by spraying it with 75% alcohol and wiping it clean after 5 minutes. Place the fluorescent quantitative PCR reagents, pipette, tip box, 96-well plate, PCR tubes, and other laboratory equipment in the clean bench. Spray it with nucleic acid cleaning solution, turn on the clean bench fan, and let it sit for 10 minutes to remove nucleic acid contamination.
[0069] The concentrations of PRRSV-QF / R, PCV2-QF / R and PCV3-QF / R primers were diluted to 0.1 μmol / L, 0.2 μmol / L, 0.3 μmol / L and 0.4 μmol / L, respectively. The concentrations of PRRSV-P, PCV2-P and PCV3-P probes were diluted to 0.2 μmol / L, 0.3 μmol / L, 0.4 μmol / L and 0.5 μmol / L, respectively. At the same time, the corresponding three positive plasmid standards were diluted to 1×10 6 Copies / μL were used as templates, and qPCR reactions were performed using the matrix method. The experiment was repeated 3 times for each group, using the following reaction system: 2×PremixEx Taq TM(Probe qPCR) 10.0 μL, upstream primer (10 μM) 0.2-0.8 μL, downstream primer (10 μM) 0.2-0.8 μL, probe 0.4-1.0 μL, template 1 μL, ddH2O to 20 μL, reaction conditions: 95°C for 30 s, 95°C for 5 s, 54°C for 34 s, 40 cycles. Optimal primer and probe concentrations for the three single-plex TaqMan fluorescent quantitative PCR reactions were determined based on Cq values, fluorescence intensities, and curve morphology.
[0070] 1.7 Optimization of annealing temperature
[0071] The concentration was 1×10 6 A mixed positive plasmid standard containing 10 copies / μL of pMD19-T-PRRSV, pMD19-T-PCV2, and pMD19-T-PCV3 was used as a template. Using the optimal primer and probe concentrations obtained above, triple TaqMan fluorescent quantitative PCR reactions were performed at annealing temperatures of 52°C, 54°C, 56°C, 58°C, 60°C, and 62°C. The optimal annealing temperature for the triple TaqMan fluorescent quantitative PCR reaction was determined based on Cq size, fluorescence intensity, and curve morphology.
[0072] 1.8 Determination of triple TaqMan fluorescence quantitative PCR reaction system
[0073] Based on the above test results, the final triple TaqMan fluorescence quantitative PCR reaction system was determined.
[0074] 1.9 Establishment of triple TaqMan fluorescence quantitative PCR standard curve
[0075] The mixed positive plasmid standards of pMD19-T-PRRSV, pMD19-T-PCV2 and pMD19-T-PCV3 were diluted 10-fold to adjust the concentration to 1×10 8 ~1×10 3 Triple TaqMan fluorescence quantitative PCR was performed using the optimized reaction system (Table 4). Three replicates were used for each concentration, and a negative control was included. A standard curve for the triple fluorescence quantitative PCR assay was constructed, with the logarithm of plasmid concentration on the X-axis and the Cq value on the Y-axis.
[0076] 2 Experimental results
[0077] 2.1 Preparation of positive standard plasmid template
[0078] The constructed recombinant plasmid was amplified by PCR using universal primers M13-R / F, and target fragments of approximately 600 bp, 500 bp, and 600 bp were obtained, respectively, which were consistent with expectations. Sequencing results further confirmed that the recombinant plasmids containing the PRRSV ORF6 gene, PCV2 ORF1 gene, and PCV3 ORF2 gene were successfully constructed ( Figure 1 ).
[0079] 2.2 Optimization of triple TaqMan fluorescence quantitative PCR reaction conditions
[0080] By optimizing the conditions of triple real-time fluorescence quantitative PCR for PRRSV, PCV2, and PCV3, the final concentrations of PRRSV-qF / qR were 0.3 μM, RRSV-P was 0.4 μM, PCV2-qF / qR was 0.2 μM, PCV2-P was 0.4 μM, and PCV3-qF / qR / P was 0.3 μM. When the annealing temperature was 54°C, the detection signal of the same test sample was the strongest and the Ct value was the smallest ( Figure 2 、 Figure 3 ).
[0081] Table 3 Optimization of annealing temperature for triplex qPCR detection method
[0082]
[0083] 2.5 Determination of triple TaqMan fluorescence quantitative PCR reaction system
[0084] Based on the above experimental results, the reaction system for triple TaqMan fluorescent quantitative PCR for PRRSV and PCV2 / PCV3 was determined. The reaction system and reaction procedure with a total volume of 20 μL are shown in Table 4.
[0085] Table 4 Triple TaqMan fluorescence quantitative PCR reaction system
[0086]
[0087] 2.6 Establishment of triple TaqMan fluorescence quantitative PCR standard curve
[0088] Dilute the mixed positive plasmid standards of PRRSV, PCV2 and PCV3 in a 10-fold ratio to adjust the concentration to 1×10 8 copies / μL~1×10 3 copies / μL, and three replicates were performed using this as a template, and a negative control was set up to establish a standard curve for the triple qPCR reaction of PRRSV, PCV2, and PCV3 ( Figure 4The results showed that the regression equations for the triple qPCR reactions for detecting PRRSV, PCV2, and PCV3 all had good linear relationships, with the logarithm of plasmid concentration as the X-axis and the Cq value as the Y-axis. The qPCR reaction regression equation for PRRSV detection was: y = -3.4055x + 40.016, with a slope k of -3.4055 and a correlation coefficient R² of 0.9957. The calculated amplification efficiency (E) was 96.3%. The qPCR reaction regression equation for PCV2 detection was: y = -3.2425x + 37.634, with a slope k of -3.2425 and a correlation coefficient R² of 0.9936. The calculated amplification efficiency (E) was 103.2%. The qPCR reaction regression equation for PCV3 detection was: y = -3.2501x + 38.619, with a slope k of -3.2501 and a correlation coefficient R² of 0.9981. The calculated amplification efficiency (E) was 102.8%. The results showed that the correlation coefficients were close to 1, and the amplification efficiencies ranged from 90% to 110%. These results indicate that the triple qPCR method for PRRSV, PCV2 and PCV3 has good correlation and stable and reliable amplification efficiency.
[0089] Example 2 Specificity, sensitivity and repeatability test of triple TaqMan fluorescent quantitative PCR
[0090] 1. Methods
[0091] 1.1 Specificity test
[0092] To evaluate the specificity of this method, nucleic acids from several common swine pathogens, including PRRSV (GenBank: JN654459.1), PCV2 (GenBank: MZ995484.1), PCV3 (GenBank: MF405272.1), classical swine fever virus (CSFV, GenBank: AY805221), Japanese encephalitis virus (JEV, GenBank: MH258849.1), porcine parvovirus (PPV), porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus (PDCoV), African swine fever virus (ASFV), pseudorabies virus (PRV), and Senecavirus (SVV), were used as templates in a triple qPCR reaction using PRRSV, PCV2, and PCV3 assays. PPV, PEDV, TGEV, PDCoV, ASFV, PRV, and SVV were all isolated from the corresponding diseased pig samples.
[0093] 1.2 Sensitivity test
[0094] In order to evaluate the plasmid sensitivity, the mixed positive plasmid standard of PRRSV, PCV2 and PCV3 was diluted 10 times to adjust the concentration to 1×108 copies / μL~1×10 0 100 copies / μL was used as template, and three replicates were set up at the same time. ddH2O was used as control. The detection limit of the detection method established in this study for the standard plasmid was analyzed.
[0095] 1.3 Repeatability test
[0096] In order to evaluate the stability of the experiment, the mixed positive plasmid standards of PRRSV, PCV2 and PCV3 were diluted 10 times to adjust the concentration to 1×10 4 copies / μL~1×10 7 A stability test was performed using triple-plex TaqMan fluorescent quantitative PCR with 1000 copies / μL of dHO as a template and three replicates within the same batch. The coefficient of variation (CV) was calculated to assess the intra-assay variability of the assay developed in this study.
[0097] Stability testing was performed three times within each batch using the four concentrations of the mixed plasmid standard template. Three replicates were selected from three different batches at one-week intervals. Similarly, the coefficient of variation (CV) between the control groups was calculated to assess the intergroup variability of the assay developed in this study.
[0098] 2. Experimental Results
[0099] 2.1 Triple TaqMan fluorescent quantitative PCR specificity detection
[0100] The triple qPCR method for PRRSV, PCV2, and PCV3 established in this study was used to amplify the nucleic acids of common swine pathogens using PRRSV-2, PCV2, and PCV3 single and mixed templates as positive controls and ddH2O as a negative control. Figure 5 As shown, the triple TaqMan fluorescent quantitative PCR reaction using PRRSV, PCV2, and PCV3 nucleic acids as templates produced corresponding fluorescence amplification curves, indicating a positive result. However, the triple qPCR reactions using other viral nucleic acids and ddH₂O as templates showed no fluorescence amplification curves, indicating a negative result. In summary, the triple qPCR method for PRRSV, PCV2, and PCV3 established in this invention has good specificity.
[0101] 2.8 Detection of plasmid sensitivity by triple TaqMan fluorescent quantitative PCR
[0102] The mixed plasmid standard of PRRSV, PCV2 and PCV3 was diluted 10-fold to adjust the concentration to 1×10 8copies / μL~1×10 0 Copies / μL was used as template, 3 replicates were set up, ddH2O was used as negative control, and triple TaqMan fluorescence quantitative PCR reaction of PRRSV, PCV2 and PCV3 was performed to determine the sensitivity of the detection method established in this study. Figure 6 The sensitivity of the triple TaqMan fluorescence quantitative PCR method for PRRSV, PCV2 and PCV3 established in this study to PRRSV ORF6 plasmid, PCV2 ORF1 plasmid and PCV3 ORF2 plasmid reached 1×10 1 copies / μL.
[0103] 2.9 Repeatability testing of triple TaqMan fluorescence quantitative PCR
[0104] The results are shown in Table 3. The above experimental results show that the coefficient of variation of the intra-batch repeatability and inter-batch repeatability tests are both less than 2%, indicating that the method established in this experiment has good repeatability and stability.
[0105] Table 5 Intra-group and inter-group repeatability test of triple TaqMan fluorescence quantitative PCR detection method
[0106]
[0107] Example 3
[0108] Nucleic acid was re-extracted from 32 PRRSV-positive samples, 33 PCV2-positive samples, and 14 PCV3-positive samples collected and stored in the laboratory and identified by conventional PCR. Five PRRSV cDNAs were mixed with five PCV2 DNAs to simulate a mixed infection of PRRSV and PCV2; eight PCV2 DNAs were mixed with eight PCV3 DNAs to simulate a mixed infection of PCV2 and PCV3; and two PRRSV cDNAs, two PCV2 DNAs, and two PCV3 DNAs were mixed to simulate a triple mixed infection. A total of 62 positive samples (25 samples with single PRRSV infection, 18 samples with single PCV2 infection, 4 samples with single PCV3 infection, 5 samples with co-infection of PRRSV and PCV2, 8 samples with co-infection of PCV2 and PCV3, and 2 samples with triple infection of PRRSV, PCV2 and PCV3) and 6 PRRSV, PCV2 and PCV3 negative samples were selected and tested using the PRRSV, PCV2 and PCV3 triple qPCR method to evaluate the clinical applicability of this method.
[0109] At the same time, the primers and probes in the national standard for the fluorescent RT-PCR detection of porcine reproductive and respiratory syndrome virus (GB / T 35912-2018) and the fluorescent PCR detection of porcine circovirus type 2 (GB / T 35901-2018) were synthesized (Table 6), and 68 samples were tested and compared using the corresponding determination methods in the national standard.
[0110] The triple TaqMan real-time fluorescence quantitative PCR detection method for PRRSV, PCV2, and PCV3 established in the present invention was compared with the national standard qPCR method for PRRSV and PCV2. The results are shown in Table 7. Preliminary clinical application / validation of the method on clinical simulation samples showed that the method has clinical application value.
[0111] Table 6 Primer and probe sequences for PRRSV and PCV2 in national standards
[0112]
[0113] Table 7 Comparison of the detection results of clinical samples by triple TaqMan fluorescence quantitative PCR method and other detection methods
[0114]
[0115] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.
Claims
1. A fluorescent quantitative PCR primer probe set for detecting pathogens related to porcine reproductive disorders, characterized in that Contains primer and probe combinations for detecting PRRSV, PCV2, and PCV3; wherein: The primer and probe combination used to detect PRRSV is PRRSV-QF, PRRSV-QR and PRRSV-P, and their nucleotide sequences are shown below: PRRSV-QF: CAGAGTACAAACAAGGTC; PRRSV-QR:CTGGAGGTGAATGAATTCTC; PRRSV-P:ROX-CAGTAGTCGCTCTCCTCTGG-BHQ1; The primer and probe combinations used to detect PCV2 are PCV2-QF, PCV2-QR, and PCV2-P, and their nucleotide sequences are shown below: PCV2-QF: GGCAACTTACTGATAGAATG; PCV2-QR:CTCTCCAACAAGGTACTC; PCV2-P: HEX-TCTCAAGGACAACGGAGTGACC-BHQ2; The primer and probe combination used to detect PCV3 is PCV3-QF, PCV3-QR, and PCV3-P, and their nucleotide sequences are shown below: PCV3-QF:ACCCTCAGAATAACAAG; PCV3-QR: GAGTGTAACTTTCATCTTTAGTA; PCV3-P: FAM-CACGCCAACCACTTCATTACC-BHQ1.
2. Use of the fluorescent quantitative PCR primer probe set according to claim 1 in the preparation of a product for detecting pathogens related to porcine reproductive disorders.
3. The use according to claim 2, characterized in that: The pathogens related to porcine reproductive disorder diseases are porcine reproductive and respiratory syndrome virus, circovirus type 2 and circovirus type 3.
4. A fluorescent quantitative PCR kit for detecting pathogens related to porcine reproductive disorders, characterized in that Comprising the fluorescent quantitative PCR primer probe set according to claim 1.
5. The kit according to claim 4, wherein: The fluorescent quantitative PCR kit also contains 2×Premix Ex Taq™.
6. Use of the kit according to claim 4 or 5 in the preparation of a product for detecting pathogens related to porcine reproductive disorders.
7. A method for detecting pathogens related to pig reproductive disorders, characterized in that The following steps are included: (1) Extracting nucleic acid from the sample to be tested; (2) using the nucleic acid obtained in step (1) as a template, and performing a triple TaqMan fluorescent quantitative PCR reaction using the fluorescent quantitative PCR primer probe set of claim 1 or the fluorescent quantitative PCR primer probe set in the kit of claim 4 or 5; The method described does not include the purpose of treating or diagnosing diseases.
8. The method for detecting pathogens related to porcine reproductive disorders according to claim 7, characterized in that: The detection system of the triple TaqMan fluorescent quantitative PCR reaction is as follows: 2×Premix Ex Taq™ 10μl, 10 μM PRRSV-QF 0.6μl, 10 μM PRRSV-QR 0.6μl, 10 μM PCV2-QF 0.4μl, 10 μM PCV2-QR 0.4μl, 10 μM PCV3-QF 0.6μl, 10 μM PCV3-QR 0.6μl, 10 μM PRRSV-P 0.8μl, 10 μM PCV2-P 0.8μl, 10 μM PCV3-P 0.6μl, nucleic acid 2μl, water 2.6μl.
9. The method for detecting pathogens related to porcine reproductive disorders according to claim 7, characterized in that: The reaction conditions of the triple TaqMan fluorescent quantitative PCR reaction are: 95℃ for 30 s; 95℃ for 5 s, 54℃ for 34 s, 40 cycles.
10. The method for detecting pathogens related to porcine reproductive disorders according to claim 7, characterized in that: The pathogens related to porcine reproductive disorder diseases are porcine reproductive and respiratory syndrome virus, circovirus type 2 and circovirus type 3.
Citation Information
Patent Citations
Kit for fluorescent quantitative PCR detection of viruses associated with porcine respiratory and reproductive disorder diseases
CN104263852A
Kit for fluorescence quantitative PCR (polymerase chain reaction) detection of main porcine viruses
CN104263853A