Three soft rot pathogen-specific detection genes and their application in detecting taro soft rot
By designing specific primer sets DK600-F/DK600-R, PA302-F/PA302-R, and PC502-F/PC502-R, the accuracy and speed issues of detecting taro soft rot pathogens were resolved, enabling fast, simple, and accurate detection, which is suitable for early monitoring and prevention of taro soft rot.
Patent Information
- Application Number
- CN202410470865.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-18
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2044-04-18
AI Technical Summary
Existing technologies make it difficult to quickly and accurately detect the main pathogens of taro soft rot, including Dadicea fangzhongensis, Pectobacterium annularis, and Pectobacterium taro, resulting in missed detections and false detections, affecting the development of the taro industry.
Specific primer sets DK600-F/DK600-R, PA302-F/PA302-R, and PC502-F/PC502-R were designed based on PCR technology to specifically detect and differentiate these three pathogens, achieving fast, simple, and accurate detection.
It achieves rapid and accurate detection of taro soft rot pathogens, avoids missed detection, shortens detection time, and improves detection sensitivity and specificity. It is suitable for early monitoring and prevention and control of taro soft rot.
Smart Images

Figure CN118147335B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology and more specifically relates to a gene fragment of a taro soft rot pathogen and its application in taro soft rot detection, as well as a taro soft rot pathogen-specific detection method established based on the gene fragment. Background Art
[0002] Soft rot is a complex, worldwide plant disease caused by a wide variety of pathogens, significantly impacting agricultural production worldwide. Because the dominant pathogens that cause soft rot vary across regions, the same plant may be infected by multiple pathogens, and the primary pathogens often vary from plant to plant. This makes comprehensive and accurate detection of soft rot difficult.
[0003] For example, the problem of taro soft rot has become increasingly severe year by year, causing significant economic losses. Taro is a dual-purpose crop, rich in nutrients, unique in flavor, and of high medicinal value, making it a nutritious food suitable for all ages. my country has a large-scale taro cultivation, with an annual output of 1.8 million tons of fresh taro. Its cultivation and processing generate approximately 810,000 tons of fodder resources. Its main planting areas include Fujian, Guangdong, Guangxi, and Hainan. Lechang County, Shaoguan City, Guangdong Province, has a long history of taro cultivation, spanning over 350 years. The taro industry has become a hallmark of Shaoguan City and a pillar of the local economy. In recent years, taro soft rot has posed a significant challenge to the development of the local taro industry. Shaoguan City has over 20,000 mu (approximately 16,000 hectares) of taro cultivation, and the incidence of taro soft rot ranges from 10% to 30%, with severe cases reaching around 60%. This results in annual economic losses of 105 million yuan, making it one of the main factors restricting the development of the taro industry in Shaoguan.
[0004] Our team's investigation and research in Shaoguan City revealed that the primary pathogens of taro soft rot in the area are Dickea fangzhongdai, Pectobacterium aroidearum, and Pectobacterium colocasium. These pathogens primarily secrete pectate lyases to degrade pectin in the middle lamella and primary wall of plant cells, impregnating plant tissues and causing softening and decay, resulting in significant economic losses (Isolation and Genome Analysis of Pectobacterium colocasium sp.nov. and Pectobacterium aroidearum, Two New Pathogens of Taro. Front Plant Sci. Zhou et al., 2022 Apr 26; 13:852750.). Therefore, missing any of these three pathogens in taro soft rot detection could result in missed disease detection.
[0005] In addition, the three pathogens Dickeya fangzhongdai, Pectobacterium circumvallate, and Pectobacterium colocasium, in addition to causing taro soft rot, have also been reported to cause a variety of plant diseases. For example, Dickeya fangzhongdai is a common soft rot pathogen that infects woody plants and also causes water rust on pear trees; Pectobacterium circumvallate can also cause soft rot in vegetables such as Chinese cabbage and konjac. All of these pathogens can cause a variety of plant diseases.
[0006] However, there is currently no better detection technology for the above-mentioned pathogens, especially technology for simultaneous detection of three pathogens. Traditional pathogen isolation and identification technology is complex and time-consuming, and is highly dependent on the operator's skills and prone to false detection and missed detection.
[0007] Therefore, establishing a rapid, accurate, and simple monitoring technology that can target these three pathogens, especially simultaneous detection technology, is crucial for monitoring and preventing related diseases. Preventing the spread of taro soft rot pathogens and controlling taro soft rot are crucial for the development of the taro industry in my country, especially in northern Guangdong. Summary of the Invention
[0008] In response to the problems of the above-mentioned prior art, the present invention analyzes and studies the genetic information of three pathogens, Dickeyafangzhongdai, Pectobacterium aroidearum, and Pectobacterium colocasium, and obtains three specific gene fragments for detecting and identifying the three pathogens. Based on this, primers and detection products that can specifically detect three different taro soft rot pathogens are developed. The primers and detection products can not only detect the three pathogens separately, but more importantly, can also detect them simultaneously, thus avoiding missed detection of taro soft rot. This type of detection technology can be implemented by molecular technologies such as PCR, which is fast, simple, accurate, and very easy to promote and apply.
[0009] The first object of the present invention is to provide a specific gene fragment capable of detecting and identifying Dickeyafangzhongdai.
[0010] The second object of the present invention is to provide a specific gene fragment capable of detecting and identifying Pectobacterium circulans.
[0011] The third object of the present invention is to provide a specific gene fragment capable of detecting and identifying Pectobacterium colocasium.
[0012] The fourth object of the present invention is to provide the application of the above gene fragment in the detection of corresponding pathogens.
[0013] The fifth object of the present invention is to provide a specific primer set for detecting the above three pathogens and detecting taro soft rot, as well as a detection kit and a detection method.
[0014] The above-mentioned purpose of the present invention is achieved through the following technical solutions:
[0015] The present invention compares and analyzes, screens and studies the whole genome data of three major taro soft rot pathogens in China, namely Dickea fangzhongdai, Pectobacterium aroidearum and Pectobacterium colocasium, to obtain specific gene fragments that can be used for detection and identification, design specific primers, and establish a specific PCR detection method. The method can specifically and sensitively distinguish the three pathogens from other pathogenic strains, thereby being used for early detection of the three pathogens and realizing the monitoring of diseases caused by the three pathogens, such as the monitoring of taro soft rot, and is particularly valuable for the monitoring of taro soft rot in northern Guangdong.
[0016] That is, the present invention provides the following solution:
[0017] A specific gene fragment capable of detecting and identifying Dickeya fangzhongdai, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0018] A specific gene fragment capable of detecting and identifying Pectobacterium aroidearum, the nucleotide sequence of which is shown in SEQ ID NO.2.
[0019] A specific gene fragment capable of detecting and identifying Pectobacterium colocasium has a nucleotide sequence shown as SEQ ID NO.3.
[0020] A specific gene fragment combination capable of detecting or monitoring taro soft rot pathogens, the specific gene fragment combination comprising any one or more of the above-mentioned specific gene fragments; the taro soft rot pathogens are one or more of Dickea fangzhongdai, Pectobacterium aroidearum, and Pectobacterium colocasium.
[0021] Based on this, the present invention also provides the following application solutions:
[0022] The above-mentioned specific gene fragment or the above-mentioned specific gene fragment combination is used as a detection target in the detection and identification of one or more pathogens among Dickea fangzhongdai, Pectobacterium aroidearum, and Pectobacterium colocasium.
[0023] The above-mentioned specific gene fragment or the above-mentioned specific gene fragment combination is used as a detection target in the preparation of a product capable of detecting one or more pathogens among Dickea fangzhongdai, Pectobacterium aroidearum, and Pectobacterium colocasium.
[0024] The above-mentioned specific gene fragment or the above-mentioned specific gene fragment combination is used as a detection target in monitoring taro soft rot.
[0025] The above-mentioned specific gene fragment or the above-mentioned specific gene fragment combination is used as a detection target in the preparation of a product capable of monitoring taro soft rot.
[0026] The reagent for detecting the above-mentioned specific gene fragment or the above-mentioned specific gene fragment combination is used in detecting and identifying one or more pathogens among Dickea fangzhongdai, Pectobacterium aroidearum, and Pectobacterium colocasium.
[0027] The invention relates to a reagent for detecting the above-mentioned specific gene fragment or the above-mentioned specific gene fragment combination, and its application in monitoring taro soft rot.
[0028] The invention relates to a reagent for detecting the above-mentioned specific gene fragment or the combination of the above-mentioned specific gene fragments, and its use in preparing a product for detecting one or more pathogens among Dickea fangzhongdai, Pectobacterium aroidearum and Pectobacterium colocasium.
[0029] The invention relates to a reagent for detecting the above-mentioned specific gene fragment or the above-mentioned combination of specific gene fragments, and its use in preparing products for monitoring taro soft rot.
[0030] Furthermore, the present invention provides a primer set for detecting taro soft rot pathogens or monitoring taro soft rot, including primer pairs for detecting the above-mentioned specific gene fragments or the above-mentioned specific gene fragment combinations.
[0031] As one of the preferred embodiments, the primer set is any one or several pairs of primer pairs DK600-F / DK600-R, PA302-F / PA302-R, and PC502-F / PC502-R, the nucleotide sequence of the primer pair DK600-F / DK600-R is shown in SEQ ID NOs. 4-5, the nucleotide sequence of the primer pair PA302-F / PA302-R is shown in SEQ ID NOs. 6-7, and the nucleotide sequence of the primer pair PC502-F / PC502-R is shown in SEQ ID NOs. 8-9.
[0032] Based on this, the present invention provides a kit for specifically detecting taro soft rot pathogens or monitoring taro soft rot, which contains reagents for detecting the above-mentioned specific gene fragments or the above-mentioned specific gene fragment combinations.
[0033] As one of the preferred solutions, the reagent is the above-mentioned primer set, and the primer set is any one or several pairs of primer pairs DK600-F / DK600-R, PA302-F / PA302-R, and PC502-F / PC502-R.
[0034] In addition, the present invention provides a method for specifically detecting taro soft rot pathogens or monitoring taro soft rot, wherein the above-mentioned specific gene fragments or the above-mentioned specific gene fragment combination are used as targets to detect a sample to be tested, and whether the sample to be tested contains the taro soft rot pathogens or is infected with soft rot is determined according to the results; if the test result is positive for any one target or any several targets, the sample to be tested contains the taro soft rot pathogens or is infected with soft rot; if the test results are all negative, the sample to be tested does not contain the taro soft rot pathogens or is not infected with soft rot.
[0035] Specifically, as a preferred embodiment, the method for specifically detecting taro soft rot pathogens or monitoring taro soft rot comprises taking DNA of a test sample, using the above-mentioned primer set or the above-mentioned kit to detect the test sample, and judging whether the test sample contains taro soft rot pathogens or is infected with soft rot according to the results; if the test results are any one or several positive, the test sample contains taro soft rot pathogens or is infected with soft rot; if the test results are all negative, the test sample does not contain taro soft rot pathogens or is not infected with soft rot.
[0036] In addition, as a specific optional implementation scheme, the detection is a PCR detection, and whether the sample to be tested contains the taro soft rot pathogen or is infected with soft rot is determined based on whether the PCR amplification product is positive.
[0037] Optionally, the PCR reaction system is: 12.5 μL of 2×T5 Super PCR Mix, 1 μL each of forward primer and reverse primer, 1 μL of DNA template, and 9.5 μL of double-distilled water.
[0038] Optionally, the PCR reaction program is: pre-denaturation at 98°C for 3 minutes, denaturation at 98°C for 15 seconds, annealing at 65°C for 15 seconds, extension at 72°C for 20 seconds, denaturation-annealing-extension for 30 cycles; and finally extension at 72°C for 5 minutes.
[0039] As an alternative embodiment, the PCR amplification product is determined by gel electrophoresis. If a 601 bp band appears, the sample is positive for Dickeya fangzhongdai; if a 302 bp band appears, the sample is positive for Pectobacterium aroidearum; and if a 502 bp band appears, the sample is positive for Pectobacterium colocasium. If any one or more of these three pathogens are positive, the sample is determined to be positive for taro soft rot.
[0040] The present invention has the following beneficial effects:
[0041] This study, the first to use molecular detection technology to identify taro soft rot, represents a breakthrough in molecular monitoring of the pathogen. Compared with traditional biochemical identification methods, this molecular biological method is simpler and faster to use, requiring no isolation or culture of the pathogen, significantly shortening detection time. With advancements in PCR technology, this method is expected to be further simplified and shortened.
[0042] The detection method of the present invention has strong specificity and high accuracy. The detection method of the present invention can specifically detect and differentiate three pathogens of taro soft rot, namely Dickea fangzhongdai, Pectobacterium circumarium, and Pectobacterium colocasium, thereby achieving interspecies differentiation of different taro soft rot pathogens. Specifically, after PCR amplification using specific detection primers DK600-F / DK600-R, specific detection of the taro soft rot pathogen D. fangzhongdai can be achieved; after PCR amplification using specific detection primers PA302-F / PA302-R, specific detection of the taro soft rot pathogen P. aroidearum can be achieved; and after PCR amplification using specific detection primers PC502-F / PC502-R, specific detection of the taro soft rot pathogen P. colocasium can be achieved. Testing the three at the same time can ensure that taro soft rot is not missed.
[0043] The detection method of the present invention has high sensitivity, with a detection limit of 0.05 ng / μL for the pathogen D.fangzhongdai and a detection limit of 0.005 ng / μL for the pathogens P.aroidearum and P.colocasium. It can specifically detect pathogens in the early stage of invasion, and then take corresponding measures for disease prevention and control in a timely manner.
[0044] In addition, the detection method of the present invention is flexible in application. It can detect the genetic information of the sample and can also directly use the plant tissue extract to detect whether the plant carries soft rot pathogens. It has good application prospects.
[0045] The present invention can be applied to more than just the prediction of taro soft rot and the identification of pathogens, and is of great significance for the prevention and control of related diseases such as taro soft rot, especially for the monitoring and prevention and control of southern taro soft rot caused by three pathogens at the same time; it also provides technical guidance and theoretical basis for the detection of other diseases caused by these three pathogens. BRIEF DESCRIPTION OF THE DRAWINGS
[0046] Figure 1The electrophoresis results of the specific PCR verification of the primer set DK600 (M is a 2000 bp marker, lane 1 is the DNA amplification result of strain ZXC1, lane 2 is the DNA amplification result of strain CL3, lane 3 is the DNA amplification result of strain MS2, lane 4 is the DNA amplification result of strain EC1, lane 5 is the DNA amplification result of strain 3937, lane 6 is the DNA amplification result of strain 5316, lane 7 is the DNA amplification result of strain 402, and H2O is the amplification result of water).
[0047] Figure 2 Electrophoresis results are shown for the specific PCR verification of primer set PA302 (M is a 2000 bp marker, lane 1 is the DNA amplification result of strain LJ2, lane 2 is the DNA amplification result of strain LJ1, lane 3 is the DNA amplification result of strain 0623, lane 4 is the DNA amplification result of strain 11303, lane 5 is the DNA amplification result of strain 11629, lane 6 is the DNA amplification result of strain 10813, lane 7 is the DNA amplification result of strain 17280, and H2O is the water amplification result).
[0048] Figure 3 Electrophoresis results are shown for the specific PCR verification of primer set PC502 (M is a 2000 bp marker, lane 1 is the DNA amplification result of strain LJ1, lane 2 is the DNA amplification result of strain 0623, lane 3 is the DNA amplification result of strain LJ2, lane 4 is the DNA amplification result of strain 11303, lane 5 is the DNA amplification result of strain 11629, lane 6 is the DNA amplification result of strain 10813, lane 7 is the DNA amplification result of strain 17280, and H2O is the water amplification result).
[0049] Figure 4Figure 2 shows the electrophoresis results of sensitivity PCR detection of D.fangzhongdai, P.aroidearum and P.colocasium by primer sets DK600, PA302 and PC502 respectively (Figure a shows the electrophoresis results of sensitivity PCR detection of primer set DK600, Figure b shows the electrophoresis results of sensitivity PCR detection of primer set PA302, and Figure c shows the electrophoresis results of sensitivity PCR detection of primer set PC502; M in Figures a, b and c is 2000 bp Marker, lane 1 is the amplification result of 50 ng / μL DNA, lane 2 is the amplification result of 25 ng / μL DNA, lane 3 is the amplification result of 10 ng / μL DNA, lane 4 is the amplification result of 5 ng / μL DNA, lane 5 is the amplification result of 1 ng / μL DNA, lane 6 is the amplification result of 0.1 ng / μL DNA, lane 7 is the amplification result of 0.05 ng / μL DNA, lane 8 is the amplification result of 0.01 ng / μL DNA, and lane 9 is the amplification result of 0.005 ng / μL DNA).
[0050] Figure 5 These are the electrophoresis results of PCR detection of taro tissue extracts (the upper figure of Figure a is the phenotypic image of the diseased tissue of taro inoculated with D.fangzhongdai CL3 strain, and the lower figure is the electrophoresis result of PCR detection of tissue extracts of taro inoculated with D.fangzhongdai CL3 strain using the DK600 primer group; the upper figure of Figure b is the phenotypic image of the diseased tissue of taro inoculated with P.aroidearum LJ2 strain, and the lower figure is the electrophoresis result of PCR detection of tissue extracts of taro inoculated with P.aroidearum LJ2 strain using the PA302 primer group; the upper figure of Figure c is the phenotypic image of the diseased tissue of taro inoculated with P.colocasium LJ1 strain, and the lower figure is the electrophoresis result of PCR detection of tissue extracts of taro inoculated with P.colocasium LJ1 strain using the PC502 primer group).
[0051] Figure 6 Figures 1 and 2 are the fluorescence quantitative PCR detection results of the D.fangzhongdai specific primer set DK600 (Figures A, B, and C are the melting curve, amplification map, and standard curve of fluorescence quantitative PCR, respectively).
[0052] Figure 7 Figures A, B, and C are the melting curve, amplification pattern, and standard curve of the fluorescent quantitative PCR, respectively.
[0053] Figure 8The results of fluorescence quantitative PCR detection using the P. colocasium specific primer set PC502 (Figures A, B, and C are the melting curve, amplification map, and standard curve of fluorescence quantitative PCR, respectively).
[0054] Figure 9 Figure 1 is the electrophoresis results of PCR detection of taro soft rot pathogens after mixing primer sets DK600, PA302 and PC502 (Figure a is the electrophoresis results of PCR detection of three taro soft rot pathogens D.fangzhongdai CL3, P.aroidearum LJ2, and P.colocasiumLJ1 after mixing the three primer sets, M is a 2000bp marker, lane 1 is the DNA amplification result of D.fangzhongdai CL3, lane 2 is the DNA amplification result of P.colocasium LJ1, lane 3 is the DNA amplification result of P.aroidearum LJ2, and lane 4 is the ddH2O amplification result; Figure b is the electrophoresis results of PCR detection of mixed DNA of three taro soft rot pathogens after mixing the three primer sets, M is a 2000bp marker Marker, lanes 1, 2, and 3 are three repetitions of the experimental results, and lane 4 is the ddH2O amplification result; Figure c is the electrophoresis results of PCR detection of the mixed DNA of three taro soft rot pathogens by the three primer sets alone, M is 2000bp, lanes 1, 2, and 3 are the electrophoresis results of PCR detection of the mixed DNA of three taro soft rot pathogens by the primer sets DK600, PC502, and PA302 alone, and lane 4 is the ddH2O amplification result). DETAILED DESCRIPTION
[0055] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.
[0056] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.
[0057] Bacterial genomic DNA purification kit, PCR Purification Kit, catalog number EP101-01, was purchased from Beijing Quanshijin Biotechnology Co., Ltd.
[0058] The primers used in the examples were synthesized by Guangzhou Qingke Biotechnology Co., Ltd.
[0059] 2×T5 Super PCR Mix was purchased from Guangzhou Qingke Biotechnology Co., Ltd. with the catalog number TSE005.
[0060] The artificial inoculation method in Example 3 refers to the inoculation method in the inventor's article "Zhou J, Hu M, Hu A, et al. Isolation and genome analysis of Pectobacterium colocasium sp.nov. And Pectobacteriumaroidearum, two new pathogens of taro [J]. Frontiers in Plant Science, 2022, 13: 852750."
[0061] The strain information used in the following examples is shown in Table 1.
[0062] Table 1 List of strains used in the present invention
[0063]
[0064]
[0065] Dickeya fangzhongdai CL3 was disclosed in the article "Hu A, Hu M, Chen S, Xue Y, Tan
[0066] Dickeya fangzhongdai ZXC1 was disclosed in the article "Huang S, Chen Z, Hu M, Xue Y, Liao L, Zhang LH. First Report of Bacterial Soft Rot Disease on Taro Caused by Dickeyafangzhongdaiin China.Plant Dis.2021May 2".
[0067] Dickeya zeae MS2 was disclosed in the article "Feng L, Schaefer AL, Hu M, Chen R, Greenberg EP*, Zhou J*. Virulence Factor Identification in the Banana Pathogen Dickeya zeae MS2. Appl. Environ. Microbiol., 2019, 85(23): e01611-19."
[0068] Dickeya oryzeae EC1 was disclosed in the article "Zhou J, Cheng Y, Lv M, Liao L, Chen Y, Gu Y, LiuS, Jiang Z, Xiong Y, Zhang LH. The Complete genome sequence of Dickeya zeae EC1 reveals substantial divergence from other Dickeya strains and species. BMCGenomics, 2015, 16(1):571".
[0069] Pectobacterium colocasium LJ1 and Pectobacterium aroidearum LJ2 are deposited in our laboratory and disclosed in the article "Zhou J, Hu M, Hu A, Li C, Ren X, Tao M, Xue Y, Chen S, Tang C, Xu Y, Zhang L, Zhou X. Isolation and Genome Analysis of Pectobacterium colocasium sp.nov. and Pectobacterium aroidearum, Two New Pathogens of Taro. Front Plant Sci. 2022Apr26;13:852750."
[0070] Dickeya dadantii 3937, a standard strain, has been disclosed on the NCBI website. The Taxonomy ID of Dickeya dadantii 3937 in NCBI is 198628.
[0071] Example 1 Design of specific primers for PCR detection of taro soft rot pathogens and verification of primer specificity
[0072] (1) Experimental methods
[0073] 1. Primer design
[0074] The present invention compares, analyzes, screens and studies the whole genome data of three taro soft rot pathogens, Dickeya fangzhongdai, Pectobacterium aroidearum and Pectobacterium colocasium, obtains specific genes that can be used for detection and identification, designs specific primers and establishes a specific PCR detection method.
[0075] The present invention designed multiple pairs of primers for three taro soft rot pathogens (D.fangzhongdai, P.aroidearum, P.colocasium) using unqprimer and NCBI Primer-Blast, and screened them through a large number of experiments to finally obtain specific primers for the three taro soft rot pathogens (as shown in Table 2).
[0076] Table 2 Primers used in the present invention
[0077]
[0078] The product amplified by the DK600 primer set can specifically detect the specific gene fragment of D.fangzhongdai, and the sequence is shown in SEQ ID NO.1.
[0079] SEQ ID NO.1:
[0080] TTGCCCGACAAGCCTGAGCGCGCCGTAGATACCCCGATCGATGTACGGCGCCCCATTTTCCGCCAGACGTTATTAAGGTCATGATGGATGAAAATATTGTGTGCTGTATTGGCGTTGAGTCTGTCAACGATGTTGCCTGCCCTGGCTCAGACGGCATCCCCGCAGGGTGAGGCGGAGATCGCCGGGCTGGCTGGTAAGCGGGATCTGGTGCAGGAAGAAAAGAACCGTGCGTTGGTGGTTGAGTTTTATACGGAAGTGTTAAGCCATCGCCGGGTCGATCTGGCGGATAAATACCTGAGCGCAGAATATATTCAGCATAATCCGTATGCAGCGACCGGGCGCGAGGCATTTGTGGCCTTTTTCACCGATTTATTCCGTCGTTATCCGCAATCCGAGCACCGTATTATCCGCACCGCTACCGACGGTAATCTGGTCTATCTGCATGTATTTGCACGGAATGACCCCAGCGATCGGGGACGGGCGGTGGTCGATATTCTGCGCGTTGATAACGGTAAGATCGTGGAGCACTGGGATGTGGTACAGCCGATACCTGAAACGAGCGCCAACACCAACGGGATGTTTTGATACGGCTTGCCCGGCG。
[0081] The amplification product of the PA302 primer set can specifically detect the specific gene fragment of Pectobacterium aroidearum, and the sequence is shown in SEQ ID NO.2.
[0082] SEQ ID NO.2:
[0083] GCGCAGGATGACGCGGAACTGACACACCGTTAAGCCACGCTTGCTGCACAAAAGAAAACGCCGACGGCTGGAGCTGTCGGCGTTTTTTATAACACTTTTCTAATAACGATATCGTGCTATCAGGTTAACTAGCGCTGTGGGTTAGTATCGTAAGCCTGGCAGCTCTGGAAGCCTTTATTGAGGACATGCCCTGTGTCGTTATAGCTCACGAAATAGTTCTGCGCGGTACCATCGCGGTTTTTCAGCAGATAATCACTGCAGGTACCCTTGGCATTCACCAAACGTTTCTCAGTGCCGCCCGT。
[0084] The amplification product of the PC502 primer set can specifically detect the specific gene fragment of Pectobacterium colocasium, and the sequence is shown in SEQ ID NO.3.
[0085] SEQ ID NO.3:
[0086] CAGTGGCGTGCTGGGTACGGCCTTGGCATCACGGGTGTCATTCAGGTAGAGCACAACGGTAGAGCGTGGATCGACGGTCACGTTACCGGACAGCGTTCGCTGTGATACCAGATCTTCCGCGCCCTTAAAGCCGACTGGTGTTTTCAGGGCGTAGCGGTTGTCGGCGCTGGCATTAATACCAATGAGATAGTGGCCGAAACGTGCGGCATAGAAATCGGCCTTGCCTCGGAAAGGTTCATCGTTGGATGCCTCTTCAGGTTTAATGCCGAGCGGCAGGATTTCACCAGCATAGGCGTTAGTCGGCGGATTGGGAGGCGTATAGGGTGTTTTCTCCGGCATGTCGATGCGGTTAGGGCGTGTATAGCTCGCCGTTGAACGAAAGATCGGGGTGGTTTCCAGTACACCATACTGATCATAGCCCGGAGTGCTGAAATGGAAACGCGCCAGCCCGTTGATGCCGGTTCCTGCTTTGGCCTGCCAATATGTCGTCAGCCACAGGCGC。
[0087] 2. Bacterial genomic DNA extraction
[0088] Using a bacterial genomic DNA purification kit (Beijing Quanshijin Biotechnology Co., Ltd.), genomic DNA was extracted from the soft rot pathogens P. colocasium LJ1, P. aroidearum LJ2, P. colocasium 0623, P. aroidearum 11303, P. aroidearum 11629, P. cacticida 10813, P. carotovorum 17280, D. fangzhongdai CL3, D. fangzhongdai ZXC1, D. oryzeae EC1, D. zeae MS2, D. dadantii 3937, D. solani 5316, and D. chrysanthemi 402. Genomic DNA was extracted according to the kit instructions. The specific method is as follows:
[0089] (1) Take 1 mL of overnight culture solution and centrifuge at 12,000 × g for 1 minute, discarding the supernatant as much as possible;
[0090] (2) Add 100 μL LB11 and 20 μL Proteinase K and shake until the bacteria are completely suspended;
[0091] (3) Incubate at 55°C for 15 minutes;
[0092] (4) Add 20 μL RNase A, mix well, and let stand for 2 minutes;
[0093] (5) Add 400 μL BB11 (with anhydrous ethanol) and vortex for 30 seconds;
[0094] (6) Add all the solution to the centrifuge column, centrifuge at 12,000 × g for 30 seconds, and discard the flow-through;
[0095] (7) Add 500 μL of CB11, centrifuge at 12,000 × g for 30 seconds, and discard the flow-through;
[0096] (8) Repeat step (7) once;
[0097] (9) Add 500 μL WB11, centrifuge at 12,000 × g for 30 seconds, and discard the flow-through;
[0098] (10) Repeat step (9) once;
[0099] (11) Centrifuge at 12000 × g for 2 minutes to completely remove residual WB11;
[0100] (12) Place the centrifuge column in a clean centrifuge tube, add 50 μL of preheated EB (60-70°C) or deionized water (pH>7.0) to the center of the column, let it stand at room temperature for 2 minutes, and centrifuge at 12,000 × g for 1 minute to elute the DNA.
[0101] The DNA concentration of the extracted genomic DNA was measured using a micro-spectrophotometer (NanoDrop2000c) and the DNA product was stored at -20°C for future use.
[0102] 3. Establishment of PCR detection method and validation of primer-specific PCR
[0103] Based on the research purpose of using three primer sets simultaneously for PCR amplification: DK600-F / DK600-R, PA302-F / PA302-R, and PC502-F / PC502-R, a PCR detection method for the pathogen of taro soft rot was established by optimizing the PCR amplification reaction system and reaction procedure:
[0104] PCR reaction system (25 μL system): 2×T5 Super PCR Mix 12.5 μL, forward primer and reverse primer 1 μL each, DNA template 1 μL, double-distilled water 9.5 μL.
[0105] PCR reaction program: pre-denaturation at 98°C for 3 minutes, denaturation at 98°C for 15 seconds, annealing at 65°C for 15 seconds, extension at 72°C for 20 seconds, denaturation-annealing-extension for 30 cycles; final extension at 72°C for 5 minutes.
[0106] PCR amplification was performed using genomic DNA of strains LJ1, LJ2, 0623, 11303, 11629, 10813, 17280, CL3, ZXC1, EC1, MS2, 3937, 5316, and 402 as templates using the above PCR reaction system and reaction procedure. 5 μL of PCR product was detected by 1% agarose gel electrophoresis, and the specificity of primers DK600-F / DK600-R, PA302-F / PA302-R, and PC502-F / PC502-R was verified.
[0107] (2) Experimental results
[0108] The specific PCR verification electrophoresis results of primer set DK600 are as follows Figure 1As shown in the figure, the results showed that primers DK600-F / DK600-R can specifically amplify a band of 601bp with D.fangzhongdai genomic DNA, while no amplified band was found with the DNA of other strains and the negative control. This shows that this pair of primers can distinguish D.fangzhongdai from other taro soft rot pathogens, has interspecies specificity, and can be used for the rapid detection of taro soft rot pathogen D.fangzhongdai.
[0109] The electrophoresis results of primer set PA302 specific PCR verification were as follows Figure 2 As shown in the figure, the results showed that primers PA302-F / PA302-R could specifically amplify a 302 bp band with P. aroidearum genomic DNA, while no amplified band was found with DNA of other strains and negative controls. This indicated that this pair of primers could distinguish P. aroidearum from other strains of taro soft rot pathogens, had interspecies specificity, and could be used for the rapid detection of taro soft rot pathogen P. aroidearum.
[0110] The electrophoresis results of primer set PC502 specific PCR verification were as follows Figure 3 As shown in the figure, the results showed that primers PC502-F / PC502-R can specifically amplify a band of 502 bp with P. colocasium genomic DNA, while no amplified band was found with DNA of other strains and negative controls. This indicates that this pair of primers can distinguish P. colocasium, the pathogen of taro soft rot, from other strains, has interspecies specificity, and can be used for rapid detection of P. colocasium, the pathogen of taro soft rot.
[0111] Example 2 Sensitivity determination of specific primers for taro soft rot pathogens
[0112] (1) Experimental methods
[0113] The genomic DNA of taro soft rot pathogens D.fangzhongdai CL3, P.aroidearum LJ2 and P.colocasium LJ1 were diluted with sterile ultrapure water to obtain DNA templates with a mass concentration gradient of 50ng / μL, 25ng / μL, 10ng / μL, 5ng / μL, 1ng / μL, 0.1ng / μL, 0.05ng / μL, 0.01ng / μL and 0.005ng / μL.
[0114] PCR amplification was performed using the PCR amplification reaction system and reaction procedure of Example 1. 5 μL of PCR product was subjected to 1% agarose gel electrophoresis to determine the sensitivity of primers DK600-F / DK600-R, PA302-F / PA302-R, and PC502-F / PC502-R.
[0115] (2) Experimental results
[0116] The results of the sensitive PCR electrophoresis of the specific primer set DK600, PA302 and PC502 are as follows Figure 4 As shown, the results show that:
[0117] The minimum concentration of D.fangzhongdai CL3 genomic DNA detected by DK600-1 was 0.05 ng / μL ( Figure 4 The lowest concentration of P. aroidearum LJ2 genomic DNA detected by PA302 was 0.005 ng / μL ( Figure 4 b); the lowest concentration of P. colocasium LJ1 genomic DNA detected by PC502 was 0.005 ng / μL ( Figure 4 Figure c).
[0118] In summary, the DK600, PA302, and PC502 primer sets have good detection sensitivity for their respective target pathogens and can be used for sensitive detection of taro soft rot.
[0119] Example 3 PCR detection using taro soft rot pathogen inoculated taro tissue
[0120] (1) Experimental methods
[0121] With reference to the reported artificial inoculation method (Zhou J, Hu M, Hu A, et al. Isolation and genome analysis of Pectobacterium colocasium sp.nov. And Pectobacterium aroidearum, two new pathogens of taro [J]. Frontiers in Plant Science, 2022, 13: 852750.), the taro slices were inoculated with taro soft rot pathogen strains D.fangzhongdai CL3, P.colocasium LJ1, and P.aroidearum LJ2, and then placed in a 28 ° C constant temperature incubator. After the host plant became ill, the rotten part of the taro tissue was transferred to a 50 mL centrifuge tube, 10 mL of sterilized double distilled water was added, and the tissue extract was prepared at 28 ° C for 2 h. The prepared tissue extract was used as a template for PCR detection, and the PCR amplification reaction system and reaction procedure were the same as in Example 1.
[0122] (2) Experimental results
[0123] The results of PCR electrophoresis of taro tissue extract are as follows Figure 5 As shown in the results, the primers DK600-F / DK600-R can amplify a specific 601bp band in the tissue extract, indicating that the pathogenic bacteria strain D.fangzhongdai ( Figure 5 Figure a);
[0124] The primers PA302-F / PA302-R and PC502-F / PC502-R were used to amplify the tissue extracts of P. aroidearum LJ2 and P. colocasium LJ1 inoculated with taro, respectively, and a specific 302 bp band was amplified. Figure 5 b) and 502 bp band ( Figure 5 Figure c) shows that by testing the extract of the diseased tissue, it is possible to determine whether the diseased tissue contains the pathogen of taro soft rot.
[0125] In summary, the experimental results show that the primer set DK600, PA302 and PC502 of the present invention can detect whether the tissue extract contains the target pathogen, and can be used for rapid molecular detection of taro soft rot pathogens. Example 4 Fluorescence quantitative PCR detection of taro soft rot pathogens using specific primers
[0126] Fluorescence quantitative PCR (qPCR) detection was performed on the DNA of D.fangzhongdai CL3, P.aroidearum LJ2 and P.colocasium LJ1 strains using specific primers DK600-F / DK600-R, PA302-F / PA302-R and PC502-F / PC502-R, respectively. The detection results were as follows: Figure 6 、 Figure 7 and Figure 8 shown.
[0127] Figure 6 、 Figure 7 and Figure 8 As shown in Figure A, the qPCR detection limit of the three primer sets of DK600, PA302 and PC502 is 2.5×10 -6 ng / μL, 200 times more sensitive than conventional PCR.
[0128] from Figure 6 、 Figure 7 and Figure 8 As can be seen from Figure B, the melting temperature of D.fangzhongdai CL3 genomic DNA amplified by DK600-F / DK600-R primers is 87.1℃, the melting temperature of P.aroidearum LJ2 genomic DNA amplified by PA302-F / PA302-R primers is 85.2℃, and the melting temperature of P.colocasium LJ1 genomic DNA amplified by PC502-F / PC502-R primers is 85.0℃. The melting curves are all single-peaked, indicating that the three primer sets have good specificity.
[0129] A standard curve was established based on the relationship between the logarithm of the initial template amount and the number of cycles required for fluorescence signal acquisition. The fluorescence quantitative standard curves of primer sets DK600, PA302, and PC502 are shown in Figure 2. Figure 6 、 Figure 7 and Figure 8 As shown in Figure C, the linear equations of the logarithmic value of DNA concentration and Ct value obtained from the standard curve are:
[0130] DK600 y = -3.0395x + 35.624 (primer set DK600);
[0131] PA302 y = -3.0832x + 35.977 (primer set PA302);
[0132] PC502 y = -3.3487x + 36.126 (primer set PC502).
[0133] The fluorescence quantitative standard curves of primer sets DK600, PA302, and PC502 showed that there was a good linear correlation between the Ct value and the DNA concentration (R 2 The results showed that the qPCR results of this experiment were highly accurate, and the real-time fluorescence PCR detection system and reaction conditions of taro soft rot pathogens were reasonable and reliable.
[0134] Example 5 PCR detection of taro soft rot pathogens using specific primers, i.e. simultaneous detection of three pathogens
[0135] (1) Experimental methods
[0136] Three sets of specific primers, DK600-F / DK600-R, PA302-F / PA302-R and PC502-F / PC502-R, were mixed together to detect the genomic DNA of three taro soft rot pathogens, D.fangzhongdai CL3, P.aroidearum LJ2 and P.colocasium LJ1, respectively, as well as the genomic DNA of the mixture of the three taro soft rot pathogens.
[0137] In addition, three sets of specific primers were used to detect the mixed genomic DNA of three taro soft rot pathogens separately.
[0138] (2) Experimental results
[0139] The three primer sets were mixed and the electrophoresis results of PCR detection of three taro soft rot pathogens, D.fangzhongdai CL3, P.aroidearum LJ2, and P.colocasiumLJ1, were as follows: Figure 9 As shown in Figure a;
[0140] The electrophoresis results of PCR detection of mixed DNA of three taro soft rot pathogens after mixing the three primer sets are as follows: Figure 9 As shown in Figure b;
[0141] The electrophoresis results of PCR detection of mixed DNA of three taro soft rot pathogens by three primer sets are as follows: Figure 9 As shown in Figure c.
[0142] The results showed that the three primer sets mixed system could independently amplify the specific bands corresponding to the three taro soft rot pathogens ( Figure 9 Figure a).
[0143] The three primer set mixed system can clearly amplify the specific bands corresponding to the three taro soft rot pathogens in the mixed DNA sample ( Figure 9(Figure b) This shows that mixing the three primer sets did not affect the original PCR amplification reaction and did not produce non-specific bands.
[0144] Using three primer sets to detect the mixed genomic DNA of three taro soft rot pathogens alone can amplify the specific bands corresponding to the three taro soft rot pathogens, which also shows that the detection results of the primer sets are not interfered by other pathogens and have good specificity ( Figure 9 Figure c).
[0145] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.
Claims
1. Use of a primer set consisting of a primer pair DK600-F / DK600-R for detecting the fragment shown in SEQ ID NO. 1, a primer pair PA302-F / PA302-R for detecting the fragment shown in SEQ ID NO. 2, and a primer pair PC502-F / PC502-R for detecting the fragment shown in SEQ ID NO. 3 for detecting a pathogen of taro soft rot or in preparing a reagent for monitoring taro soft rot; the nucleotide sequence of the primer pair DK600-F / DK600-R is shown in SEQ ID NOs. 4-5, the nucleotide sequence of the primer pair PA302-F / PA302-R is shown in SEQ ID NOs. 6-7, and the nucleotide sequence of the primer pair PC502-F / PC502-R is shown in SEQ ID NOs. 8-9.
2. A kit for specifically detecting taro soft rot pathogens or monitoring taro soft rot, characterized in that: Contains the primer set according to claim 1.
3. A method for specifically detecting taro soft rot pathogens or monitoring taro soft rot, characterized in that: The method comprises the following steps: using the primer set described in claim 1, taking the fragments shown in SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3 in claim 1 as targets, detecting a sample to be tested, and judging whether the sample to be tested contains the pathogen of taro soft rot or is infected with soft rot according to the results; if the test result is positive for any one or several targets, the sample to be tested contains the pathogen of taro soft rot or is infected with soft rot; if the test results are all negative, the sample to be tested does not contain the pathogen of taro soft rot or is not infected with soft rot.
Citation Information
Patent Citations
Specific sequence of konjac soft rot bacteria, and detection primer and application thereof
CN108866219A
Primer group for detecting field pectobacterium carotovorum subsp and kit and method for extracting and detecting DNA of pectobacterium carotovorum subsp
CN110218804A