Chromosome segment of gossypium barbadense for improving fiber strength of upland cotton and application
By introducing the D06 chromosome segment of sea island cotton, especially the InDel markers C6STR-3 to C6STR-10, into upland cotton, the problem of low fiber strength in upland cotton was solved, resulting in a significant improvement in fiber strength and breeding efficiency, and promoting the breeding of new cotton varieties with high fiber strength.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ZHEJIANG UNIV
- Filing Date
- 2024-04-01
- Publication Date
- 2026-04-28
AI Technical Summary
Upland cotton has low fiber strength, limiting its genetic improvement. Existing technologies are insufficient to effectively increase its fiber strength, and there is a negative correlation between fiber strength and yield, which affects the breeding of new cotton varieties.
The InDel molecular markers C6STR-3 to C6STR-10 fragments on chromosome D06 of Sea Island cotton were introduced into upland cotton. The results were detected by PCR amplification, and cotton varieties with improved fiber strength were cultivated.
It significantly improves the fiber strength of upland cotton, simplifies the genetic background, improves breeding efficiency, enables precise localization of fiber strength and gene cloning, and promotes the breeding of new varieties with high fiber strength.
Smart Images

Figure CN118147349B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of crop genetics and breeding, specifically relating to a chromosome fragment of sea island cotton that can improve the fiber strength of upland cotton and its application. Background Technology
[0002] Cotton, as an important economic crop, produces high-quality, widely used natural fibers, and is a crucial raw material for the textile industry. Upland cotton (Gossypium hirsutum) and Sea Island cotton (Gossypium barbadense) are the main cultivated tetraploid cotton species in the genus *Gossypium*, with upland cotton being the most important, accounting for approximately 95% of the world's total cotton production annually. It boasts high yield and medium quality, suitable for spinning medium-count yarns. However, genetic improvement of its yield and fiber quality traits is limited by linkage carryover and a narrow genetic base. Sea Island cotton accounts for approximately 2% of global cotton production; however, its fibers are long and thin with high strength, making it suitable for textiles of high-end fibers. Therefore, Sea Island cotton can serve as an important genetic resource for improving the genetic basis of upland cotton.
[0003] Chromosomal segment introgression lines (CSILs) are populations constructed from donor and recipient parents through hybridization and multiple generations of backcrossing, combined with marker-assisted selection. The vast majority of the genome in a CSIL is identical to that of the recurrent parent, with only one or a few chromosome segments originating from a non-recurrent parent. This reduces interference from the population's genetic background, simplifies the study of complex traits such as yield and quality, and makes CSILs a valuable germplasm resource for achieving fine mapping of QTLs and identifying candidate genes.
[0004] Cotton fiber quality mainly includes traits such as fiber strength, fiber fineness, fiber length, uniformity, and micronaire value. Among these, fiber strength is one of the key evaluation indicators of cotton fiber quality. It is the degree to which cotton fibers resist tensile breakage and is positively correlated with yarn and fabric quality. High cotton fiber strength can reduce yarn breakage rate and improve production efficiency during spinning. However, the genetic mechanism of fiber strength is complex, being a quantitative trait controlled by multiple loci. Furthermore, important fiber quality traits such as fiber strength and fiber length have significant negative correlations with yield and yield components, greatly restricting the genetic improvement of fiber quality in the breeding of new cotton varieties.
[0005] Therefore, using upland cotton as the recipient parent and Sea Island cotton as the donor parent to breed Sea Island cotton chromosome fragment introduction lines with an upland cotton background, and introducing the superior genes of Sea Island cotton, is of significant practical importance for the genetic improvement of upland cotton. These Sea Island cotton chromosome fragment introduction lines with an upland cotton background not only provide rich germplasm resources for molecular design breeding for cotton fiber quality improvement, but also help to discover major genes and QTLs related to fiber quality traits, which is of great significance for the genetic improvement of cotton fiber quality. Summary of the Invention
[0006] The purpose of this invention is to provide a chromosome fragment of upland cotton that can improve the strength of upland cotton fibers and its application.
[0007] In a first aspect, the present invention provides a segment of Sea Island cotton chromosome capable of improving the strength of upland cotton fibers. The chromosome segment is derived from Sea Island cotton variety 3-79 and is located on the D06 chromosome of Sea Island cotton containing a segment starting with the InDel molecular marker C6STR-3 and ending with the InDel molecular marker C6STR-10.
[0008] The nucleotide sequence of the InDel molecular marker C6STR-3 is shown in SEQ ID NO.3;
[0009] SEQ ID NO.3:
[0010] GCTAGGATTCTGCAGTGCCATAGGTGGCATTTCATAATTTGTGCACATGATATTTGTACTACCGCTTAAAGAAATAATAA
[0011] TTAATGTGAACTATTTCCATCTATTAATTTTCAATTATCTCCATTGCTTTTCTTGCATGTCTAATGTGATTCTTTCTTGT
[0012] CGTTTACTTCAAGTGACGAAATGGAATGATACCAATGACAACAGAACTTAGCTGGCCGCCTGCCCCTAGTGATGGCAATA
[0013] GGGTGGGGTGGGGCAGGTCGGATTTTTGCTCCACGAAGTCTTACCATTGCGTCTCAATTCTTACTCGACTCTTGACATAA
[0014] AAAAACTTTCCCCTAACCAGCCCTTGAAATTTTATAGAAAACCCAACCTTGACCCAAGTTTTTCAATTATTTGATGACGT
[0015] GACGAGGATTTGCT
[0016] The nucleotide sequence of the InDel molecular marker C6STR-10 is shown in SEQ ID NO.6.
[0017] SEQ ID NO.6:
[0018] CAACGTCTTGGGTAAGGGGTGTTACAAACTAATAGCAAAATCATTACTTATAAAAACAAAACTTTCTATTTCAGCATGA
[0019] GATTGTATTGATTTACATGTTGTACGCATCAAGCTAATAAATTATAAATACTCCCCATTACGATTGATTTTTGGTCAAGA
[0020] GCCAAATATTTCCCAATACGGTATATGTTCCAACTGCTCCCCCACAATGCACAAAGATG
[0021] A second aspect of the present invention provides the application of the aforementioned Sea Island cotton chromosome fragment in identifying high fiber strength cotton varieties and improving cotton fiber strength traits, specifically:
[0022] The test detects whether the genomic DNA of the cotton sample contains the island cotton chromosome segment that can improve the fiber strength of upland cotton. Cotton that contains the island cotton chromosome segment that can improve the fiber strength of upland cotton is a high fiber strength cotton variety.
[0023] Furthermore, the specific steps of detecting whether the genomic DNA of the cotton to be tested contains the island cotton chromosome fragment that can improve the fiber strength of upland cotton are as follows:
[0024] The cotton genomic DNA to be tested was amplified using primers for the InDel molecular markers C6STR-3 and C6STR-10. The amplification results were used to determine whether the cotton genomic DNA contained the island cotton chromosome fragment that can improve the fiber strength of upland cotton. Otherwise, the cotton genomic DNA did not contain the island cotton chromosome fragment that can improve the fiber strength of upland cotton.
[0025] Furthermore, the forward primer nucleotide sequence of the InDel molecular marker C6STR-3 is shown in SEQ ID NO.1, and the reverse primer nucleotide sequence is shown in SEQ ID NO.1, which can amplify a DNA fragment of 414 bp as shown in SEQ ID NO.3; the forward primer nucleotide sequence of the InDel molecular marker C6STR-10 is shown in SEQ ID NO.4, and the reverse primer nucleotide sequence is shown in SEQ ID NO.5, which can amplify a DNA fragment of 219 bp as shown in SEQ ID NO.6.
[0026] A third aspect of the invention also provides the application of the InDel molecular marker in the identification or selection of cotton fiber strength traits.
[0027] The InDel molecular marker described in this invention is used to cultivate cotton varieties with improved fiber strength by screening for chromosome fragments containing the target sea island cotton.
[0028] A fourth aspect of the present invention also provides a method for identifying the strength of cotton fibers, characterized in that it comprises:
[0029] 1) Extract genomic DNA from the cotton sample;
[0030] 2) PCR amplification of the obtained genomic DNA was performed using primers for the InDel molecular markers C6STR-3 and C6STR-10; the nucleotide sequence of the forward primer for the InDel molecular marker C6STR-3 is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2; the nucleotide sequence of the forward primer for the InDel molecular marker C6STR-10 is shown in SEQ ID NO.4, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.5.
[0031] 3) Judgment based on PCR amplification results: If the amplification results of the primers for the InDel molecular marker C6STR-3 and the InDel molecular marker C6STR-10 both contain bands, then the cotton genomic DNA to be tested contains the island cotton chromosome fragment that can improve the fiber strength of upland cotton; otherwise, the cotton genomic DNA to be tested does not contain the island cotton chromosome fragment that can improve the fiber strength of upland cotton.
[0032] A fifth aspect of the present invention also provides a method for breeding cotton varieties with improved fiber strength, comprising the following steps: replacing the original chromosome segment of the recipient parent with at least a segment located on the D06 chromosome of Sea Island cotton, starting from the InDel molecular marker C6STR-3 and ending at the InDel molecular marker C6STR-10, to obtain a cotton variety with improved fiber strength.
[0033] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0034] 1. This invention uses the high-quality Sea Island cotton variety 3-79 as the donor parent and the upland cotton genetic standard line TM-1 as the recipient parent. A fragment from the Sea Island cotton D06 chromosome, starting from the InDel molecular marker C6STR-3 and ending at the InDel molecular marker C6STR-10, is introduced into upland cotton TM-1, resulting in a Sea Island cotton chromosome fragment introduction line material with improved fiber strength and an upland cotton background. The chromosome fragment developed in this invention (the fragment from the Sea Island cotton D06 chromosome starting from the InDel molecular marker C6STR-3 and ending at the InDel molecular marker C6STR-10) has important application value in the future breeding of new cotton varieties with high fiber strength.
[0035] 2. The two InDel molecular markers C6STR-3 and C6STR-10 and their primers provided by this invention can improve the speed and efficiency of breeding high-fiber-strength cotton and accelerate the breeding process of new high-fiber-strength cotton varieties.
[0036] 3. The upland cotton chromosome fragment introduction line material with improved fiber strength provided by this invention can be used for fine localization of fiber strength regulatory genes and cloning and functional analysis of related genes through InDel molecular markers C6STR-3 and C6STR-10 and their primers. This can not only provide materials for breeding new cotton varieties with high fiber strength, but also lay the foundation for elucidating the molecular genetic mechanism of cotton fiber strength traits. Attached Figure Description
[0037] Figure 1 This is a comparison of fiber strength between HY2654 and TM-1, two Sea Island cotton chromosome fragment introductory lines with an upland cotton background.
[0038] Figure 2 This is a statistical chart comparing the fiber strength of pools with high fiber strength and pools with low fiber strength.
[0039] Figure 3 This is a graph showing the QTL (qFS-D06-1) results of BSA-seq technology for identifying fiber strength in HY2654.
[0040] Figure 4 This is a schematic diagram showing the positional distribution of InDel molecular markers in fiber strength QTL qFS-D06-1.
[0041] Figure 5 This is a graph showing the comparison of fiber strength after typing the seeds of the island cotton chromosome fragment introduction line obtained in Example 1 using primers of InDel molecular markers C6STR-3 and C6STR-10. Detailed Implementation
[0042] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0043] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0044] The island cotton chromosome fragment introduction line HY2654 in the following embodiments was propagated and preserved by the applicant. The public can obtain this biological material from the applicant. This biological material is only used to repeat the experiments of the present invention and cannot be used for other purposes.
[0045] Example 1: Identification of chromosome segments associated with high fiber strength trait in cotton and development of related molecular markers:
[0046] Using the high-quality Sea Island cotton variety 3-79 as the donor parent (non-recurrent parent) and the upland cotton genetic standard line TM-1 as the recipient parent (recurrent parent), the seeds produced after one hybridization, five backcrosses, and three self-crosses are the Sea Island cotton chromosome fragment introduction line materials.
[0047] Seeds of the upland cotton chromosome fragment introduction line were planted at experimental bases in Sanya, Hainan and Dangtu, Anhui from 2018 to 2020. Two rows, 3 meters long, were planted in triplicate, with TM-1 as a control. At the cotton boll opening stage, 25 bolls from the upper and middle parts of each row were randomly harvested. After ginning, 15g of lint was collected, and fiber quality and strength were measured using the HVI9000 system. Fiber quality testing revealed that the average fiber strength of upland cotton TM-1 was 27.66 cN / Tex, while the average fiber strength of one of the upland cotton chromosome fragment introduction lines was 33.69 cN / Tex, named the introduction line HY2654, showing a significant increase. Figure 1 Therefore, this study focuses on the mechanism by which chromosome fragments from upland cotton HY2654 are introduced into the fiber strength of the plant.
[0048] High-throughput whole-genome resequencing was performed on the introduced line HY2654, the upland cotton parent TM-1, and the sea island cotton parent 3-79. Bioinformatics analysis of the sequencing data identified 909,666 SNP loci from the sea island cotton parent 3-79 in the introduced line HY2654. Nine exogenous fragments were found in the genome of the HY2654 line, located on chromosomes A03, A08, A11, D02, D03, D04, D06, D09, and D11 (Table 1). Compared to other introduced fragments, the larger fragments on chromosomes D03 and D06 originate from the 3-79 genome of Sea Island cotton. A 48.70 Mb Sea Island cotton chromosome introduced fragment exists on chromosome D03 from 837298 bp to 49537092 bp, and a 47.84 Mb Sea Island cotton chromosome introduced fragment exists on chromosome D06 from 2900452 bp to 50739190 bp. It is speculated that these two fragments play a role in the formation of high fiber strength in the HY2654 introduced strain.
[0049] Table 1. Chromosome fragments introduced into the HY2654 importation material.
[0050]
[0051] The introduced line HY2654 was crossed with TM-1 to obtain F1 seeds, which were then self-crossed to obtain the F2 secondary segregating population, which consisted of 1285 individual plants. Statistical analysis of fiber quality traits in the F2 secondary segregating population was performed. 48 plants with high fiber strength were selected to construct a high fiber strength pool, and 48 plants with low fiber strength were selected to construct a low fiber strength pool. The mean fiber strength of the high fiber strength pool was 35.86 cN / tex, while the mean fiber strength of the low fiber strength pool was 27.23 cN / tex, showing a significant difference (Student.test). Figure 2As shown. After extracting DNA from each individual plant, equal amounts were mixed to form a pooled DNA and then subjected to BSA-seq sequencing. Bioinformatics analysis of the data identified a candidate QTL locus significantly associated with fiber strength on chromosome D06, named qFS-D06-1. This QTL is located at positions 1191262 bp to 17973989 bp on chromosome D06, with a total length of approximately 16.78 Mb. Figure 3 ).
[0052] InDel markers were developed and screened within the candidate region of qFS-D06-1, and marker polymorphism was detected in the parental line TM-1 and the introduced line HY2654. A total of 13 polymorphic marker pairs were detected, all of which were co-dominant. Using the 13 polymorphic marker primer pairs (Table 2), PCR amplification and capillary electrophoresis were performed on individual plants in the high fiber strength mixed pool. The genotype and fiber strength phenotypic values of the population were correlated, and two closely linked InDel marker pairs, C6STR-3 and C6STR-10, were found. Figure 4 ).
[0053] Table 2. Primer sequences for 13 pairs of InDel markers
[0054]
[0055] Example 2: Application of Sea Island cotton chromosome fragments and related molecular markers that can improve the strength of upland cotton fibers:
[0056] The seeds of the island cotton chromosome fragment introduction line obtained in Example 1 were placed in a 1.5 ml centrifuge tube, and 600 μl of pre-cooled freshly prepared extraction buffer was added. The mixture was ground with a grinder, and DNA was extracted using the CTAB method. PCR amplification was performed using primers labeled with InDel for C6STR-3 and C6STR-10. The amplification system consisted of 10 μl of DNA template and 1 μl of pre-denaturation at 94 °C for 5 min, followed by denaturation at 94 °C for 0.5 min, annealing at 57 °C for 0.5 min, and extension at 72 °C for 1 min. After 30 cycles, a final extension at 72 °C for 10 min was performed. The amplified products were subjected to non-denaturing polyacrylamide gel electrophoresis: the gel concentration was 8%, the electrophoresis buffer was 0.5 times TBE, and the electrophoresis was performed at a constant voltage of 220 V for 1 hour. Chromosome fragments containing two molecular marker bands (414bp and 219bp in upland cotton) are selected as Sea Island cotton chromosome fragments that can improve the fiber strength of upland cotton. The corresponding plants are the Sea Island cotton chromosome fragment introduction line HY2654. Otherwise, other lines are selected.
[0057] Statistical analysis was performed based on the fiber quality test results in Example 1, and the results are as follows: Figure 5As shown, the fiber strength of the HY2654 line, containing a chromosome segment of Sea Island cotton starting from InDel molecular marker C6STR-3 and ending at InDel molecular marker C6STR-10, was significantly higher than that of other Sea Island cotton lines without this chromosome segment, and also significantly higher than that of the upland cotton control TM-1 (ANOVA test), which also lacked this chromosome segment. This indicates that the Sea Island cotton chromosome segment can significantly improve the fiber strength of upland cotton. Furthermore, the two InDel molecular markers, C6STR-3 and C6STR-10, can be used to identify Sea Island cotton chromosome segments that can improve the fiber strength of upland cotton, thus aiding in the breeding of new high-fiber-strength cotton varieties.
Claims
1. The application of a reagent for detecting chromosome fragments in Sea Island cotton that enhance fiber strength in upland cotton in the identification of high-fiber-strength cotton varieties, characterized in that, The chromosome fragments of the sea island cotton are InDel molecular markers C6STR-3 and C6STR-10; The nucleotide sequence of the InDel molecular marker C6STR-3 is shown in SEQ ID NO.3; The nucleotide sequence of the InDel molecular marker C6STR-10 is shown in SEQ ID NO.
6.
2. The application according to claim 1, characterized in that, Specifically: The reagent detects whether the genomic DNA of the cotton sample contains the island cotton chromosome segment that can improve the fiber strength of upland cotton. Cotton that contains the island cotton chromosome segment that can improve the fiber strength of upland cotton is a high fiber strength cotton variety.
3. The application according to claim 2, characterized in that, The reagent is a primer pair for detecting the InDel molecular marker C6STR-3 and the InDel molecular marker C6STR-10. Specifically, the reagent detects whether the cotton genomic DNA to be tested contains the island cotton chromosome fragment that can improve the fiber strength of upland cotton. The cotton genomic DNA to be tested was amplified using primers for the InDel molecular markers C6STR-3 and C6STR-10. The amplification results were used to determine whether the cotton genomic DNA contained the island cotton chromosome fragment that can improve the fiber strength of upland cotton. Otherwise, the cotton genomic DNA did not contain the island cotton chromosome fragment that can improve the fiber strength of upland cotton.
4. The application according to claim 3, characterized in that, The forward primer nucleotide sequence of the InDel molecular marker C6STR-3 is shown in SEQ ID NO.1, and the reverse primer nucleotide sequence is shown in SEQ ID NO.2; the forward primer nucleotide sequence of the InDel molecular marker C6STR-10 is shown in SEQ ID NO.4, and the reverse primer nucleotide sequence is shown in SEQ ID NO.
5.
5. A method for determining the strength of cotton fibers, characterized in that, include: 1) Extract genomic DNA from the cotton sample; 2) PCR amplification of the obtained genomic DNA was performed using primers for InDel molecular markers C6STR-3 and C6STR-10; the nucleotide sequence of InDel molecular marker C6STR-3 is shown in SEQ ID NO.3; the nucleotide sequence of InDel molecular marker C6STR-10 is shown in SEQ ID NO.6; the nucleotide sequence of the forward primer for InDel molecular marker C6STR-3 is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2; the nucleotide sequence of the forward primer for InDel molecular marker C6STR-10 is shown in SEQ ID NO.4, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.
5. 3) Judgment based on PCR amplification results: If the amplification results of the primers for the InDel molecular marker C6STR-3 and the InDel molecular marker C6STR-10 both contain bands, then the cotton genomic DNA to be tested contains the island cotton chromosome fragment that can improve the fiber strength of upland cotton; otherwise, the cotton genomic DNA to be tested does not contain the island cotton chromosome fragment that can improve the fiber strength of upland cotton.