A one-step method for detecting miRNA without RNA reverse transcriptase

Abstract

The present invention belongs to the technical field of analysis and detection, and relates to a one-step detection method for miRNA without RNA reverse transcriptase. The PCR buffer used is 10×PCR buffer, including 0.1-1.0M Tris-HCl, 0.01-0.05M (NH4) 2 SO 4 , 0.1‑0.5 M KCl, 0.01‑0.05 M MgCl 2 , 0-20% glycerol and 0-0.1M DMSO. The invention provides a one-step RT-qPCR detection method without RNA reverse transcriptase, which can realize rapid, low-cost and pollution-free detection of miRNA.

Description

Technical Field

[0001] The invention belongs to the technical field of analysis and detection, and specifically relates to a method for realizing RT-qPCR one-step detection of miRNA without RNA reverse transcriptase. Background Art

[0002] miRNA is a non-coding RNA with a length of only about 18-24 nt. It plays an important role in transcriptional regulation and disease occurrence. MiRNA is not uniformly present in tissue cells, but also widely present in samples such as body fluids, in the form of free miRNA or miRNA encapsulated in intracellular vesicles. Compared with other types of free nucleic acids, such as cfDNA, free miRNA has the advantages of greater stability and greater abundance, and is therefore also considered a potentially effective non-invasive disease diagnostic marker.

[0003] There are many methods for detecting miRNA, such as second-generation sequencing, electrochemical chips, and RT-qPCR. Second-generation sequencing has the advantages of high throughput, high sensitivity, and typability in miRNA detection, so it is widely used in miRNA expression spectrum analysis and marker mining. However, there are problems such as high cost and complex operation for the detection of individual known miRNAs and terminal detection in clinical applications. Electrochemical chips and other methods currently have no mature application technology, and are rarely used due to factors such as low sensitivity. The current gold standard for detecting miRNA is still the RT-qPCR method, which mainly includes methods based on stem-loop reverse transcription primers and methods based on Ploy-A reverse transcription primers, and the stem-loop method is currently the most widely used technology. However, all of the above methods require that miRNA first be reverse transcribed into cDNA using reverse transcriptase, and then detected using sequencing, electrochemical chips or qPCR technology. When detecting miRNA, the primer probe cannot directly bind to the miRNA. First, the miRNA needs to be reverse transcribed into cDNA before the primer probe can bind to the cDNA to complete the subsequent PCR process. The general process is to reverse transcribe in one reaction tube, and then transfer the reverse transcribed CDNA as a template to another reaction tube for PCR amplification. This process has the following two defects: 1) The detection process requires the use of two enzymes, reverse transcriptase and Taq DNA polymerase, which increases the detection cost, and the buffer systems used by the two enzymes are different, which may cause potential interference; 2) The reaction in two reaction tubes will increase the complexity and time cost of the operation during the pipetting process, and will also bring potential cross-contamination. Therefore, if a one-step RT-qPCR detection method without RNA reverse transcriptase can be developed, it will be of great significance to improve the efficiency of miRNA detection, reduce detection costs and reduce cross-contamination. Summary of the invention

[0004] The present invention aims to develop a novel one-step RT-qPCR method without RNA reverse transcriptase for the detection of miRNA, so as to achieve rapid, low-cost and pollution-free detection of miRNA.

[0005] The technical solution provided by the present invention is as follows:

[0006] A PCR buffer for miRNA detection, wherein the PCR buffer is a 10×PCR buffer, comprising 0.1-1.0M Tris-HCl, 0.01-0.05M (NH4)2SO4, 0.1-0.5M KCl, 0.01-0.05M MgCl2, 0-20% glycerol and 0-0.1M DMSO.

[0007] A one-step detection system for miRNA without RNA reverse transcriptase includes 10×PCR buffer, Taq DNA polymerase, reverse transcription primer, linker, forward primer and fluorescent probe, 4 dNTPs mixture and DEPC water; wherein the reverse transcription primer also acts as a reverse primer in the subsequent PCR process;

[0008] Furthermore, the Taq DNA polymerase is a hot-start polymerase.

[0009] Furthermore, the reverse transcription primer is divided into two parts, RF1 and RF2. RF1 is the part near the 5' end, which is a random fragment and does not produce complementary pairing with other nucleic acid sequences. RF2 is the part near the 3' end, which can form a complementary pairing with about 1 / 2 of the miRNA for reverse transcription. The reverse transcription primer is also used as a reverse primer in the PCR process.

[0010] Furthermore, the linker is divided into two parts, LF1 and LF2. The 3' end of the linker is blocked with a phosphate group, C3 or C9, etc., and cannot be extended; the LF1 fragment is consistent with the CDNA sequence of about 1 / 2 of the 5' end of the miRNA, and the LF2 part can be complementary to the forward primer and part of the probe sequence. After the CDNA is reverse transcribed by the reverse transcription primer, it will be linked to the linker, and under the action of Taq DNA polymerase, it will continue to extend to form a complete fragment, and then the qPCR detection is completed through the joint action of the forward and reverse primers and the fluorescent probe.

[0011] The present invention also provides a one-step detection method for miRNA without RNA reverse transcriptase, which adopts the above miRNA detection system to induce Taq DNA polymerase to produce reverse transcriptase activity to achieve miRNA detection.

[0012] The miRNA reverse transcription of the present invention is to induce Taq DNA polymerase to produce stable and efficient reverse transcriptase activity under the action of the PCR buffer of the present invention, thereby realizing simultaneous reverse transcription and DNA extension of a single enzyme.

[0013] The detection procedure of the present invention may include the following two types: 1) reverse transcription first, then extension, and finally qPCR detection and 2) reverse transcription and extension at the same time, and finally qPCR detection.

[0014] 1) The reverse transcription is first performed, followed by extension, and the final qPCR detection procedure is as follows: Step 1, 30-50°C for 15-30 minutes; Step 2, 95°C for 5-20 minutes; Step 3, 37°C for 0-1 minute, 50°C for 1-10 minutes; Step 4, 95°C for 15 seconds, 56°C for 30 seconds, 70-72°C for 10 seconds, for a total of 45-50 cycles. Step 5, 4-10°C for 1 minute.

[0015] 2) Reverse transcription and extension, the final qPCR detection program is: step 1, 95℃5-20 minutes; step 2, 50℃1-60 minutes; step 3, 95℃15 seconds, 56℃30 seconds, 70-72℃10 seconds, a total of 45-50 cycles. Step 4, 4-10℃1 minute.

[0016] In the detection procedure 1), the temperature of step 1 is 30-50°C. At this time, Taq DNA polymerase has not been hot-started and does not have the ability to replicate DNA, and can only reverse transcribe RNA. In step 2, a 5-20 minute hot start at 95°C is performed before DNA replication.

[0017] In the detection procedure 2), step 1 directly performs a 5-20 minute hot start at 95°C. At this time, the TaqDNA polymerase is activated and has the function of DNA replication, but the hot start does not affect the ability of reverse transcription. Moreover, at 95°C, the reverse transcription primer and template cannot be combined, and reverse transcription cannot be performed at this time. Only when step 2 is cooled to 50°C can reverse transcription and extension be performed simultaneously.

[0018] The concentration of reverse transcription primer is 0.2-0.8μM, the concentration of Taq DNA polymerase is 0.05-0.2U / μL, the concentration of linker is 5-20nM, the concentration of fluorescent probe is 0.01-0.2μM, the concentration of forward primer is 0.1-0.5μM, the final concentration of PCR buffer is 1×, the concentration of dNTPs mixture is 0.1-0.5mM, and DEPC water is added to 30μL.

[0019] The present invention also provides application of the above detection method in miR-16 detection, wherein the forward primer sequence used is shown in SEQ ID NO.1, the linker sequence is shown in SEQ ID NO.2, the reverse transcription primer sequence is shown in SEQ ID NO.3, and the fluorescent probe sequence is shown in SEQ ID NO.4.

[0020] The present invention also provides an application of the above-mentioned detection method in the detection of serum free miRNA. The free miRNA in the serum of gastrointestinal cancer and normal control samples is extracted by an extraction kit. During the extraction step, an external reference miRNA: cel-miR-39 needs to be added to the serum. Then, the method of the present invention is used to simultaneously detect free miR-16 and miR-93 in the serum, which proves that the above method can be used for non-invasive diagnosis of gastrointestinal cancer.

[0021] Beneficial Effects

[0022] The present invention provides for the first time a one-step miRNA detection method without RNA reverse transcriptase, which avoids the defect of the prior art that two enzymes, reverse transcriptase and Taq DNA polymerase, need to be used simultaneously. Only one Taq DNA polymerase is used to realize the reverse transcription and PCR of miRNA, and the reaction can be performed in a single tube, with low cost, simple operation process and no cross contamination.

[0023] The miRNA reverse transcription of the present invention is to induce Taq DNA polymerase to produce reverse transcriptase activity under the action of the PCR buffer of the present invention, thereby realizing simultaneous reverse transcription and qPCR of a single enzyme. The PCR buffer provided by the present invention realizes that TaqDNA polymerase has the functions of reverse transcription and DNA replication at the same time, and its effect is achieved by adjusting the components and component concentrations in the PCR buffer. It can be seen from the comparative test data in the embodiment that only by adopting the components and concentrations described in the present invention can the technical effects of simultaneous reverse transcription and qPCR of a single enzyme be achieved. The present invention provides a one-step RT-qPCR detection method without RNA reverse transcriptase, which can realize rapid, low-cost and pollution-free detection of miRNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The results of the method of the present invention for detecting miRNA and the blank control are shown in Figure 1. (A) Amplification curve, (B) Agarose gel electrophoresis. Note: The target band is in the box;

[0025] Figure 2 Comparison of the reverse transcription effects of Taq DNA polymerase induced by conventional PCR buffer and the PCR buffer of the present invention, (A) Ct value comparison, (B) agarose gel electrophoresis comparison;

[0026] Figure 3 The Ct values ​​of miRNA detected at different reverse transcription temperatures in Procedure 1 of the present invention, (A) reaction procedure, (B) Ct values ​​at different temperatures;

[0027] Figure 4 It is a schematic diagram of the principle of program 2 of the present invention;

[0028] Figure 5 The Ct values ​​of miRNA detected at different times in the second step of procedure 2 of the present invention, (A) reaction procedure, (B) Ct values ​​at different times;

[0029] Figure 6 The method of the present invention detects the effect of miRNA at different Taq DNA polymerase concentrations and different reverse transcription primer concentrations, (A) Ct values ​​at different Taq DNA polymerase concentrations, (B) agarose gel electrophoresis at different Taq DNA polymerase concentrations; (C) Ct values ​​at different reverse transcription primer concentrations, (D) agarose gel electrophoresis at different reverse transcription primer concentrations. Note: The target band is in the box;

[0030] Figure 7 The method of the present invention is used to detect the effect of different miRNA concentration gradients, (A) Ct value, (B) linear interval;

[0031] Figure 8 The diagram shows the specific effect of the method of the present invention on distinguishing miRNAs with similar sequences, (A) miR-93 specific primer probe detects miR-17 and miR-20b; (B) miR-17 specific primer probe detects miR-93 and miR-20b; (C) miR-21b specific primer probe detects miR-93 and miR-17; (D) detection rate of cross-detection of three miRNAs.

[0032] Fig. 9 The results of the method of the present invention for detecting free miRNA in serum are shown in Figure 1. (A) The level of external reference miRNA: cel-miR-39 in digestive tract cancer and normal controls; (B) The level of miR-16 in digestive tract cancer and normal controls; (C) The level of miR-93 in digestive tract cancer and normal controls; (D) The AUC curve of miR-16 distinguishing digestive tract cancer from normal controls; (E) The AUC curve of miR-93 distinguishing digestive tract cancer from normal controls; (F) The AUC curve of the combination of miR-16 and miR-93 distinguishing digestive tract cancer from normal controls.

[0033] Fig.10 The effect diagram of the present invention using different components of buffer to detect miR-16, (A) Ct value comparison, (B) agarose gel electrophoresis comparison;

[0034] Fig.11 This is a diagram showing the effect of different PCR buffer components in detecting miR-16 in Example 10;

[0035] Fig.12 This is a diagram showing the effect of detecting miR-16 using PCR buffer with different component concentrations in Example 11;

[0036] Fig.13 This is a comparison chart of the Ct values ​​of 1-100 fM quadruple miRNA detected by 10×G6 buffer and 10×G8 buffer in Example 12. DETAILED DESCRIPTION

[0037] Example 1

[0038] First, 10×PCR buffer-1 was prepared according to the following concentrations: 0.6M Tris-HCl (pH 8.0), 0.02M (NH4)2SO4, 0.4M KCl, 0.02M MgCl2. miR-16 was used as the detection target, and TE buffer (10mM Tris-HCl, 1mM EDTA, pH=8.0) was used as the blank control for detection. Forward primer: GTACTGCATCATCGGTCTAC (SEQ ID NO.1), linker: GTACTGCATCATCGGTCTACGTACCAGAGCCAACTAGCAGCACGT (SEQ ID NO.2), reverse transcription primer: CCTACAGACTACGCCAATAT (SEQ ID NO.3) and fluorescent probe: CAGAGCCAACTAGC (SEQ ID NO.4). The concentration of reverse transcription primer was 0.4 μM, the concentration of Taq DNA polymerase was 0.1 U / μL, the concentration of linker was 5 nM, the concentration of fluorescent probe was 0.1 μM, the concentration of forward primer was 0.2 μM, the concentration of dNTPs mixture was 0.2 mM, the miRNA template and DEPC water were added to 30 μL, and the reaction procedure was as follows: Step 1, 50°C for 30 minutes; Step 2, 95°C for 10 minutes; Step 3, 37°C for 1 minute, 50°C for 1 minute; Step 4, 95°C for 15 seconds, 56°C for 30 seconds, 72°C for 10 seconds, a total of 45 cycles. Step 5, 4°C for 1 minute.

[0039] Test results Figure 1 As shown, the method of the present invention can effectively amplify the fluorescence curve and band of miR-16, and there is no target band and fluorescence curve in TE.

[0040] Example 2

[0041] Further, 10×PCR buffer-2 was prepared according to the following concentrations: 0.5M Tris-HCl (pH 8.0), 0.02M (NH4)2SO4, 0.5M KCl, 0.03M MgCl2, 10% glycerol. miR-16 was used as the detection target and TE was used as the blank control for detection. Forward primer: GTACTGCATCATCGGTCTAC (SEQ ID NO.1), linker:

[0042] GTACTGCATCATCGGTCTACGTACCAGAGCCAACTAGCAGCACGT (SEQ ID NO.2), reverse transcription primer: CCTACAGACTACGCCAATAT (SEQ ID NO.3) and fluorescent probe: CAGAGCCAACTAGC (SEQ ID NO.4). The concentration of reverse transcription primer was 0.4 μM, the concentration of Taq DNA polymerase was 0.1 U / μL, the concentration of linker was 5 nM, the concentration of fluorescent probe was 0.1 μM, the concentration of forward primer was 0.2 μM, the concentration of dNTPs mixture was 0.2 mM, the miRNA template and DEPC water were supplemented to 30 μL, and the reaction procedure was as follows: step 1, 50°C for 30 minutes; step 2, 95°C for 10 minutes; step 3, 37°C for 1 minute, 50°C for 1 minute; step 4, 95°C for 15 seconds, 56°C for 30 seconds, 72°C for 10 seconds, a total of 45 cycles. Step 5, 4°C for 1 minute. At the same time, 5×PCR buffer (MgCl2 free, product number NH9739, batch number: LK1001, 5×, 100mL / L, main components are Tris-HCl, glycerol, KCl) of Suzhou Xinhai Biotechnology Co., Ltd. was selected, and the same concentration of MgCl2 was added as a control buffer for testing under the same conditions.

[0043] The comparison results are as follows Figure 2 As shown, when conventional PCR buffer is used, there is no fluorescent signal and no PCR bands, while when the PCR buffer formula of the present invention is used, Taq DNA polymerase can be induced to produce efficient and stable reverse transcription effect in the absence of RNA reverse transcriptase, thereby realizing reverse transcription of miRNA, and then a cDNA template is generated for the next step of qPCR, which proves that the present invention can activate the reverse transcription function of Taq DNA polymerase by optimizing the ion concentration of PCR buffer, but does not lose the DNA replication function, while the traditional PCR buffer does not have this ability.

[0044] Example 3

[0045] Prepare 10×PCR buffer-1 according to the following concentrations: 0.6M Tris-HCl (pH 8.0), 0.02M (NH4)2SO4, 0.4M KCl, 0.03M MgCl2, 20% glycerol, 0.06M DMSO. Use miR-16 as the detection target and TE as the blank control for detection. Forward primer:

[0046] GTACTGCATCATCGGTCTAC (SEQ ID NO. 1), linker:

[0047] GTACTGCATCATCGGTCTACGTACCAGAGCCAACTAGCAGCACGT (SEQ ID NO.2), reverse transcription primer: CCTACAGACTACGCCAATAT (SEQ ID NO.3) and fluorescent probe: CAGAGCCAACTAGC (SEQ ID NO.4). The concentration of reverse transcription primer was 0.4 μM, the concentration of Taq DNA polymerase was 0.1 U / μL, the concentration of linker was 10 nM, the concentration of fluorescent probe was 0.1 μM, the concentration of forward primer was 0.4 μM, the concentration of dNTPs mixture was 0.2 mM, the miRNA template and DEPC water were supplemented to 30 μL, and the reaction procedure was as follows: step 1, 30-50℃ for 30 minutes; step 2, 95℃ for 10 minutes; step 3, 37℃ for 1 minute, 50℃ for 1 minute; step 4, 95℃ for 15 seconds, 56℃ for 30 seconds, 72℃ for 10 seconds, a total of 45 cycles. Step 5, 4℃ for 1 minute.

[0048] like Figure 3 As shown, under program 1, whether the reverse transcription temperature is 30°C, 40°C or 50°C, it can ensure that miRNA can be reverse transcribed into a CDNA template, thereby achieving subsequent linker extension and qPCR.

[0049] Example 4

[0050] To prove that it is not because the Taq DNA polymerase is mixed with RNA reverse transcriptase, but the reverse transcription activity generated by the Taq enzyme activated by the buffer of the present invention, we established procedure 2 for testing. Since RNA reverse transcriptase is not thermally stable, it will lose its activity at high temperature (above 90°C) for 15 minutes. Therefore, we followed the following procedure: Figure 4 The reaction system was first hot-started according to the procedure, and the entire reaction system was consistent with Example 3. Figure 5As shown in the figure, miRNA signals can still be effectively amplified under the conditions of program 2, proving that the reverse transcription activity comes from Taq DNA polymerase. At the same time, we verified the effects of different times in step 2: variable reverse transcription and variable extension steps, and found that the Ct value of fluorescence detection at 1 minute was too large, and when extended to 30 and 59 minutes, the Ct value tended to be stable, proving that reverse transcription was not sufficient at 1 minute, but when the time was extended to 30 minutes or more, sufficient reverse transcription effect was achieved.

[0051] Example 5

[0052] Prepare 10×PCR buffer-1 according to the following concentrations: 0.6M Tris-HCl (pH 8.0), 0.02M (NH4)2SO4, 0.4M KCl, 0.02M MgCl2, 10% glycerol, 0.06M DMSO. Use miR-16 as the detection target and TE as the blank control for detection. Forward primer:

[0053] GTACTGCATCATCGGTCTAC (SEQ ID NO. 1), linker:

[0054] GTACTGCATCATCGGTCTACGTACCAGAGCCAACTAGCAGCACGT (SEQ ID NO.2), reverse transcription primer: CCTACAGACTACGCCAATAT (SEQ ID NO.3) and fluorescent probe: CAGAGCCAACTAGC (SEQ ID NO.4). The concentration of reverse transcription primer is 0.2-0.8 μM, the concentration of Taq DNA polymerase is 0.05-0.2 U / μL, the concentration of linker is 10 nM, the concentration of fluorescent probe is 0.1 μM, the concentration of forward primer is 0.4 μM, the concentration of dNTPs mixture is 0.2 mM, the miRNA template and DEPC water are supplemented to 30 μL, and the reaction program is as follows: step 1, 95°C for 15 minutes; step 2, 50°C for 30 minutes; step 4, 95°C for 15 seconds, 56°C for 30 seconds, 70°C for 10 seconds, a total of 45 cycles. Step 5, 4°C for 1 minute.

[0055] The results are as follows Figure 6 As shown, under different Taq DNA polymerase concentrations and different reverse transcription primer concentrations, the detected fluorescent signal and band brightness can be significantly amplified, and show a trend of increasing brightness with increasing concentration. The optimal concentration of Taq DNA polymerase is 0.10-0.15U / μL, and the optimal concentration of reverse transcription primer is 0.6μM.

[0056] Example 6

[0057] 10×PCR buffer-1 was prepared according to the following concentrations: 0.6M Tris-HCl (pH 8.0), 0.02M (NH4)2SO4, 0.4M KCl, 0.02M MgCl2, 10% glycerol, 0.06M DMSO. miR-16 forward primer: GTACTGCATCATCGGTCTAC (SEQ ID NO.1), miR-16 linker: GTACTGCATCATCGGTCTACGTACCAGAGCCAACTAGCAGCACGT (SEQ ID NO.2), miR-16 reverse transcription primer: CCTACAGACTACGCCAATAT (SEQ ID NO.3) and miR-16 fluorescent probe: CAGAGCCAACTAGC (SEQ ID NO.4). cel-miR-39 forward primer: GTACTGCATCATCGGTCTAC (SEQ ID NO.1), cel-miR-39 reverse transcription primer: GAGTAACAACGCAAGCTGATTT (SEQ ID NO.5), cel-miR-39 linker: GTACTGCATCATCGGTCTACGAACCAACTCAACATCACCGGGTGT (SEQ ID NO.6), cel-miR-39 fluorescent probe: CCAACTCAACATCA (SEQ ID NO.7). miR-93 forward primer: GTACTGCATCATCGGTCTAC (SEQ ID NO.1), miR-93 reverse transcription primer: TTACAGTGGTCCTACCTGCACG (SEQ ID NO.8), miR-93 linker: GTACTGCATCATCGGTCTACGAACTCTGACTCGCAAAGTGCTGTTC (SEQ ID NO.9), miR-93 probe: TCTGACTCGCAAAG (SEQ ID NO.10). The concentration of reverse transcription primer was 0.6μM, the concentration of Taq DNA polymerase was 0.1U / μL, the concentration of linker was 10nM, the concentration of fluorescent probe was 0.1μM, the concentration of forward primer was 0.4μM, the concentration of dNTPs mixture was 0.2mM, the miRNA template and DEPC water were added to 30μL, and the reaction procedure was as follows: Step 1, 95℃ for 15 minutes; Step 2, 50℃ for 30 minutes; Step 4, 95℃ for 15 seconds, 56℃ for 30 seconds, 70℃ for 10 seconds, a total of 45 cycles. Step 5, 4℃ for 1 minute. Five concentration gradients of miRNA were detected, ranging from 0.01 to 100fM.

[0058] The results are as follows Figure 7As shown in FIG. 1 , the method of the present invention can effectively detect three miRNAs at 5 concentration gradients, and R 2 All of them were >0.98, which proved the wide applicability of this method.

[0059] Example 7

[0060] To further verify the specificity of the present invention, miR-20b and miR-17, which are similar to miR-93 in sequence, were selected for specificity analysis. The sequences of the above three miRNAs are shown below, and the underlined positions are the base differences.

[0061] miR-20b CAAAGUGCUCAUAGUGCAGGUAG(SEQ ID NO.11)

[0062] miR-17CAAAGUGCU U A C AGUGCAGGUAG (SEQ ID NO. 12)

[0063] miR-93CAAAGUGCU GU U C GUGCAGGUAG (SEQ ID NO. 13)

[0064] Prepare PCR buffer and reaction procedures according to Example 6. miR-93 forward primer: GTACTGCATCATCGGTCTAC (SEQ ID NO.1), miR-93 reverse transcription primer: TTACAGTGGTCCTACCTGCACG (SEQ ID NO.8), miR-93 linker: GTACTGCATCATCGGTCTACGAACTCTGACTCGCAAAGTGCTGTTC (SEQ ID NO.9), miR-93 probe: TCTGACTCGCAAAG (SEQ ID NO.10). miR-17 forward primer: GTACTGCATCATCGGTCTAC (SEQ ID NO.1), miR-17 reverse transcription primer:

[0065] TTACAGTGGTCCTACCTGCACTG (SEQ ID NO.14), miR-17 linker: GTACTGCATCATCGGTCTACGAACTCTGACTCGCAAAGTGCTTAC (SEQ ID NO.15), miR-17 fluorescent probe: TCTGACTCGCAAAG (SEQ ID NO.10). miR-20b forward primer: GTACTGCATCATCGGTCTAC (SEQ ID NO.1), miR-20b reverse transcription primer: TTACAGTGGTCCTACCTGCACTA (SEQ ID NO.16), miR-20b linker: GTACTGCATCATCGGTCTACGAACTCTGACTCGCAAAGTGCTCAT (SEQ ID NO.17), miR-20b fluorescent probe: TCTGACTCGCAAAG (SEQ ID NO.10).

[0066] The results are as follows Figure 8 As shown, there was almost no amplification signal in the cross-check between the three miRNAs, which proved that the method had good specificity.

[0067] Example 8

[0068] Blood was drawn from 23 patients with digestive tract cancer (including 12 patients with esophageal cancer, 6 patients with gastric cancer, and 5 patients with colorectal cancer) and 10 normal controls, and serum was separated. The serum / plasma free miRNA extraction kit of Suzhou Weishan Biotechnology Co., Ltd. was used to extract miRNA. During the extraction, an external reference cel-miR-39 was added to monitor the extraction process. After extraction, the test was performed according to the process of Example 6. The results are shown in FIG. Fig. 9 As shown, Fig. 9 As shown in the figure, the Ct values ​​of cel-miR-39 in gastrointestinal cancer and normal controls are close, with no significant difference, proving the consistency of the extraction effect. Both miR-16 and miR-93 can significantly distinguish gastrointestinal cancer from normal controls, and after combining miR-16 and miR-93 for analysis, the AUC area is as high as 1.0, proving the effectiveness of this method for detecting gastrointestinal cancer.

[0069] Example 9

[0070] Different PCR buffers were prepared according to Table 1, in which the PCR buffer of Nanjing Novozyme Biotechnology Co., Ltd. was used as a control, miR-16 was used as the detection target, and TE was used as a blank control for detection. Forward primer: GTACTGCATCATCGGTCTAC (SEQ ID NO.1), linker: GTACTGCATCATCGGTCTACGTACCAGAGCCAACTAGCAGCACGT (SEQ ID NO.2), reverse transcription primer: CCTACAGACTACGCCAATAT (SEQ ID NO.3) and fluorescent probe: CAGAGCCAACTAGC (SEQ ID NO.4). The concentration of reverse transcription primer was 0.4 μM, the concentration of Taq DNA polymerase was 0.1 U / μL, the concentration of linker was 10 nM, the concentration of fluorescent probe was 0.1 μM, the concentration of forward primer was 0.4 μM, the concentration of dNTPs mixture was 0.4 mM, the miRNA template and DEPC water were added to 30 μL, and the reaction program was as follows: Step 1, 95°C for 15 minutes; Step 2, 50°C for 30 minutes; Step 4, 95°C for 15 seconds, 56°C for 30 seconds, 70°C for 10 seconds, a total of 45 cycles. Step 5, 4°C for 1 minute.

[0071] Table 1. Components of different PCR buffers

[0072]

[0073] The results are as follows Fig.10 As shown in the figure, the Ct value of miR-16 detected by AC buffer is relatively delayed, and only 2 of 3 PCR repeats have signals and bands. However, the G6, G7 and G8 buffers of the present invention can effectively amplify 3 repeats, and the Ct value is significantly earlier than that of AC buffer. Compared with G6 buffer, G7 buffer adds glycerol, the band becomes clearer, and the dimer is relatively reduced. On the basis of G7 buffer, DMSO is added to make G8 buffer, and the band is clearer, and there is no mixed band and dimer.

[0074] Example 10

[0075] Different PCR buffers were prepared according to Table 2, and miR-16 was used as the detection target and TE was used as the blank control for detection. Forward primer: GTACTGCATCATCGGTCTAC (SEQ ID NO.1), linker: GTACTGCATCATCGGTCTACGTACCAGAGCCAACTAGCAGCACGT (SEQ ID NO.2), reverse transcription primer: CCTACAGACTACGCCAATAT (SEQ ID NO.3) and fluorescent probe: CAGAGCCAACTAGC (SEQ ID NO.4). The concentration of reverse transcription primer was 0.4 μM, the concentration of Taq DNA polymerase was 0.1 U / μL, the concentration of linker was 5 nM, the concentration of fluorescent probe was 0.1 μM, the concentration of forward primer was 0.4 μM, the concentration of dNTPs mixture was 0.4 mM, the miRNA template and DEPC water were added to 30 μL, and the reaction program was as follows: Step 1, 95°C for 15 minutes; Step 2, 50°C for 30 minutes; Step 4, 95°C for 15 seconds, 56°C for 30 seconds, 70°C for 10 seconds, a total of 45 cycles. Step 5, 4°C for 1 minute.

[0076] Table 2. Components of different PCR buffers

[0077]

[0078] The results are as follows Fig.11 As shown, the target band could not be stably amplified using the above three comparison buffers, proving that the expected purpose can be achieved only after the combination of the present invention is used. However, removing any one of Tris-HCl (pH 8.0), (NH4)2SO4, and KCl will not achieve the expected purpose.

[0079] Embodiment 11

[0080] PCR buffer with different component concentrations was prepared according to Table 3, and miR-16 was used as the detection target and TE was used as the blank control for detection. Forward primer: GTACTGCATCATCGGTCTAC (SEQ ID NO.1), linker: GTACTGCATCATCGGTCTACGTACCAGAGCCAACTAGCAGCACGT (SEQ ID NO.2), reverse transcription primer: CCTACAGACTACGCCAATAT (SEQID NO.3) and fluorescent probe: CAGAGCCAACTAGC (SEQ ID NO.4). The concentration of reverse transcription primer was 0.4 μM, the concentration of Taq DNA polymerase was 0.1 U / μL, the concentration of linker was 5 nM, the concentration of fluorescent probe was 0.1 μM, the concentration of forward primer was 0.4 μM, the concentration of dNTPs mixture was 0.4 mM, the miRNA template and DEPC water were added to 30 μL, and the reaction program was as follows: Step 1, 95°C for 15 minutes; Step 2, 50°C for 30 minutes; Step 4, 95°C for 15 seconds, 56°C for 30 seconds, 70°C for 10 seconds, a total of 45 cycles. Step 5, 4°C for 1 minute.

[0081] Table 3. PCR buffer components with different component concentrations

[0082]

[0083]

[0084] The results are as follows Fig.12 As shown, Ct value signals can be amplified under different component concentrations, but the Ct value detected by the component concentration of formula 1 is relatively early, the Ct values ​​of formulas 2-4 are relatively consistent, and the Ct value of formula 5 is the most delayed.

[0085] Example 12

[0086] In order to verify the ability of the method of the present invention to detect multiple miRNAs, 10×G6 buffer and 10×G8 buffer in Table 1 were used for testing. Four miRNAs, miR-16, miR-93, cel-miR-39 and miR-21, were detected respectively. The four miRNAs were labeled with FAM, JOE, ROX and TAMRA. Forward primer of miR-16: GTACTGCATCATCGGTCTAC (SEQ ID NO.1), linker of miR-16:

[0087] GTACTGCATCATCGGTCTACGTACCAGAGCCAACTAGCAGCACGT (SEQ ID NO.2), miR-16 reverse transcription primer: CCTACAGACTACGCCAATAT (SEQ ID NO.3) and miR-16 fluorescent probe: CAGAGCCAACTAGC (SEQ ID NO.4). cel-miR-39 forward primer: GTACTGCATCATCGGTCTAC (SEQ ID NO.1), cel-miR-39 reverse transcription primer: GAGTAACAACGCAAGCTGATTT (SEQ ID NO.5), cel-miR-39 linker: GTACTGCATCATCGGTCTACGAACCAACTCAACATCACCGGGTGT (SEQ ID NO.6), cel-miR-39 fluorescent probe: CCAACTCAACATCA (SEQ ID NO.7). miR-93 forward primer: GTACTGCATCATCGGTCTAC (SEQ ID NO.1), miR-93 reverse transcription primer: TTACAGTGGTCCTACCTGCACG (SEQ ID NO.8), miR-93 linker: GTACTGCATCATCGGTCTACGAACTCTGACTCGCAAAGTGCTGTTC (SEQ ID NO.9), miR-93 probe: TCTGACTCGCAAAG (SEQ ID NO.10). miR-21 forward primer: GTACTGCATCATCGGTCTAC (SEQ ID NO.1), miR-21 reverse transcription primer: CTCAGCGTCTAACATCAGT (SEQ ID NO.18), miR-21 linker: GTACTGCATCATCGGTCTACGAACATGTCCGCCTAGCTTATCAG (SEQ ID NO.19), miR-93 probe: ATGTCCGCCTAGCT (SEQ ID NO.20).

[0088] The concentration of reverse transcription primer was 0.6μM, the concentration of Taq DNA polymerase was 0.12U / μL, the concentration of linker was 10nM, the concentration of fluorescent probe was 0.1μM, the concentration of forward primer was 0.4μM, the concentration of dNTPs mixture was 0.2mM, the miRNA template and DEPC water were added to 30μL, and the reaction procedure was as follows: Step 1, 95℃ for 15 minutes; Step 2, 50℃ for 30 minutes; Step 4, 95℃ for 15 seconds, 56℃ for 30 seconds, 70℃ for 10 seconds, a total of 45 cycles. Step 5, 4℃ for 1 minute. The four-mixed miRNAs with a total of 3 concentration gradients of 1-100fM were detected respectively.

[0089] The results are as follows Fig.13 As shown, G6 buffer and G8 buffer can achieve multiplex reactions to a certain extent, but G8 buffer is significantly better than G6 buffer in detecting 4-fold miRNA in terms of sensitivity, anti-cross-interference ability, detection rate and amplification efficiency. This is because glycerol and DMSO can enhance the specificity of primer probes and enzymes and improve the detection efficiency of multiplex reactions. It can be seen that the PCR buffer of the present invention can be applied to multiplex miRNA detection, and the multiplex is 2 to 5.

Claims

1. Application of a miRNA detection system without RNA reverse transcriptase in the preparation of a digestive tract cancer detection reagent, characterized in that: The miRNA detection system without RNA reverse transcriptase was used to induce Taq DNA polymerase to produce reverse transcriptase activity, and four miRNAs, miR-16, miR-93, cel-miR-39 and miR-21, were detected respectively; The miRNA detection system without RNA reverse transcriptase includes PCR buffer, Taq DNA polymerase, reverse transcription primer, linker, forward primer, fluorescent probe, dNTPs mixture and DEPC water; the PCR buffer is 10× PCR buffer, including 0.1-1.0M Tris-HCl, 0.01-0.05M (NH4)2SO4, 0.1-0.5M KCl, 0.01-0.05M MgCl2, 0-20% glycerol and 0-0.1M DMSO; the reverse transcription primer concentration is 0.6 µM, the Taq DNA polymerase concentration is 0.12 U / µL, the linker concentration is 10 nM, the fluorescent probe concentration is 0.1µM, the forward primer concentration is 0.4 µM, and the dNTPs mixture concentration is 0.2mM; The sequence of the miR-16 forward primer is shown in SEQ ID NO.1, the sequence of the miR-16 linker is shown in SEQ ID NO.2, the sequence of the miR-16 reverse transcription primer is shown in SEQ ID NO.3, the sequence of the miR-16 fluorescent probe is shown in SEQ ID NO.4, the sequence of the cel-miR-39 forward primer is shown in SEQ ID NO.1, the sequence of the cel-miR-39 reverse transcription primer is shown in SEQ ID NO.5, the sequence of the cel-miR-39 linker is shown in SEQ ID NO.6, and the sequence of the cel-miR-39 fluorescent probe is shown in SEQ ID NO.7; the sequence of the miR-93 forward primer is shown in SEQ ID NO.1, the sequence of the miR-93 reverse transcription primer is shown in SEQ ID NO.8, the sequence of the miR-93 linker is shown in SEQ ID NO.9, the sequence of the miR-93 probe is shown in SEQ ID NO.10, and the sequence of the miR-21 forward primer is shown in SEQ ID NO. NO.1, the miR-21 reverse transcription primer sequence is shown in SEQ ID NO. 18, the miR-21 linker sequence is shown in SEQ ID NO. 19, and the miR-93 probe sequence is shown in SEQ ID NO. 20; The reaction program was as follows: step 1, 95°C for 15 minutes; step 2, 50°C for 30 minutes; step 4, 95°C for 15 seconds, 56°C for 30 seconds, 70°C for 10 seconds, for a total of 45 cycles; step 5, 4°C for 1 minute.

2. The use according to claim 1, characterized in that: In the PCR buffer, the concentration of Tris-HCl is 600 mM.

3. The use according to claim 1, characterized in that: In the PCR buffer, the concentration of (NH4)2SO4 is 20 mM.

4. The use according to claim 1, characterized in that: In the PCR buffer, the concentration of KCl is 400 mM.

5. The use according to claim 1, characterized in that: In the PCR buffer, the concentration of MgCl2 is 20 mM.

6. The use according to claim 1, characterized in that: In the PCR buffer, the volume ratio of glycerol is 10%.

7. The use according to claim 1, characterized in that In the PCR buffer, the concentration of DMSO is 60 mM.

Images