Construction and application of Cfap46 gene knockout mouse animal model

Abstract

The present invention discloses a method for constructing a Cfap46 knockout mouse model for fertility research and its application. A Cfap46 knockout mouse model (C57BL / 6J) is established by CRISPR / cas9-mediated genome engineering technology, and its construction method includes: determining the specific target sites sgRNA1 and sgRNA2 of the Cfap46 gene, and transcribing them into mRNA in vitro with Cas9 nuclease respectively; microinjecting active sgRNA1, sgRNA2 and Cas9RNA into mouse fertilized eggs to obtain Cfap46 knockout mice; identifying the constructed Cfap46 knockout mouse model, and verifying its female and male fertility. The present invention uses CRISPR / Cas9 gene knockout technology to establish a mouse animal model of Cfap46 gene knockout for the first time, providing a convenient and reliable animal model for studying the relationship between Cfap46 gene and fertility.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to a method for constructing and applying a Cfap46 gene knockout mouse animal model based on CRISPR / Cas9 technology. Background Art

[0002] According to statistics, about 10%-15% of couples worldwide suffer from infertility, and male factors account for about 50% of infertility patients. Multiple morphological abnormalities of sperm flagella (MMAF) can lead to male infertility. The phenotypes of MMAF mainly include: curled, bent, irregular, short or absent flagella. Previous studies have identified several flagella-related genes, including AKAP3, AKAP4, TTC21A, TTC29, fsp2, DNAH1, DNAH2, DNAH6, DNAH8, DNAH17 and DZIP1, involved in the biogenesis of sperm flagella. At the same time, the cilia and flagella-associated protein (CFAP) family, such as Cfap58, Cfap61, Cfap69, Cfap65, Cfap43, Cfap44, Cfap70 and Cfap251, are also related to the biogenesis and morphogenesis of flagella. Mutations in these genes may affect the morphology of sperm and lead to male infertility.

[0003] Flagella and cilia-associated gene 46 (Cfap46) (NCBI reference sequence: NM_001302546;

[0004] ENSMUSG00000049571: ENSMUSG00000049571) is located on mouse chromosome 7 and is 83872bp in length. The Cfap46 gene encodes the Cfap46 protein, which is part of the central organ of the microtubule-based cytoskeleton of cilia. In humans, changes in genes of the cilia and flagellar-related protein family are associated with abnormal flagellar morphology. The Cfap46 gene is mainly expressed in the testis and is expressed at lower levels in other tissues (small amounts in the lungs and ovaries). Therefore, the Cfap46 gene may play an important role in spermatogenesis.

[0005] At present, there are relatively few studies on the Cfap46 gene. Studies have shown that asthma and neural tube defects may be associated with the methylation of the Cfap46 gene. The Cfap46 gene may also fuse with the VTI1A gene to form a new transcript involved in the occurrence of hepatocellular carcinoma. In terms of reproduction, selecting sperm with the best fertilization potential is one of the main challenges faced in assisted reproductive technology, and this selection is mainly based on semen parameters. There are differences in the expression level of the Cfap46 gene in high-quality and low-quality sperm samples, and the expression of the Cfap46 gene is related to the morphology of sperm. However, it is not yet known whether the Cfap46 gene will affect fertility. The present invention creates a Cfap46 gene knockout mouse model, which provides a possibility for further exploring the effect of the Cfap46 gene on fertility. Summary of the invention

[0006] The present invention aims to provide a method for constructing a Cfap46 gene knockout mouse animal model and its application based on CRISPR / Cas9 technology.

[0007] In a first aspect, the present invention relates to a method for constructing a Cfap46 gene knockout mouse animal model, the method comprising the following steps:

[0008] S1, sgRNA1 and sgRNA2, which determine the specific target site of Cfap46 gene, were transcribed into mRNA in vitro with Cas9 nuclease;

[0009] S2, active sgRNA1, sgRNA2 and Cas9 RNA were microinjected into mouse fertilized eggs to obtain Cfap46 gene knockout mice;

[0010] The sgRNA1: TCCCCGGACTGTGCATAAGCTGG (SEQ ID NO. 1);

[0011] sgRNA2:TCAGTTTGCCACGGTGCGTCCGG (SEQ ID NO. 2).

[0012] The step S2 comprises the following steps:

[0013] S21, inducing ovulation and in vitro fertilization of female mice to cultivate fertilized eggs;

[0014] S22, microinjection of active sgRNA1, sgRNA2 and Cas9 RNA into mouse fertilized eggs; in vitro culture of fertilized eggs, implantation of recipients and cultivation of targeted gene-modified animals.

[0015] The step S22 comprises the following steps:

[0016] S221, take the fertilized eggs that survive the injection and transplant them into pseudo-pregnant female mice to give birth to mice. The pseudo-pregnant female mice are bred to produce F0 generation single-gene or multi-gene heterozygous mouse models;

[0017] S222, extract tail DNA from F0 generation mice, amplify by PCR and send the product for sequencing;

[0018] S223, breeding F0 generation single-gene or multi-gene heterozygous mice with wild mice to obtain F1 generation single-gene or multi-gene heterozygous mice;

[0019] S224, F1 generation mice of the same genotype were bred together to obtain homozygous mutant mice, namely the F2 generation Cfap46 gene knockout mouse model.

[0020] The mice, female mice and pseudo-pregnant female mice described above are C57BL / 6J mice.

[0021] Furthermore, the F0 generation single-gene or multi-gene heterozygous mouse is a positive F0 generation mouse, and 4.391 kb bases are deleted in the Cfp46 gene of the positive F0 generation mouse. The base sequence of the deleted Cfap46 gene of the positive F0 generation mouse is shown in SEQ ID NO.3.

[0022] Furthermore, the F2 generation mice were tested by PCR using two pairs of primers, Cfap46-seq-F1+Cfap46-seq-R1 and Cfap46-seq-F2+Cfap46-seq-R1, respectively, to identify the homozygous F2 generation mice;

[0023] The sequence of primer Cfap46-seq-F1: AAAGAGCCTGAGATAAGCGAAGAC (KO-only), as shown in SEQ ID NO. 4;

[0024] The sequence of primer Cfap46-seq-F2: TGGCAGGCTATTTAGCGTTTACAT (WT only), as shown in SEQ ID NO.5;

[0025] The sequence of primer Cfap46-seq-R1: GGGCAATCACAATTCCATCATCTC (downstream common primer), as shown in SEQ ID NO.6.

[0026] The homozygous mutant mouse is an F2 generation homozygous mouse, and the genome sequence of the F2 generation homozygous mouse has 4.391 kb bases deleted, and the deleted 4.391 kb bases are shown in SEQ ID NO.3.

[0027] In a second aspect, the present invention relates to a Cfap46 gene targeting vector, which is a group of sgRNA expression vectors based on the CRISPR / Cas9 system; the sgRNA is Cfap46-gRNA1 between exons 3 and 4 of the Cfap46 gene, and Cfap46-gRNA1 between exons 8 and 9 of the Cfap46 gene; the sequence of the action site of the sgRNA is shown in SEQ ID NO:1 and SEQ ID NO:2.

[0028] In a third aspect, the present invention relates to the use of a group of sgRNAs in constructing a Cfap46 gene knockout mouse animal model for fertility research.

[0029] In a fourth aspect, the present invention relates to an application of the Cfap46 gene knockout mouse animal model prepared as described above in fertility research.

[0030] The present invention has the following beneficial effects:

[0031] The present invention screened specific target sgRNA1 and sgRNA2 for the cfap46 gene, constructed a Cfap46 gene targeting vector using CRISPR / Cas9 gene knockout technology, and established a Cfap46 gene knockout mouse animal model for the first time, providing a convenient and reliable animal model for studying the relationship between the Cfap46 gene and fertility, especially providing a convenient and reliable animal model for studying the relationship between male animal fertility and the Cfap46 gene and for screening related therapeutic drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0033] Figure 1 :Schematic diagram of the construction of cfap46 gene-specific target sgRNA1 and sgRNA2;

[0034] Figure 2 :Schematic diagram of the construction scheme of Cfap46 knockout mice;

[0035] Figure 3 : PCR test results of F0 generation mice;

[0036] Figure 4 : PCR test results of F1 generation mice;

[0037] Figure 5 : PCR test results of F2 generation mice;

[0038] Figure 6: Sequencing peaks of 40 bp before and after the homozygous knockout fragment of the F2 generation;

[0039] Figure 7 :Results of fertility study on F2 generation homozygous Cfap46 knockout mice.

[0040] Remark: Figure 1-2 In the above, gRNA1 refers to sgRNA1 and gRNA2 refers to sgRNA2, which are two expressions of the same thing. DETAILED DESCRIPTION

[0041] The present invention is described in detail below in conjunction with embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, some adjustments and improvements can also be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0042] Example 1: Construction of Cfap46 knockout mice: Figure 1-2 shown.

[0043] (1) Construction of specific target sgRNA1 and sgRNA2 for the Cfap46 gene:

[0044] like Figure 1 As shown, use the CRISTR Design Tool online tool and select CRISPR: Site-specific; Mouse (Mus musculus); cfap46 (212214). Enter the sgRNA design interface, select Fn9 (gene sequence: Table 1) between exons 3 and 4 of the Cfap46 gene as sgRNA1, and select Fn1 (gene sequence: Table 1) between exons 8 and 9 of the Cfap46 gene as sgRNA2. The schematic diagram is shown in Figure 2 shown.

[0045] (2) The specific target sgRNA1 and sgRNA2 of the Cfap46 gene designed above are linearized and purified DNA and transcribed into mRNA in vitro. The sequence of the sgRNA1 of Cfap46 is shown in SEQ ID NO.1; the sequence of the sgRNA2 of Cfap46 is shown in SEQ ID NO.2.

[0046] The gRNA sequence information table is shown in Table 1:

[0047]

[0048]

[0049] (3) The purified sgRNA1 and sgRNA2 described in step (2) are transcribed in vitro with Cas9 nuclease mRNA, and microinjected into fertilized eggs. The fertilized eggs that survive the injection are transplanted into the uterus of surrogate mother mice, and the mice born are the F0 generation mice.

[0050] (4) 10 days after the birth of the F0 generation mice, the tails were cut and DNA was extracted for PCR identification and sequencing. The Cfap46 gene of the obtained F0 positive mice had 4.391 kb bases (exon4-exon8) deleted, and the deleted sequence is shown in SEQ ID NO.3:

[0051] GGTGAAAACCAGTTTGCATTGGATGCCAGGAATGAAGATGAGCAGCAGT

[0052] GGGTGCTGGGGTGGCTAGTTGGCTCACCTGGGTATTCTTTGTGCTGTCTT

[0053] AGGAAGAATTTGAAAATTGCGTGACACAGTACATGAAGGCCATAAACTT

[0054] TGCAAAAGGAGAACCGAGGTAGGTATGCTGAACTGTCTGTCTGCTTCTA

[0055] CTTGATTGCATAAGACTCTGGTGCCCACAGAAGCAAGCGATGTCATTTCT

[0056] CTTTCTGACATCCATCCCTTCTCCTTTCTGTTTTGTGCTTGTAACGAATGG

[0057] AGTTATGACACAGGCTTGTCTTACTAGCTGGGAAGGCCAGCCATACCCAT

[0058] GCAGACTTCCTATGCTGTGCTTGCTCAGGGCTCACTGAGATTTGTAGATG

[0059] GCTCTCAAAGTGTTTTCTCGGTGGCCTCCTTCCCAACCTGTCCCCCAGAA

[0060] CTCCTTGTTCCTGGCTTTTGGGTCTCTCTGAAGGGAGAAGGGCACGCTTC

[0061] AGGTTCTTCTGTGGAGACTGTAGTCCGCTGGCCCTGAGCCAAGGCTTCCT

[0062] GGCTGCAGCCACGACTCTAGCACCGCTTTTTAGATGGTGGTTGTCTTTTTT

[0063] TTTTTCCCTACCCAAACCCAAATTCGATTGTTGAAATGGTTAAGTTGGCA

[0064] TACACTGGCATTGGCACACATGCAGTGGGACCCAACATTAGCAGTAGCT

[0065] TTTGCTCATCCCGCCCATGCCCACTGCTCATTGGTTGATATCCTTATCAAG

[0066] TTACTGAATGCATAGGCACAAGGGTCCAAGGTGCAGCCCTACAAGCCTG

[0067] GATGAGCCACCCCAGCACCCACTGCTGCTCCCTCCCTCCAAGAGTCAGA

[0068] AGCCCGTGCTACACCAGAGATCTTAGCACAGTGAATGTTTTCAAATAGAT

[0069] CCATCCAGTTCCTAGCCATGTCCCACTGCAAGGGTCTTGGAGACAGTTAT

[0070] AAATGGGCCCGACAGGTGACTGGGAATCACTGGTCCGGCAGTTGGCCAT

[0071] TTGGTTTCTCTCCCTCCTTCCTGGATAATGAGCAGCAATGACCTGTCCAG

[0072] TAACCAACCAGTAATAGAATGTCAAGCCTGTCCACTCCAGAAAGCAGCT

[0073] TTATAGTAAGAAAGTGCCCTGTGTGACTCCCTCAGGTGATGACCTGCCAC

[0074] TCAGAGGAAGATGCTGGGAGGGTAGCTCTCATACATCTTCAACACCCTTCT

[0075] CAAGAGCTTATGATCGGACATGGAGTTTGTCCTACAGTCCCTCACTTCCA

[0076] CTGCAACACACTCATCTGTCTGACTGACCATCTTTTGCCTACTCAGCTCCT

[0077] GGCTGATTCTTGGACTTCTTCCAGGTCACAGTCAGATGCCACCTCCTCCA

[0078] GGAAGCCTTCCATGTTCTTTCCTCCCTTGCTTCTGACTGTATTTTCATAGG

[0079] GTGTGGTTAGTTGTGGAATGACTGAACCTAGCCCAGCCGTGTCATCACCA

[0080] CTGTGAGTGAGACAGCCATTGCTCGTGTGGGAAAGGGCTGTCGGGGTGGG

[0081] CTCTGCATCCTGGTGCCGATGCAGATTGGTGAGGAGTACCCTAAATGAG

[0082] GTGCCTGCGTCTGATGGTGATTGGACACACCTTCACTCCCCTCCTGAATG

[0083] GGTCCAGGAACCCGGATACCCCCAGCCCTGTGCCTCCAACATTCTGATTT

[0084] CTACTCCTGACCCAGGTATTACTTCTTGGTGTTCAATGCTTCTGTCCTCTA

[0085] CTGGAACATGGTGCGGCCTTCCTGAAGCCTGGATACCACCACCTCGTGA

[0086] TTCCCAGCCTCTCCCAAATCATCACTGTGTTAAATCAGAGAGAGGA

[0087] GGACAAGGAGTGGCGGGCAGAGCTGATGCTGTGAGTGGGGTGGCAGCC

[0088] CTAACAGCCCTGATGAGTCCCTGATTACGATTCACATAGACCTCTCTCTC

[0089] TCTTCCAAGGTAGGGCTTGGGTTTCTGACTTGTCAGCGGGTTCTTCCTAG

[0090] AAATCTATGGATATTGCCACACGCCTTAAAGACACATCGGGATTCAAAG

[0091] CAAAGGAAATAATGACACAGCCCTTACTCCTGGTCCATGCTTCTTAAAAC

[0092] ATTAGTGTAGTGGGGTTTGGTTGTGGGTTTGCTTTTGGTAGGCACTTTGG

[0093] CAAATAGCTATGCCAATATGAGCATCACACCTGGGTTCCCAGATACCTG

[0094] GGCATGGGAGCTCTGGGCTTGCTGCTTGAAAGCCACAGACTATCAGCAA

[0095] ATTCTAAAGAGGGGGTCTCTCACAGGTTTTGTGAGGATCTTGCTACAAAC

[0096] AAGAGACCGGGTGGATTTTGTCAATGTGAATTCCAGCATCAAAGATGCC

[0097] AGTTCAAGTCCAGACCTCAGCCTACCGGCTTGGGGACCTGCTTGTGGCTA

[0098] TTTGGAAAACCTCTAAGAGGAAGTTGATGTAAATGAGATGTTCCTTCAA

[0099] AGTATCGACTGGAAATGTTCTTAATTAAAGTGCTGATAGCTGTCTGTGCC

[0100] ATCAGCAGGAATTTCTCCCACTCCTGCTGGCTTTGCACTGAGCGGTGGAT

[0101] CCTGGCGTGTGCCGTGAGCTTCCCTGGGAAGCTCCGGAAAGTTTGCAAA

[0102] CTACAGTTTGCCAAAGCCTGAGGACCTAGTTACTGGAGATTTGCAACAA

[0103] AAGAGCTCTGAGAATGCTAATGTCTGTTGTTTTCTGATGTCCAGAGAACT

[0104] GCTTGAATGTTACCTGCAAGCCGGAAGAAAGGAGGATGCTACCAAGTTC

[0105] TGCTTGACAGCAGCGCCATTCGTCAGAACCCAGGTGCCCCACAAGTACC

[0106] GGCAGATGTTCTCAACCATGGTAAATAGACACTTTGACAAGAGAGGCAA

[0107] TAACTAGCTTTGTTAAAAGTCATTTTCTAGGAACTATGCACAAAACAGTA

[0108] ATAATCCCACTTACAGAGGAAGGCAGGAGCTTACACATGTGTGGACAAA

[0109] GCAAAAACAATGAAAAGAACAGGCAAACCCTCCTGTGTGAAAAAGCAA

[0110] CATCTGTTCATTACTGTGCTTAAATAATCCTGTAATAGCATCAGCTTTTTA

[0111] AAACACTAACAGAGAATTTATGAAACTAAGTATTTGCTATAGCACCATA

[0112] TCTCAAGTGTCTACAACTTGGTGATTTGTATATTTAAGAATTTTTATTATT

[0113] TACATATAAAAATGTATAGAACTTAATTATTGAGAGTTTGCCTTAGTTTC

[0114] AAATACTAATTTTATGGGAGGGGTTAAATAATATCTGGACACAACATCT

[0115] GAGTCCTCCTTTGAATGCAGAGTGACATTCGGTTGCATTCCCAACAGGTT

[0116] CGTTATGAAGTATTGGATGATCTTATGTTGAGGGAAGACAAGCAGCAAT

[0117] CCATTATACTCTCCATCACTTACCACATCAATTCGCTGAAAGCGTAAGTG

[0118] GTTGGGAAGGCTGGGATCAGGACACTGTCTGCTCCCCTGGGATGCCCAC

[0119] TGTCAGTAGGAGACCCCTAAGGCTGCGGGGATTTCCCTAGAGGTGGCTC

[0120] TGGTGGATTCTGTGGGGGAGAATCTAAAGTAAGCCCCATTTGCCACACC

[0121] CCACCAGTAGGGAGTGGGGTGCAATGAAGCCACTAATGAAGTAGTCCAGA

[0122] GTCCCAGCCAGGGAAGAGAGTCTTGCCAGGTGAGGCGTGAGGTAGACCA

[0123] TGAGGGAGGTCCCAAGGCGAGTGAGGCGACCACAGGATGTCCACTCCTA

[0124] AGGTGAGTGAGGAGACTGCAGTATTTTGAGGTTGAGGGAACTCCTTAC

[0125] TTCGGGGACCTTGCGGCAATAATACTGAGATACCGAGAGAACTTCGGTCG

[0126] CAGGTCCAATAGCAAAGTGAAGATAAGGGCCAAAGTGTTCCAGGGCAG

[0127] GGGATCTTAGGGACAGAGCTGGCTCTGCAGATGAGCCCTTGCACACTCT

[0128] CCCGGAGTTTCCCTGCAGTGACATAAGAAAAGGAACATTGCCTGCCGAG

[0129] AGGGAGTCTAAGGAGGTAGGAAAATTTGCCCGGGAAATGAGACACGAA

[0130] GAAAGGAGAAGGGATATTTTAAGACCTCCATTCCCTAAGAAGCATGGGT

[0131] TGGTTCATTGATTTCAGTCTTCCTTGAGAATCATTTTTTTAAACAAATATG

[0132] GCAGGCTATTTAGCGTTTACATCGATTCTAGGAAATTGGATAAAAATAAC

[0133] TTGCCGGAAAACCTGGAGCAAATCCTGAGGAAAATGTATAGAGATTTAA

[0134] GTCAGTACCATGACCAACACGTCCCTACCATCAGAGAAGAAAAGTAAGT

[0135] GTGGCTCTCCTCTATGTGTACACACAGAGACACCTACACGGTCACCATAC

[0136] AAAATATGAAAACAAGCAACCAGACCCTTGCAAGGACCAGCCCCACATC

[0137] GGGGAGGGTTTGCTAGAGCCTCCCTGGTAATATCGTCCTGAGGTTTGCAC

[0138] CGTCTGTGTACTGCACTGGGATGTGGCCCTCCATATTTGACCTTGGAAAA

[0139] ATCAAATTTAACTTCTAAGCACAGTCATT

[0140] (4) The F0 positive mice obtained in the above step (3) are mated with wild-type mice to obtain F1 heterozygous mice.

[0141] (5) The F1 generation heterozygous mice were hybridized to obtain the F2 generation homozygous mice, which are the Cfap46 gene knockout mouse animal model.

[0142] Example 2: PCR identification method and results of F0 generation mice:

[0143] (1) Primer information is shown in Table 2:

[0144]

[0145]

[0146] (2) The reaction system is as shown in Table 3: PCR Mixture (primer concentration: 10 μM):

[0147] Component Volume(μl) ddH2O 9.0 Product primer F 1.0 Product primer R 1.0 Premix Taq 12.5 DNA 1.5 Total 25

[0148] (3) Reaction conditions are shown in Table 4:

[0149]

[0150] (4) The genotype determination criteria are as shown in Table 5:

[0151] Cfap46-seq-F1+Cfap46-seq-R1 Cfap46-seq-F2+Cfap46-seq-R1 Homozygotes 700bp No product Heterozygote 700bp 682bp Wildtype allele No product 682bp

[0152] Note: Two pairs of primers need to be used for PCR separately.

[0153] (5) Identification report of F0 generation mice: PCR detection was performed on F0 generation mice using primers Cfap46-seq-F2+Cfap46-seq-R1. The results are shown in the electrophoresis diagram: Figure 3 .Depend on Figure 3 It can be seen that heterozygous mice will have a band at the 700bp position, while wild-type mice will not produce a band. Therefore, there are 4 heterozygous (i.e. positive F0 generation mice) in the F0 generation mice, numbered 1, 3, 4, and 5; mice numbered 2 and 6 are wild-type.

[0154] Example 3: Obtaining F1 generation mice and identifying their genotypes

[0155] (1) Positive F0 mice were selected and mated with wild-type C57BL / 6J mice to obtain F1 heterozygous mice with a knockout type of 4.391 kb base sequence deleted. The identification method was the same as that of F0 mice.

[0156] (2) F1 generation mouse identification report: The obtained F1 generation mice were identified using primers

[0157] Cfap46-seq-F2+Cfap46-seq-R1 was used for PCR detection. The results are shown in the electrophoresis diagram: Figure 4 .Depend on Figure 4 It can be seen that the F1 mice with numbers 1, 3, and 5 are heterozygous, while the mice with numbers 2, 4, and 6 are wild-type.

[0158] Example 4: Obtaining F1 generation mice, namely, Cfap46 gene knockout mouse animal model

[0159] (1) F1 heterozygous mice were hybridized to obtain F2 homozygous mice, which are Cfap46 gene knockout mouse animal models. Identification of F2 homozygous mice: The identification method is the same as that of F0 mice;

[0160] (2) Identification report of F2 generation mice:

[0161] PCR detection was performed using primers Cfap46-seq-F1+Cfap46-seq-R1 and Cfap46-seq-F2+Cfap46-Seq-R1. The results are shown in the electropherogram: Figure 5 .Depend on Figure 5 It can be seen that wild-type mice only produce a band at the 682bp position, homozygous mice only produce a band of 700bp, and heterozygous mice can produce both bands. Therefore, the wild-type mice in the F2 generation are numbered 1 and 8; the heterozygous mice are numbered 4, 5, 6, and 7; and the homozygous is 3. N is a negative control. The homozygous F2 generation is the constructed Cfap46 gene knockout mouse animal model, and its PCR product sequencing verifies that it contains the 40bp sequence before and after the knockout fragment, namely:

[0162] TTGTGCTTTTCTCCGCTCGGTACTCGCCAGGTGCCTGA--del4481bp--GGTTTGCACCGTCTGTGTACTGCACTGGGATGTGGCCCTC,

[0163] Sequencing peak diagram Figure 6 .

[0164] Appendix: Basis for Results Analysis

[0165] Wild type: No bands can be obtained in Cfap46-seq-F1+Cfap46-seq-R1;

[0166] Cfap46-seq-F2+Cfap46-Seq-R1 can obtain a 682bp fragment.

[0167] Heterozygotes: Cfap46-seq-F1+Cfap46-seq-R1 obtained a 700 bp fragment;

[0168] Cfap46-seq-F2+Cfap46-Seq-R1 obtained a fragment of 682 bp.

[0169] Homozygotes: Cfap46-seq-F1+Cfap46-seq-R1 obtained a 700 bp fragment;

[0170] No bands were obtained with Cfap46-seq-F2+Cfap46-Seq-R1.

[0171] Example 5: Effect of Cfap46 knockout mice on fertility

[0172] Homozygous Cfap46 knockout mice were obtained in the F2 generation. (1) Homozygous Cfap46 knockout female mice were mated with wild male mice (WT), and (2) Homozygous Cfap46 knockout male mice were mated with wild female mice (WT) to test the fertility of mice after Cfap46 knockout. Figure 7 The figure shows the average number of offspring per litter of mice after being caged together for half a year. Figure 7 It can be seen that knocking out the Cfap46 gene leads to infertility in male mice, but the fertility of female mice is not affected. The Cfap46 gene belongs to a class of flagellar genes, which are mainly expressed in the testicles and play an important role in the formation of the sperm tail structure. We speculate that after the Cfap46 gene is knocked out, the sperm tail structure of the mouse is destroyed, resulting in male mouse infertility. The Cfap46 gene knockout mouse model constructed by the present invention can be used as an effective animal model to explore the effect of the Cfap46 gene on fertility.

Claims

1. A method for constructing a Cfap46 gene knockout mouse animal model, characterized in that: The steps include: S1, sgRNA1 and sgRNA2, which determine the specific target site of Cfap46 gene, were transcribed into mRNA in vitro with Cas9 nuclease; S2, active sgRNA1, sgRNA2 and Cas9 RNA were microinjected into mouse fertilized eggs to obtain Cfap46 gene knockout mice; The sgRNA1: TCCCCGGACTGTGCATAAGCTGG (SEQ ID NO. 1); sgRNA2:TCAGTTTGCCACGGTGCGTCCGG (SEQ ID NO. 2).

2. The method for constructing a Cfap46 gene knockout mouse animal model according to claim 1, characterized in that: Step S2 includes the following steps: S21, inducing ovulation and in vitro fertilization of female mice to cultivate fertilized eggs; S22, microinjection of active sgRNA1, sgRNA2 and Cas9 RNA into mouse fertilized eggs; in vitro culture of fertilized eggs, implantation of recipients and cultivation of targeted gene-modified animals.

3. The method for constructing a Cfap46 gene knockout mouse animal model according to claim 2, characterized in that: Step S22 includes the following steps: S221, take the fertilized eggs that survive the injection and transplant them into pseudo-pregnant female mice to give birth to mice. The pseudo-pregnant female mice are bred to produce F0 generation single-gene or multi-gene heterozygous mouse models; S222, extract tail DNA from F0 generation mice, amplify by PCR and send the product for sequencing; S223, breeding F0 generation single-gene or multi-gene heterozygous mice with wild mice to obtain F1 generation single-gene or multi-gene heterozygous mice; S224, F1 generation mice of the same genotype were bred together to obtain homozygous mutant mice, namely the F2 generation Cfap46 gene knockout mouse model.

4. The method for constructing a Cfap46 gene knockout mouse animal model according to claim 3, characterized in that: The mice, female mice and pseudo-pregnant female mice are C57BL / 6J mice.

5. The method for constructing a Cfap46 gene knockout mouse animal model according to claim 3, characterized in that: The F0 generation single gene or multi-gene heterozygous mouse is a positive F0 generation mouse, and 4.391 kb bases are deleted in the Cfp46 gene of the positive F0 generation mouse. The base sequence of the deleted Cfap46 gene of the positive F0 generation mouse is shown in SEQ ID NO.

3.

6. The method for constructing a Cfap46 gene knockout mouse animal model according to claim 3, characterized in that: F2 mice were tested by PCR using two pairs of primers, Cfap46-seq-F1+Cfap46-seq-R1 and Cfap46-seq-F2+Cfap46-seq-R1, to identify homozygous F2 mice; The sequence of primer Cfap46-seq-F1: AAAGAGCCTGAGATAAGCGAAGAC (KO-only), as shown in SEQ ID NO. 4; The sequence of primer Cfap46-seq-F2: TGGCAGGCTATTTAGCGTTTACAT (WT only), as shown in SEQ ID NO. 5; The sequence of primer Cfap46-seq-R1: GGGCAATCACAATTCCATCATCTC (downstream common primer), as shown in SEQ ID NO.

6.

7. The method for constructing a Cfap46 gene knockout mouse animal model according to claim 3, characterized in that: The homozygous mutant mouse is an F2 generation homozygous mouse, and the genome sequence of the F2 generation homozygous mouse has 4.391 kb bases deleted, and the deleted 4.391 kb bases are shown in SEQ ID NO.

3.

8. A Cfap46 gene targeting vector, characterized in that: The vector is a group of sgRNA expression vectors based on the CRISPR / Cas9 system; the sgRNA is Cfap46-gRNA1 between exons 3 and 4 of the Cfap46 gene, and Cfap46-gRNA1 between exons 8 and 9 of the Cfap46 gene; the sequences of the action sites of the sgRNA are shown in SEQ ID NO: 1 and SEQ ID NO:

2.

9. Use of a set of sgRNAs as claimed in claim 8 in constructing a Cfap46 gene knockout mouse animal model for fertility research.

10. Use of the Cfap46 gene knockout mouse animal model prepared according to any one of claims 1 to 7 in fertility research.

Images