A method for detecting and identifying Heilongjiang short groove curled worms by PCR

Abstract

The present invention belongs to the field of molecular biological detection and identification, and specifically relates to a method for detecting and identifying Heilongjiang short groove snails by PCR. The present invention provides a molecular marker of Heilongjiang short groove snails, and the molecular marker comprises a sequence with at least 95%, 96%, 97%, 98%, 99%, and 100% homology to SEQ ID NO.1. The molecular marker is detected with high specificity, and the reliability of the result is fully guaranteed. When traditional taxonomic methods are difficult to identify Heilongjiang short groove snails and other snails, the present invention uses molecular biological technology to make up for it, thereby obtaining a PCR method for rapid and accurate detection and identification of Heilongjiang short groove snails, which can meet the needs of rapid and reliable detection and identification of Heilongjiang short groove snails, and provides a new technical means for the detection and identification of Heilongjiang short groove snails, which is of great significance for preventing the spread and diffusion of parasitic diseases with Heilongjiang short groove snails as intermediate hosts.

Description

Technical Field

[0001] The invention belongs to the field of molecular biological detection and identification, and specifically relates to a PCR detection and identification method for Heilongjiang short groove curl. Background Art

[0002] Semisulcospira amurensis (also known as Koreoleptoxis amurensis) belongs to the genus Semisulcospira in the class Gastropoda of the order Mesogastropoda of the family Pleuroceridae of the phylum Mollusca. Semisulcospira amurensis is an important first intermediate host of Clonorchis sinensis in my country. It is widely distributed in the Heilongjiang River, Songhua River and its tributaries, Mudanjiang River and Wusuli River basins, as well as lakes such as Jingbo Lake and Xingkai Lake. The eggs of Clonorchis sinensis can gradually develop into adults through the first intermediate host Semisulcospira amurensis, the second intermediate host fish and shrimp, and the final host humans and cats, and then damage the liver of the final host, thereby causing bile duct epithelial hyperplasia, obstructive jaundice, gallstones, cholecystitis and cholangitis, and even cirrhosis and bile duct cancer.

[0003] The study of the classification of intermediate host snails has practical significance for the prevention and control of Clonorchiasis sinensis and the biological research of snails. At present, some similar species of the Nephila family are difficult to distinguish, and it is difficult to identify species by combining morphological methods such as external morphology and internal anatomy. Therefore, a molecular biological identification method is needed to assist the morphological identification method to complete the identification of Heilongjiang short groove snails. Summary of the invention

[0004] The purpose of the first aspect of the present invention is to provide a molecular marker.

[0005] The second aspect of the present invention aims to provide an application.

[0006] The third aspect of the present invention aims to provide a product.

[0007] The fourth aspect of the present invention aims to provide a reagent or a kit.

[0008] The purpose of the fifth aspect of the present invention is to provide the use of the product of the third aspect of the present invention and / or the reagent or kit of the fourth aspect of the present invention.

[0009] The sixth aspect of the present invention aims to provide a method.

[0010] In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is:

[0011] The first aspect of the present invention provides a molecular marker for Heilongjiang short groove curl, characterized in that:

[0012] The molecular marker comprises a sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% homology to SEQ ID NO.1; the base sequence of SEQ ID NO:1 is: GTTTCT GGCTTTTACC CCCAGCACTA CTACTTTTACTTTCTTCTGCCGCTGTTGAAAGAGGTGTAGGAACAGGATGAACTGTTTACCCTCCTCTATCAGGAAATCTCGCCCATGCTGGGGGCTCTGTAGATTTAGCTATTTTTTCACTCCATTTGGCAGGCGCCTCTTCTATTCTAGGTGCCGTAAATTTTATTACAACTATTATTAATATACGATGGCGTGGAATACAGTTTGAACGACTTCCTTTATTTGTTTGATCTGTAAAAATTACTGCCA TCCTTCTCTTGCTT (5'-3').

[0013] The second aspect of the present invention provides the use of a substance for detecting a molecular marker according to the first aspect of the present invention in at least one of (a1) to (a6):

[0014] (a1) Identification of Heilongjiang short groove curl;

[0015] (a2) preparing products for identifying Heilongjiang short groove squid;

[0016] (a3) Screening Heilongjiang short groove curl;

[0017] (a4) Screening products of Heilongjiang short groove curling;

[0018] (a5) Detection of Heilongjiang short groove curl;

[0019] (a6) Preparation of products for detecting Heilongjiang short groove curl.

[0020] Preferably, the substance comprises a substance related to one or more detection techniques or methods selected from the group consisting of Northern blotting, PCR, biochip method, and nucleic acid sequencing method.

[0021] Preferably, the product comprises at least one of a reagent, a kit, a test paper, a chip, and a system.

[0022] The third aspect of the present invention provides a product comprising a substance for detecting the molecular marker of the first aspect of the present invention.

[0023] Preferably, the substance comprises a substance used in one or more detection techniques or methods selected from the group consisting of Northern blotting, PCR, biochip, and nucleic acid sequencing.

[0024] Preferably, the product comprises at least one of a reagent, a kit, a test paper, a chip, and a system.

[0025] Preferably, the product comprises a primer pair for amplifying the molecular marker described in the first aspect of the present invention.

[0026] Preferably, the product may also include probes for detecting the molecular markers described in the first aspect of the present invention.

[0027] Preferably, the sequences of the primer pairs for amplifying the molecular markers described in the first aspect of the present invention are as shown in SEQ ID 2 and 3; the base sequence of SEQ ID NO: 2 is: GTTTCTGGCTTTTACCCCCA (5'-3'); the base sequence of SEQ ID NO: 3 is: AAGCAAGAGAAGGATGGCAG (5'-3').

[0028] The fourth aspect of the present invention provides a reagent or kit comprising the primer pair and / or probe of the third aspect of the present invention.

[0029] Preferably, the kit further comprises Taq DNA polymerase, dNTP, PCR buffer, Mg 2+ At least one of .

[0030] A fifth aspect of the present invention provides use of any one of (1) to (2) in any one of (b1) to (b3);

[0031] (1) The product according to the third aspect of the present invention;

[0032] (2) The reagent or kit according to the fourth aspect of the present invention;

[0033] (b1) Identification of Heilongjiang short groove curl;

[0034] (b2) Screening of Heilongjiang short groove curl;

[0035] (b3) Detection of Heilongjiang short groove curl.

[0036] The sixth aspect of the present invention provides a method according to any one of (c1) to (c3):

[0037] (c1) A method for identifying Heilongjiang short-grooved snail, comprising detecting whether the genome of a snail sample to be tested contains the molecular marker described in the first aspect of the present invention; if the genome of the snail sample to be tested contains the molecular marker described in the first aspect of the present invention, the snail sample is Heilongjiang short-grooved snail; otherwise, it is not;

[0038] (c2) A method for screening Heilongjiang short groove snails, detecting whether the genome of the snail sample to be tested contains the molecular marker described in the first aspect of the present invention, and selecting the snail sample whose genome contains the molecular marker described in the first aspect of the present invention;

[0039] (c3) A method for detecting Heilongjiang short groove curled corydalis, detecting whether the genome of the test sample contains the molecular marker described in the first aspect of the present invention; if the genome of the test sample contains the molecular marker described in the first aspect of the present invention, then the test sample contains Heilongjiang short groove curled corydalis; otherwise, it does not contain it.

[0040] Preferably, the method for detecting whether the genome of the snail sample to be tested contains the molecular marker described in the first aspect of the present invention is: mixing the DNA of the sample to be tested with the primer pair and / or probe in the reagent or kit of the fourth aspect of the present invention, and performing PCR detection.

[0041] Preferably, the final concentration of the primer pair is 100-300 nM.

[0042] Preferably, the annealing temperature in the PCR reaction procedure is 50-60°C.

[0043] The beneficial effects of the present invention are:

[0044] The present invention provides a molecular marker of Heilongjiang short groove curl, and the molecular marker comprises a sequence with at least 95%, 96%, 97%, 98%, 99%, and 100% homology to SEQ ID NO.1. The molecular marker is used for detection, and the specificity is high, and the reliability of the result is fully guaranteed. When the traditional taxonomic method is difficult to identify Heilongjiang short groove curl and other black snails, the present invention uses molecular biology technology to make up for it, thereby obtaining a PCR method for rapid and accurate detection and identification of Heilongjiang short groove curl. It is highly practical and can meet the needs of rapid and reliable detection and identification of Heilongjiang short groove curl. The present invention provides a new technical means for the detection and identification of Heilongjiang short groove curl, which is of great significance for preventing the spread and diffusion of parasitic diseases with Heilongjiang short groove curl as intermediate hosts. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1The specificity test results of the specific primer pair of the present invention, wherein: M is a 2000bp DNA ladderMarker; lanes 1-2 are Amur scutellaria; lanes 3-4 are Pomacea canaliculata; lanes 5-6 are Pomacea canaliculata; lanes 7-8 are Pomacea square-shaped short groove snails; and lanes 9-10 are Pseudomonas tuberculosis. DETAILED DESCRIPTION

[0046] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0047] The primer pairs used in the present invention were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.

[0048] Example 1 Primer Design

[0049] The present invention screens specific molecular markers for Heilongjiang short groove snails, compares sequences with other snails, searches for specific sequences, and finally finds that a partial sequence of mitochondrial cytochrome oxidase subunit I of Koreoleptoxis amurensis isolate D464 has specificity: GTTTCTGGCTTTTACCCCCAGCACTACTACTTTACTTTCT TCTGCCGCTGTTGAAAGAGGTGTAGGAACAGGATGAACTGTTTACCCTCCTCTATCAGGAAATCTCGCCCATGCTGGGGGCTCTGTAGATTTAGCTATTTTTTCACTCCATTTGGCAGGCGCCTCTTCTATTCTAGGTGCCGTAAATTTTATTACAACTATTATTAATATACGATGGCGTGGAATACAGTTTGAACGACTTCCTTTATTTGTTTGATCTGTAAAAATTACTGCCATCCTTCTCTTGCTT (5'-3', SEQ ID NO: 1). Primers are designed and analyzed with the assistance of the NCBI website. After the specificity is tested by NCBI Blast, the optimal primers determined are as follows:

[0050] Forward primer: Sequence(5'to3'):GTTTCTGGCTTTTACCCCCA(SEQ ID NO:2);

[0051] Reverse primer: Sequence(5'to3'):AAGCAAGAGAAGGATGGCAG (SEQ ID NO: 3).

[0052] The amplified fragment size of this primer pair in Heilongjiang short groove curl is 290bp.

[0053] Example 2 Heilongjiang short groove curl PCR primer specificity test

[0054] 1. Material preparation

[0055] The snails tested included: Heilongjiang short-grooved snail, striped pond snail, golden apple snail, square short-grooved snail, and tubercle-shaped black snail, two of each type.

[0056] The above test snails were collected through parasite investigation and kept in the laboratory with dechlorinated water for future use. The above snails purchased conventionally in the market can also achieve the effect of the present invention.

[0057] 2. DNA Extraction

[0058] The sample genomic DNA was extracted using a kit extraction method (FlaPure Animal Tissue / Cell / Blood DNA Extraction Kit, a high-efficiency animal tissue / cell / blood genomic DNA extraction kit from Beijing Jinsha Biotechnology Co., Ltd.). The specific steps are as follows:

[0059] 1) Take a prepared snail sample, rinse it with clean water and wipe off the dust on its surface, rinse it again with 75% ethanol and wipe off the surface of the snail, then cut open the snail shell with scissors and tweezers disinfected with 75% ethanol, carefully remove the muscle tissue part, put it in 1*PBS buffer solution to wash several times, wipe off the surface moisture and put it in a sample freezing tube for later use.

[0060] 2) Place the muscle tissue removed in the previous step into a mortar and grind it with liquid nitrogen. Place the ground sample in a 1.5 mL centrifuge tube and add 200 μL of Buffer GA1.

[0061] 3) Add 20 μL Proteinase K (20 mg / mL), vortex and oscillate to mix thoroughly, and fully lyse in a 56°C water bath for 3 h. During this period, invert or oscillate several times to disperse the sample.

[0062] 4) Add 200 μL Buffer GA2, vortex and mix thoroughly, and place in a 70°C water bath for 10 min. After a brief centrifugation, add 200 μL anhydrous ethanol and immediately vortex and mix thoroughly to obtain a solution and flocculent precipitate.

[0063] 5) Centrifuge briefly, add all the solution and flocculent precipitate obtained in the previous step to the adsorption column (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm (~13,400×g) for 30 seconds, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0064] 6) Add 500 μL Buffer GW1 (anhydrous ethanol has been added according to the instructions) to the adsorption column, centrifuge at 12,000 rpm for 30 seconds, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0065] 7) Add 600 μL Buffer GW2 (anhydrous ethanol has been added according to the instructions) to the adsorption column, centrifuge at 12,000 rpm for 30 seconds, pour out the waste liquid in the collection tube, put the adsorption column back into the collection tube, and repeat this step once.

[0066] 8) Centrifuge at 12,000 rpm for 2 min, and leave to dry at room temperature for 2 min with the lid open.

[0067] 9) Place the adsorption column in a new centrifuge tube (self-prepared), add 50 μL ddH2O to the middle of the adsorption membrane, place at room temperature for 2 minutes, centrifuge at 12000 rpm for 2 minutes, collect the DNA solution, and store the DNA at -20°C.

[0068] 3. PCR amplification reaction

[0069] The total volume of the PCR reaction system is 50 μL, including 25 μL of 2xTransStarf FastPfu Fly PCR SuperMix, 1 μL of upstream and downstream primers (0.4 μM), 2 μL of DNA template (1 ng / μL), and the rest is made up with sterile ddH2O. After mixing, the mixture is placed in a PCR amplifier for amplification.

[0070] The PCR amplification reaction program was as follows: pre-denaturation at 98°C for 1 min; 35 cycles of 98°C for 10 s, 55°C for 5 s, and 72°C for 1 min; extension at 72°C for 1 min, and termination of the reaction at 4°C.

[0071] 4. PCR product detection and identification

[0072] Take 9 μL of the PCR product and run it on a 1.5% agarose gel (containing ethidium bromide) at 130 V for about 30 minutes, and observe it with a gel imager. If a band is observed at the position of 290 bp, it means that the snail sample detected is Heilongjiang short groove snail.

[0073] like Figure 1As shown in the figure, the test results showed that only the product amplified by the primer of Heilongjiang short groove curl amplified a bright band at the position of 290bp, while the primer did not amplify bands in the other four types of snails: Marsh snail, Pomacea canaliculata, Square short groove curl, Tumor black snail (as shown in the figure Figure 1 This indicates that the primers have good specificity and can identify Heilongjiang short-grooved snails in different snail samples.

Claims

1. A primer pair for identifying Heilongjiang short groove curl, characterized in that: The sequences of the primer pairs are shown in SEQ ID NOs. 2 and 3; The molecular marker of Heilongjiang short groove curled worm amplified by the primer pair is a sequence with 100% homology to SEQ ID NO:

1.

2. A kit for identifying Heilongjiang short-grooved curl, comprising the primer pair described in claim 1.

3. The kit according to claim 2, characterized in that: The kit also includes Taq DNA polymerase, dNTP, PCR buffer, Mg 2+ At least one of .

4. Use of the primer pair described in claim 1 in identifying Heilongjiang short groove curl.

5. Use of the kit according to claim 2 or 3 in identifying Heilongjiang short groove curl.

6. A method for identifying Heilongjiang short-grooved snail, detecting whether the genome of the snail sample to be tested contains the molecular marker described in claim 1. If the genome of the snail sample to be tested contains the molecular marker described in claim 1, the snail sample is Heilongjiang short-grooved snail; otherwise, it is not; the method for detecting whether the genome of the snail sample to be tested contains the molecular marker described in claim 1 is: mixing the DNA of the sample to be tested with the primer pair in the kit described in claim 2 or 3, and performing PCR detection.

7. The method according to claim 6, characterized in that: The final concentration of the primer pair is 100-300 nM; The annealing temperature in the PCR reaction procedure is 50-60°C.

Images