A new allelic variation of wheat leaf angle gene TaSPL8 and its CAPS marker and application

Abstract

The application discloses a CAPS marker of a new allelic variation of a wheat leaf angle gene TaSPL8 and application, and relates to the technical field of molecular biology and crop breeding. The application aims to solve the technical problem of how to identify the size of a wheat leaf angle. To this end, the application provides application of a composition for detecting polymorphism or genotypes of WB24 in a wheat genome in identification or auxiliary identification of the size of a wheat leaf angle, wherein the WB24 is a SNP in the wheat genome, the nucleotide type of which is C or T, and the nucleotide is located at the 324th nucleotide of SEQ ID No. 1. The application also provides a composition and / or a kit for detecting the WB24. The genotypes of the WB24 can be detected to rapidly realize screening and typing of the materials to be tested, rapid auxiliary selection at the seedling stage, accelerate improvement of the wheat leaf angle phenotype, and breed excellent varieties with ideal leaf angles.

Description

Technical Field

[0001] This application relates to the fields of molecular biology and crop breeding technology, and in particular to the CAPS marker and application of a new allelic variant of the wheat leaf angle gene TaSPL8. Background Technology

[0002] Wheat is one of the most important food crops, providing approximately 20% of the world's food calories. Ensuring stable and high yields is a key aspect of ensuring food security (SHIFERAW et al., 2013). The flag leaf angle is one of the important traits in high-yield wheat breeding. Since the flag leaf is the main organ for photosynthesis, providing the necessary carbohydrates for grain formation, an appropriate flag leaf angle can promote photosynthesis and light energy utilization efficiency during the grain-filling stage, thereby increasing wheat yield. Therefore, improving the flag leaf angle and morphology of wheat is of great significance for increasing yield. Summary of the Invention

[0003] The technical problem this application aims to solve is: how to determine the size of the angle between wheat leaves.

[0004] To address the aforementioned technical problems, this application provides the use of a composition for detecting the polymorphism or genotype of WB24 in the wheat genome in any of the following:

[0005] 1) Application in identifying or assisting in identifying the size of the angle between wheat leaves;

[0006] 2) Application in the preparation of products for identifying or assisting in the identification of the size of the angle between wheat leaves;

[0007] 3) Applications in wheat breeding or wheat-assisted breeding;

[0008] 4) Applications in the preparation of products for wheat breeding or wheat breeding assistance;

[0009] WB24 is a SNP in the wheat genome, and its nucleotide type is C or T. It is the 324th nucleotide in SEQ ID No. 1.

[0010] The composition for detecting the polymorphism or genotype of WB24 in the wheat genome can be used to determine the polymorphism or genotype of WB24 by at least one of the following methods. Required reagents and / or instruments include: restriction enzyme fragment length polymorphism (RLP), DNA sequencing, single-strand conformation polymorphism (SCM), denaturing high-performance liquid chromatography (HPLC), and SNP chips. The SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on one-step reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule-DNA binding reactions.

[0011] Furthermore, in the aforementioned applications, the composition may include primer pairs that amplify wheat genomic DNA fragments comprising the WB24.

[0012] Furthermore, in the aforementioned application, the primer pair may consist of primer WB24F and primer WB24R;

[0013] The primer WB24F can be a single-stranded DNA molecule with the nucleotide sequence SEQ ID No. 2.

[0014] The primer WB24R can be a single-stranded DNA molecule with the nucleotide sequence SEQ ID No. 3.

[0015] Furthermore, in the described application, the composition further includes the restriction endonuclease XmnI.

[0016] This application also provides the above-described compositions.

[0017] This application also provides a kit for identifying or assisting in the identification of the size of the angle between wheat leaves, the kit comprising the primer pair described above and the restriction endonuclease XmnI described above.

[0018] The kit may also include other reagents required for PCR amplification.

[0019] The kit may also include other reagents required for the restriction endonuclease XmnI to digest the amplification products.

[0020] The cleavage site of the restriction endonuclease XmnI is indicated by the arrows below.

[0021] 5'GAANN↓NNTTC 3';

[0022] 3'CTTNN↑NNAAG 5';

[0023] N can be any of the nucleotides A, T, C, or G.

[0024] This application also provides a method for identifying or assisting in the identification of the leaf-angle of wheat, the method comprising detecting the genotype of WB24 in the genome of the wheat to be tested, and identifying or assisting in the identification of the leaf-angle of the wheat to be tested based on the genotype of WB24; wherein WB24 is a SNP in the wheat genome, its nucleotide type is C or T, and it is the 324th nucleotide of SEQ ID No. 1.

[0025] Furthermore, based on the genotype identification or auxiliary identification of the wheat to be tested, the leaf angle of the wheat is as follows:

[0026] The leaf angle of the wheat test with genotypes C / C and C / T is greater than or candidate to be greater than the leaf angle of the wheat test with genotype T / T.

[0027] The C / C is a homozygous form of WB24 in the wheat genome where WB24 is C; the T / T is a homozygous form of WB24 in the wheat genome where WB24 is T; and the C / T is a heterozygous form of WB24 in the wheat genome where WB24 is both T and C.

[0028] Furthermore, in the method, the detection of the WB24 genotype in the wheat genome to be tested includes A1) or A2):

[0029] A1) Sequencing;

[0030] A2) Perform PCR amplification on the wheat genomic DNA to be tested using the primer pair described above, and then digest the amplification product with restriction endonuclease XmnI. Detect the number of bands in the digestion product: Determine the genotype of WB24 in the wheat genome to be tested based on the number of bands in the digestion product.

[0031] Further, in the method described in A2), the genotype of WB24 in the wheat genome to be tested is determined based on the number of bands in the enzyme digestion product:

[0032] If the enzyme digestion product shows one band, the genotype of WB24 in the wheat genome is C / C. If the enzyme digestion product shows three bands, the genotype of WB24 in the wheat genome is C / T or T / T.

[0033] In some embodiments of this application, the method for identifying or assisting in the identification of the Taspl8b genotype of the new allelic variant of the wheat leaf angle gene includes the following steps:

[0034] S1. Extract the wheat genomic DNA to be tested, and perform PCR amplification on the extracted DNA to obtain the amplification product; the primer sequences used for the PCR amplification are as follows: the upstream primer sequence is SEQ ID NO.2, and the downstream primer sequence is SEQ ID NO.3;

[0035] Primer sequences used for PCR amplification:

[0036] WB24F:5'TTGCCTAGCTACTGCATCGA 3'(SEQ ID NO.2)

[0037] WB24R:5'CCGAGCTGAAGGATGTTGCTA 3'(SEQ ID NO.3)

[0038] S2. The amplification product is digested with XmnI restriction endonuclease to obtain the digested product;

[0039] S3. Analyze the number of bands in the enzyme digestion products. When three enzyme digestion products are generated, the wheat to be tested is either homozygous small-leaf angle material (WB24 genotype T / T) or heterozygous material (WB24 genotype C / T); when the enzyme digestion product has only one main band, the wheat to be tested is large-leaf angle material (WB24 genotype C / C).

[0040] In step S1, the total PCR amplification system is 50 μL, including 25 μL of 2×Phanta Flash Master Mix, 200 ng of DNA, 20 μM upstream primer, 20 μM downstream primer, and ddH2O added to the 50 μL system; the reaction conditions are: 98℃ pre-denaturation for 30 s, 98℃ denaturation for 10 s, 60℃ annealing for 5 s, 72℃ extension for 5 s, for a total of 34 cycles; and finally, a full extension at 72℃ for 1 min.

[0041] In step S2, the total enzyme digestion system is 10 μL, including 0.2 μL of XmnI restriction endonuclease, 4 μL of PCR product, 1 μL of 10×NEB buffer, and ddH2O added to the total system of 10 μL; the reaction conditions are: enzyme digestion temperature 37℃, enzyme digestion reaction time 30 min.

[0042] In this application, the aforementioned wheat or the wheat to be tested can be a hybrid offspring of wheat A and wheat B, wherein wheat A is wheat carrying the WB24 nucleotide, and the nucleotide type of the WB24 is C; and wheat B is wheat carrying the WB24 nucleotide, and the nucleotide type of the WB24 is T or a combination of C and T. The hybrid offspring can be F2 generation or higher, such as F2 generation, BC1F2, F3 generation, etc.

[0043] Furthermore, the B wheat may specifically be wheat carrying the WB24, and the nucleotide type of the WB24 is T.

[0044] In some embodiments of this application, wheat A is wheat Jing 411, and wheat B is wheat mutant je0407.

[0045] This application also provides the application of the above-described methods in wheat breeding.

[0046] This application also provides a method for wheat breeding, comprising the following steps: selecting wheat with the genotype C / T and / or T / T of WB24 as parents for breeding, wherein WB24 is a SNP in the wheat genome, its nucleotide type is C or T, and it is the 324th nucleotide of SEQ ID No. 1, wherein T / T is the homozygous type of WB24 as T in the wheat genome; and C / T is the heterozygous type of WB24 as T and C in the wheat genome.

[0047] This application also provides a DNA molecule, the nucleotide sequence of which is SEQ ID No. 1.

[0048] In this application, the purpose of wheat breeding is to screen wheat with a target leaf angle size.

[0049] In this application, the wheat breeding specifically refers to screening wheat with a smaller leaf angle.

[0050] In this application, the leaf angle can be the flag leaf angle.

[0051] In this application, the wheat breeding may be wheat-assisted breeding.

[0052] In this application, the product may be a reagent and / or a kit.

[0053] Compared with the prior art, this application has the following beneficial effects:

[0054] The newly identified Taspl8b is a novel allelic variant of TaSPL8 that significantly reduces the wheat leaf angle, resulting in a compact plant architecture, without affecting ligule development. This application provides the CAPS marker for the novel wheat leaf angle gene allelic variant Taspl8b and its application. The CAPS marker WB24 can be used for marker-assisted breeding of wheat to distinguish leaf angle size, which is beneficial for accelerating the breeding of wheat with ideal plant architecture.

[0055] Taspl8b is a novel and superior allelic variant. The mutation of C to T at the 3012th base from the start codon can lead to a decrease in leaf angle without causing the loss of the ligule, thus enabling this gene to be used to improve leaf angle in wheat breeding. Attached Figure Description

[0056] Figure 1 The phenotypes and agronomic traits of mutants carrying the new allelic variant Taspl8b and their wild-types were studied.

[0057] Figure 2 The enzyme digestion results of the Taspl8b genotype carried by F2 single plants were detected by CAPS marker WB24.

[0058] Figure 3 CAPS marker WB24 was used to detect whether the F3 cells corresponding to some F2 individual plants carried the Taspl8b genotype.

[0059] Figure 4 CAPS marker WB24 was used to detect whether the F3 cells corresponding to some F2 individual plants carried the Taspl8b genotype. Detailed Implementation

[0060] The present application will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the present application and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present application in any way.

[0061] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0062] The wild-type wheat variety Jing 411 in the following examples is a known variety that has passed variety approval and was purchased from Beijing Seed Company.

[0063] The wheat upright leaf angle mutant je0407 described in the following examples is publicly available in the NCBI GenBank sequence information under GenBank numbers PP478096 (GenBank: PP478096.1) and PP502762. This biological material may be obtained from the applicant by the public within twenty years from the filing date of this application. The obtained biological material may only be used to verify the feasibility of the experiments in this application and may not be used for any other purpose.

[0064] In the following embodiments, the leaf angle refers to the flag leaf angle.

[0065] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0066] Example 1: Comparison of agronomic traits and CAPS marker selection between wild type and erect leaf angle mutant je0407

[0067] The wheat leaf angle gene TaSPL8 (TraesCS2D03G1119600) is located on chromosome 2D of the Chinese Spring Reference Genome v2.1. A C / T mutation at position 3012 (starting from the start codon) of this gene results in a change from leucine to phenylalanine at amino acid 243. This mutation significantly reduces the wheat leaf angle but does not affect ligule formation. This is a novel allelic variant of TaSPL8, named Taspl8b. A CAPS marker, WB24, was designed to detect this novel allelic variant of the wheat leaf angle gene, utilizing this mutation site. The leaf angle mutant je0407 is homozygous for the novel allelic variant Taspl8b.

[0068] Wild-type Jing 411 and the upright leaf angle mutant JEO407 were planted in the experimental field of the Institute of Crop Science, Chinese Academy of Agricultural Sciences in October 2021. Twenty plants were planted in each row, with a row length of 2 meters. When the wheat leaf angle trait stabilized in May of the following year, five mutant plants and five wild-type plants were randomly selected to measure the leaf angle. At the same time, the leaf angle was investigated. The differences between JEO407 and Jing 411 in various agronomic traits were statistically analyzed, and the significance of the differences in the data was analyzed using an independent samples t-test.

[0069] Genomic DNA was extracted from wheat varieties Jing 411 and Je0407. The extracted DNA was amplified by PCR using primers WB24F (single-stranded DNA molecule with SEQ ID No. 2) and WB24R (single-stranded DNA molecule with SEQ ID No. 3). The amplified products were then digested with XmnI restriction endonuclease to obtain the digested products. The number of bands of the target product was detected by DNA agarose gel electrophoresis. The total digestion volume was 10 μL, containing 0.2 μL of XmnI restriction endonuclease, 4 μL of PCR product, 1 μL of 10×NEB buffer, and ddH2O was added to the total volume of 10 μL. The reaction conditions were: digestion temperature 37℃, digestion time 30 min. The results are as follows: Figure 1 As shown, Figure 1 Leaf angle and agronomic traits of wild-type Jing411 and the mutant je0407 carrying the new allelic variant Taspl8b. a shows the enzyme digestion results of Jing 411 and the mutant je0407; b shows the whole plant phenotype of Jing 411 and the mutant je0407 in pots during the grain-filling stage; c shows the ear phenotype of Jing 411 and the mutant je0407; d shows the leaf pulvinus structure of Jing 411 and the mutant je0407; e shows the ligule structure of Jing 411 and the mutant je0407; f shows the grain length comparison of Jing 411 and the mutant je0407; g shows the grain width comparison of Jing 411 and the mutant je0407; h shows the plant height comparison of Jing 411 and the mutant je0407; i shows the flag leaf angle of Jing 411 and the mutant je0407; j shows the ear length of Jing 411 and the mutant je0407; and k shows the thousand-grain weight of Jing 411 and the mutant je0407.

[0070] Figure 1 The results showed that the wild-type Jing 411 amplification product had only one major band after enzyme digestion. Figure 1 (a) Its leaf phenotype is flat ( Figure 1 (c); The mutant je0407 can be digested into three bands, carrying a new Taspl8b allelic variant, exhibiting upright leaves, compact plant type, and no significant change in plant height. Figure 1 Although the pulvinus development of the middle b and h is delayed, the ligule development is normal. Figure 1(Ce). The leaf angle of the Taspl8b mutant je0407 ranged from 23.75° to 41.98°, significantly smaller than that of the wild-type Jing411 (89.75°–133.74°). Figure 1 (i). Meanwhile, compared to the wild-type Jing 411, the mutant je0407 showed no significant differences in grain length, grain width, thousand-grain weight, or ear length. Figure 1 (f, g, j, k).

[0071] The PCR amplification products were sequenced. Sequencing results showed that the nucleotide sequence of the PCR amplification product was SEQ ID No. 1. The nucleotide at position 324 of SEQ ID No. 1 was either C or T, representing a SNP in the wheat genome, named WB24. When using wheat genomic DNA from the Jing 411 variety as the amplification template, the genotype at the WB24 locus of the amplification product was homozygous for C, denoted as C / C. When using wheat genomic DNA from the mutant je0407 variety as the amplification template, the genotype at the WB24 locus of the amplification product was homozygous for T, denoted as T / T.

[0072] Example 2: Screening and identification of segregating populations using the CAPS marker WB24

[0073] Wild-type Jing411 was used as the male parent and the mutant je0407 as the female parent to construct a segregating population of offspring. The F1 generation was obtained by crossing wild-type Jing411 as the male parent and the mutant je0407 as the female parent. All individual plants in the F1 generation exhibited leaf angles greater than 80 degrees, showing a spreading leaf shape. This indicates that when the genotype at WB24 locus is heterozygous (C / T), the corresponding leaf angle is spreading. Self-pollination of the F1 generation yielded the F2 generation, and self-pollination of the F2 generation yielded the F3 generation. Marker analysis was performed on 80 individual F2 plants and their corresponding F3 plants. PCR products were obtained by PCR amplification of genomic DNA extracted from the segregating population using primers WB24F and WB24R. The PCR products were then digested with restriction endonuclease XmnI. The digested products were separated by 1% agarose gel electrophoresis. Individuals with a single band were identified as carrying the wild-type genotype, exhibiting a large leaf angle and a spreading leaf pattern. Individuals with three bands were identified as mutants or heterozygotes carrying the new allelic variant Taspl8b. Mutants exhibited a small leaf angle, while heterozygotes exhibited a spreading leaf pattern; these individuals require further isolation and identification in the next generation.

[0074] The results are as follows Figures 2-4 As shown, Figures 2-4The mid-markers, from bottom to top, are 100bp, 200bp, 500bp, 1000bp, and 2000bp. The results showed that single bands were observed in individual plants 1–5, 21–28, 41, 42, 45, 55, 56, 64, 65, 67, 68, and 73, and a single band was also observed in some F3 populations from 1–1 to 5–12. The genotype at WB24 locus was C / C. Figure 2 , Figure 3 This indicates that the individual plants do not carry the Taspl8b genotype, and all individual plants have leaf angles greater than 80 degrees, exhibiting a spreading phenotype (Table 1). The enzyme digestion products of individual plants 6–20, 33–40, 43, 44, 46, 48, 49, 52, 54, 57, 58, 59, 61, 69, 70, 71, 75, 76, 77, 78, and 79 show three bands. Furthermore, some of their F3 progeny groups 6–1–20–18, 34–1–34–7, and 37–1–37–6 also show three bands, and the leaf angles of individual plants are less than 25 degrees, indicating that they carry the Taspl8b genotype. The genotype at WB24 locus is T / T (…). Figure 2-4 (Table 1). The enzyme digestion products of individual plants at 29–32, 47, 50, 51, 53, 60, 62, 63, 66, 72, 74, and 80 showed three bands, and the leaf angle of individual plants was greater than 80 degrees. In some F3 progeny groups: 29-1, 29-2, 29-9, 29-10, 30-1, 30-2, 30-13, 30-15, 30-17, 31-6, 31-7, 31-8, 31-10... 31-11, 31-13, 31-14, 32-1, 32-2, 32-3, 32-10, 32-12, and 32-13 form a single band with a leaf angle greater than 80 degrees per plant; 29-3, 29-4, 29-5, 29-7, 29-13, 29-14, 29-15, 30-3, 30-4, 30-7, 30-9, 30-14, 30-19, 31-2, 3 1-4, 31-12, 32-4, 32-6, 32-8, 32-15, and 32-16 have three bands and the leaf angle of a single plant is greater than 80 degrees; 29-8, 29-11, 29-12, 29-16, 30-5, 30-6, 30-8, 30-10, 30-11, 30-12, 30-16, 30-18, 31-1, 31-3, 31-5, 31-9, and 32... -5, 32-7, 32-9, 32-11, 32-14, 32-17, 34-1, 34-2, 34-3, 34-4, 34-5, 34-6, 34-7, 37-1, 37-2, 37-3, 37-4, 37-5, and 37-6 show three bands and the leaf angle of a single plant is less than 25 degrees, indicating that plants 29–32 are heterozygous, and the genotype at WB24 is C / T. Figure 4 (Table 1).

[0075] The WB24 locus genotype obtained by CAPS combined with phenotypic identification was consistent with the sequencing verification results.

[0076] F2 generation plants numbered 1-80 and F3 generation plants numbered 1-1 to 37-6 all possessed leaf ligules. Analysis of variance showed that there was no significant difference in leaf angle between the C / C and C / T genotype plants, while the leaf angle of the T / T genotype plants was significantly smaller (Table 2).

[0077] The above experiments show that the new allelic variant Taspl8b of the TaSPL8 gene significantly reduces the leaf angle without affecting the development of the ligule. Furthermore, the CAPS marker WB24 can be used for marker-assisted selection, enabling high-throughput, rapid seedling-stage assisted selection and accelerating the breeding of wheat varieties with ideal leaf angle phenotypes.

[0078] Table 1. Specific data on WB24 genotype and leaf angle in the segregating population.

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095] Table 2. Statistical data on WB24 marker genotypes and leaf angles in segregating populations

[0096] genotype Quantity (plants) Leaf angle (degrees) C / C 117 104.66±14.55a C / T 36 103.70±13.79a T / T 309 18.21±3.90b

[0097] Table 3 Sequences in this application

[0098]

[0099]

[0100] Note: In SEQ ID No. 1, the y at position 324 represents nucleotide T or C.

[0101] The present application has been described in detail above. Those skilled in the art will recognize that the present application can be implemented in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments are given in this application, it should be understood that further modifications can be made to the present application. In summary, in accordance with the principles of this application, this application is intended to include any changes, uses, or improvements to the present application, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. The application of a composition for detecting the polymorphism or genotype of WB24 in the wheat genome in any of the following: 1) Application in identifying or assisting in identifying the size of the angle between wheat leaves; 2) Application in the preparation of products for identifying or assisting in the identification of the size of the angle between wheat leaves; 3) Application in breeding or assisted breeding of wheat leaf angle; 4) Application in the preparation of products for breeding or assisted breeding of wheat leaf angle size; WB24 is a SNP in the wheat genome, and its nucleotide type is C or T. It is the 324th nucleotide in SEQ ID No.

1.

2. The application according to claim 1, characterized in that, The composition includes a primer pair that amplifies a wheat genomic DNA fragment comprising the WB24.

3. The application according to claim 1 or 2, characterized in that, The composition also includes the restriction endonuclease XmnI.

4. A method for identifying or assisting in the identification of the size of the included angle of wheat leaves, characterized in that, The method includes detecting the genotype of WB24 in the genome of the wheat to be tested, and identifying or assisting in identifying the leaf angle of the wheat to be tested based on the genotype of WB24; WB24 is a SNP in the wheat genome, and its nucleotide type is C or T, and it is the 324th nucleotide of SEQ ID No.

1.

5. The method according to claim 4, characterized in that, The genotype of WB24 in the wheat genome to be tested includes A1) or A2): A1) Sequencing; A2) Perform PCR amplification on the wheat genomic DNA to be tested using the primer pair described in claim 2, then digest the amplification product with restriction endonuclease XmnI, and detect the number of bands in the digestion product: determine the genotype of WB24 in the wheat genome to be tested based on the number of bands in the digestion product.

6. The application of the method according to claim 4 or 5 in the breeding of wheat leaf angle size.

7. A method for breeding wheat leaf angle trait, comprising the following steps: selecting wheat with genotype T / T of WB24 as parents for breeding, wherein WB24 is a SNP in the wheat genome, its nucleotide type is C or T, and it is the 324th nucleotide of SEQ ID No. 1, and T / T is the homozygous type of WB24 as T in the wheat genome.

Images