A hair growth-promoting recombinant collagen xvii and a preparation method and application thereof

Abstract

The application discloses a kind of recombination XVII type collagen of promoting hair growth and its preparation method and application, the recombination XVII type collagen is formed by a plurality of repeating units in series, wherein the amino acid sequence of repeating unit is: SHSRGSSSSSHSSSVRRGSSYSSSMS.Due to the higher serine content in the amino acid sequence of XVII type recombination collagen of the application, it has better hair growth promoting effect, so it can be widely applied to the preparation of hair growth promoting related cosmetics and medical devices.Moreover, the XVII type recombination collagen of the application is formed by a plurality of repeating units in series, and the repeating unit is derived from the amino acid sequence of natural XVII type collagen, so it has the advantages of good biocompatibility and high safety.At the same time, the preparation method of the XVII type recombination collagen of the application is simple and easy to operate, suitable for industrial large-scale production, so it has broad application prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological chemical industry, in particular to a recombinant collagen XVII for promoting hair growth and a preparation method and application thereof. BACKGROUND

[0002] Collagen is one of the most abundant proteins in the animal body, which is widely distributed in the skin, skeleton, tendon, ligament, cartilage and blood vessels of mammals. It is the main protein component of connective tissue and an important component of extracellular matrix. The content of collagen in the human body accounts for 25-30% of the total protein, and it is rich in amino acids such as glycine, proline and hydroxyproline needed by the human body. Collagen is closely related to tissue formation, maturation, cell information transmission, joint lubrication, wound healing, calcification, blood coagulation and aging, and is one of the most critical raw materials in the biotechnology industry. Collagen has a wide range of applications in medicine, food, beauty and biological materials, and has been a research hotspot in recent years.

[0003] Currently, the main source of industrialized collagen is extracted from animal skin, bone, connective tissue and other tissues by acid, alkaline hydrolysis and enzymatic hydrolysis. However, collagen extracted from animal tissues has the risk of animal-derived diseases, and large-scale production puts great pressure on animal feeding on the supply side.

[0004] With the improvement of modern living standards, people's life pressure is also increasing, and the problem of hair loss is also becoming more and more serious. Studies have shown that collagen, especially collagen XVII, can regulate the adhesion, separation and developmental differentiation of epithelial cells, and plays an important role in the differentiation of keratinocytes and the regeneration of hair follicle stem cells. Since the content of human collagen XVII in the human body is extremely low, and it is a non-extracellular secretory collagen, its amino acid chain is long and the molecular weight is large, making it very difficult to extract directly and mass-produce. At the same time, animal-derived collagen products inevitably have immunogenicity and potential biological safety hazards such as viruses, and have not been widely used so far. With the gradual increase of market acceptance of recombinant collagen, the market demand for recombinant collagen is gradually increasing, so the mass production of recombinant collagen is currently in urgent need.

[0005] Recombinant collagen can be obtained by constructing truncated proteins or truncated peptides of natural collagen. However, the uncertainty of the position and length of the truncated protein in natural collagen makes the number of types of recombinant collagen theoretically several million. However, there is a lack of effective theoretical guidance on which of these recombinant collagens can have higher secretion yield, and the best results must be screened through a large number of experimental verifications, which is the main reason for the small number of types of recombinant collagen currently mass-produced.

[0006] In view of this, the present application is proposed. SUMMARY

[0007] The present application aims to provide a hair growth promoting recombinant collagen XVII and a preparation method and application thereof, which has good hair growth promoting effect.

[0008] The present application is implemented as follows:

[0009] In the first aspect, the present application provides a recombinant collagen XVII formed by a plurality of repeating units in series, wherein the amino acid sequence of the repeating unit is shown in SEQ ID NO. 1.

[0010] In some embodiments, the number of the repeating units in the recombinant collagen XVII is 5-7.

[0011] In some embodiments, the number of the repeating units in the recombinant collagen XVII is 6.

[0012] In some embodiments, the amino acid sequence of the recombinant collagen XVII is shown in SEQ ID NO. 2.

[0013] In the second aspect, the present application provides a nucleic acid molecule encoding the recombinant collagen XVII.

[0014] In the third aspect, the present application provides an expression cassette comprising the nucleic acid molecule.

[0015] In the fourth aspect, the present application provides an expression vector comprising the expression cassette.

[0016] In the fifth aspect, the present application provides a host cell comprising the recombinant collagen XVII or the nucleic acid molecule or the expression cassette or the expression vector.

[0017] In the sixth aspect, the present application provides a preparation method of the recombinant collagen XVII, comprising: expressing the recombinant collagen XVII by using the host cell, and then performing separation and purification, so as to obtain the recombinant collagen XVII.

[0018] In the seventh aspect, the present application provides an application of the recombinant collagen XVII in preparing a hair growth promoting product, wherein the product comprises a medicine, a cosmetic or a medical device.

[0019] In some embodiments, the product comprises the cosmetic and the medical device.

[0020] In some embodiments, the medical device comprises a collagen microneedle, a scalp injection solution and an injection gel.

[0021] In an eighth aspect, the present application provides a hair growth promoting product comprising the recombinant collagen XVII described above.

[0022] The present application has the following advantages:

[0023] (1) The recombinant collagen XVII of the present application is formed by a plurality of repeating units in series, and the repeating units are derived from the amino acid sequence of natural collagen XVII, thus having the advantages of good biocompatibility and high safety.

[0024] (2) The recombinant collagen XVII of the present application has a higher content of serine in the amino acid sequence, thus having a good hair growth promoting effect, and can be widely used in the preparation of hair growth promoting related cosmetics and medical devices.

[0025] (3) The preparation method of the recombinant collagen XVII of the present application is simple and easy to operate, and is suitable for industrial large-scale production, thus having a broad application prospect. DETAILED DESCRIPTION

[0026] In order to make the purpose, technical scheme and advantages of the embodiments of the present application clearer, the technical scheme of the embodiments of the present application will be described clearly and completely below. Unless otherwise specified in the embodiments, the conditions are carried out according to the conventional conditions or the conditions recommended by the manufacturer. Unless otherwise specified, the reagents or instruments used are conventional products that can be purchased on the market.

[0027] Unless otherwise defined in the following, all technical and scientific terms used in the detailed description of the present application are intended to have the same meaning as commonly understood by one of ordinary skill in the art. Although it is believed that the following terms are well understood by one of ordinary skill in the art, the following definitions are set forth to better clarify the present application.

[0028] As used in the present application, the terms "comprise", "include", "have", "contain", or "involve" are inclusive or open-ended, and do not exclude other unlisted elements or method steps. The term "consist of" is considered to be a preferred embodiment of the term "comprise". If a group is defined in the following to comprise at least a certain number of embodiments, this is also to be understood as disclosing a group that preferably consists only of these embodiments.

[0029] The indefinite article "a" or "an" or the definite article "the" used in connection with a singular noun, for example, includes the plural form of the noun unless the context clearly dictates otherwise.

[0030] The following are provided only to aid in the understanding of the present application. These definitions should not be construed as having a scope less than that understood by those skilled in the art.

[0031] The technical solutions of the present application will be further described in detail in the manner of specific embodiments, but do not constitute any limitation on the present application, and any limited modifications made by anyone within the scope of the claims of the present application are still within the scope of the claims of the present application.

[0032] The present application provides a type XVII recombinant collagen (referred to as XVII2606) formed by a plurality of repeated units in series, and the amino acid sequence of the repeated unit is: SHSRGSSSSSHSSSVRRGSSYSSSMS (SEQ ID NO. 1).

[0033] It is generally believed in the art that the serine-related sequence in the type XVII recombinant collagen is related to hair growth. The inventors of the present application selected a polypeptide fragment with a high serine content as shown in SEQ ID NO. 1 from the natural type XVII collagen amino acid sequence, used the fragment as a repeated unit, and repeated it multiple times to obtain a new type XVII recombinant collagen. It has been verified that the type XVII recombinant collagen has good hair growth promoting effect.

[0034] The number of repetitions of the repeated unit can be 5, 6 or 7 times, and the number of repetitions is preferably 6 times. The recombinant collagen composed of 6 repeated units in series consists of 156 amino acids, and the specific amino acid sequence is:

[0035] SHSRGSSSSSHSSSVRRGSSYSSSMSSHSRGSSSSSHSSSVRRGSSYSSSMSSHSRGSSSSSHSSSVRRGSSYSSSMSSHSRGSSSSSHSSSVRRGSSYSSSMSSHSRGSSSSSHSSSVRRGSSYSSSMSSHSRGSSSSSHSSSVRRGSSYSSSMS (SEQ ID NO. 2).

[0036] In specific embodiments, in order to facilitate subsequent separation and purification, the above-mentioned type XVII recombinant collagen also has a tag that makes it easy to purify.

[0037] Protein tags are a technology that uses gene cloning means to fuse polypeptides, protein domains, or even complete proteins with specific functions to the target protein to achieve the application of target protein expression, purification, detection and tracking. Protein tags can be roughly divided into three categories of detection tags, expression and purification tags, and tracking tags according to their functions. The commonly used expression and purification tags at present are: His, GST, MBP, CBD, Strep-tag, Halo-Tag, SNAP-tag, SUMO, NusA, TrxA, DsbA, Flag and c-Myc.

[0038] In a specific embodiment, the purification tag attached to the above-mentioned type XVII recombinant collagen includes a His tag, a Flag tag, or a c-Myc tag.

[0039] The present application provides a nucleic acid molecule encoding the above-mentioned type XVII recombinant collagen.

[0040] A nucleic acid molecule is a general term for deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), which is a biological macromolecular compound polymerized by many nucleotide monomers, and is one of the most basic substances of life. The nucleotide sequence refers to the arrangement order of bases in DNA or RNA. The nucleic acid molecule contains cDNA, and in some cases, the nucleic acid molecule can be modified for use in the vector of the present application, such as for codon optimization. In some cases, the sequence can be designed to contain a terminal restriction site sequence for the purpose of cloning into a vector. The nucleic acid molecule can be obtained from various sources, such as by polymerase chain reaction (PCR) amplification of the encoding nucleic acid in or isolated from one or more given cells.

[0041] In a specific embodiment, the above-mentioned nucleic acid molecule can be synthesized artificially after optimizing the relevant gene sequence according to the codon preference of the host cell. It should be understood that the nucleic acid molecule capable of being translated into the above-mentioned amino acid sequence is within the scope of protection of the present application.

[0042] The present application provides an expression cassette comprising the above-mentioned nucleic acid molecule. At the same time, the expression cassette also contains regulatory sequences such as promoters and terminators.

[0043] An expression cassette refers to a nucleic acid construct comprising a coding sequence and regulatory sequences operably linked when introduced into a host cell, resulting in transcription and / or translation of RNA or polypeptide, respectively. The expression cassette should be understood to include a promoter that allows transcription to start, an open reading frame of the gene of interest, and a transcription terminator. Generally, the promoter sequence is placed upstream of the gene of interest, and the distance between the promoter sequence and the gene of interest is compatible with expression control.

[0044] In a specific embodiment, the above-mentioned expression cassette comprises one or more "promoter-gene of interest-transcription terminator" structural units from upstream to downstream.

[0045] The present application provides an expression vector comprising the above-mentioned nucleic acid molecule or expression cassette.

[0046] An expression vector refers to a self-replicating DNA molecule in genetic engineering recombinant DNA technology that transfers a DNA segment (a gene of interest) to a recipient cell. In addition to commonly used E. coli plasmid vectors, many other artificially constructed plasmid vectors suitable for microorganisms, yeasts, plants, etc. have been developed. The vector includes, but is not limited to, a single-stranded, double-stranded, or partially double-stranded nucleic acid molecule; a nucleic acid molecule comprising one or more free ends, without free ends (e.g., circular); a nucleic acid molecule comprising DNA, RNA, or both; and other polynucleotide species known in the art. The most commonly used vector type is "plasmid", which refers to a circular double-stranded DNA ring that can insert additional DNA fragments, for example, by standard molecular cloning techniques. Certain vectors are capable of autonomous replication in the host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell and thereby replicate with the host genome. Moreover, certain vectors are capable of directing the expression of genes of interest. Such vectors are referred to herein as "expression vectors". A recombinant expression vector can comprise a form suitable for expressing a nucleic acid in a host cell, meaning that the recombinant expression vector includes one or more regulatory elements, which can be selected based on the host cell used for expression, which can be operably linked to the nucleic acid sequence to be expressed.

[0047] The present application provides a host cell comprising the above-mentioned nucleic acid molecule or the above-mentioned expression cassette or the above-mentioned expression vector, and the host cell is capable of expressing the above-mentioned type XVII recombinant collagen.

[0048] A host cell refers to any cell type that is susceptible to transformation, transfection, transduction, etc. with a nucleic acid construct or expression vector comprising a polynucleotide of the present application. "Host cell" encompasses any progeny of the parent cell which result from the replication of the parent cell, which can not be identical to the parent cell due to natural and spontaneous mutation that can occur during replication. A host cell can be any cell useful in the production of type XVII recombinant collagen of the present application. To produce type XVII recombinant collagen, a nucleic acid encoding type XVII recombinant collagen can be isolated and inserted into one or more vectors for further cloning and / or expression in a host cell. This nucleic acid can be readily isolated and sequenced using conventional techniques, e.g., by using oligonucleotide probes that are specific to genes encoding recombinant collagen. The above-mentioned host cell refers to a cell into which a foreign nucleic acid has been introduced, including the progeny of such a cell. The host cell includes transformants and transformed cells, including the primary transformed cell and progeny derived therefrom, regardless of the number of passages. The progeny can not be identical to the parent cell in nucleic acid content due to mutations that occur during replication, but can contain mutations. Methods for introducing vectors into host cells are well known, for example, using electroporation to introduce vectors into host cells, which can also be transfection, microinjection techniques, biolistic techniques, liposome-mediated methods, etc.

[0049] In specific embodiments, the host cell described above can be a prokaryotic cell or a eukaryotic cell, including: bacterial hosts such as Escherichia coli, Bacillus subtilis, Bacillus licheniformis, etc.; eukaryotic hosts such as Pichia pastoris, Saccharomyces cerevisiae, animal cells, plant cells, etc., preferably, the host cell is Escherichia coli or Pichia pastoris, more preferably, the host cell is Pichia pastoris.

[0050] The present application provides a preparation method of type XVII recombinant collagen, which comprises: expressing type XVII recombinant collagen by using the host cell described above, and then performing separation and purification, so as to obtain the type XVII recombinant collagen.

[0051] In specific embodiments, expressing by using the host cell means that the host cell is cultured, and the culture medium and culture conditions are well known to those skilled in the art.

[0052] As for the expression mode, the present application does not make any limitation, which can be selected and adjusted as required, for example, the expression can be one of constitutive expression, induced expression or a combination of the two expressions, and the inducer of induced expression can be IPTG, beta-galactoside, methanol, ethanol, etc.

[0053] As for the separation and purification method, it comprises one or a combination of several methods such as salting-out, chromatography, affinity chromatography, acid-base precipitation, membrane separation, etc., preferably, the combination of chromatography and membrane separation, more preferably, the combination of ion exchange chromatography and membrane separation.

[0054] The present application provides an application of the type XVII recombinant collagen described above in preparing a hair growth promoting product, and the product described above comprises a medicine, a cosmetic or a medical device, preferably, the product described above comprises a cosmetic and a medical device.

[0055] The medical device described above comprises a collagen microneedle, a scalp injection solution and an injection gel.

[0056] The present application provides a hair growth promoting product comprising the type XVII recombinant collagen described above. The present application performs a hair growth function test on the back of a mouse by using the type XVII recombinant collagen of the present application, and the result shows that the type XVII recombinant collagen of the present application has a greater effect on the hair growth length than the existing type XVII collagen, and has a more prominent effect on promoting the growth of new hair follicles, so that the type XVII recombinant collagen of the present application can be widely applied in the preparation of a hair growth promoting product.

[0057] This specification is considered sufficient to enable one skilled in the art to practice the application. Various modifications of the application in accordance with the preceding description will be apparent to those skilled in the art from the foregoing description, and fall within the scope of the appended claims, apart from those shown and described.

[0058] Example 1

[0059] This example is the preparation of XVII2606 in a yeast expression system, and the specific operation method is as follows:

[0060] I. Experimental method

[0061] 1. Preparation of shuttle plasmid

[0062] According to the amino acid sequence shown in SEQ ID NO. 2, the codon optimization of the yeast expression system is carried out, and the target gene sequence of XVII type-β1 is obtained, and the nucleotide sequence is shown in SEQ ID NO. 3: TCACACTCAAGAGGTAGTAGTAGTAGTTCTCATTCCAGTTCTGTTCGTAGGGGCTCATCATATTCTTCATCCATGTCTTCACACTCAAGAGGATCCTCTAGTAGTTCCCACTCTTCTAGTGTTAGGAGAGGTTCCTCCTACAGTTCCTCTATGTCTTCTCACAGTAGAGGATCCTCTTCTTCCTCTCACTCTTCTTCCGTCAGAAGAGGTAGTTCCTACTCTTCTTCCATGTCTTCTCACTCTAGAGGATCATCTTCATCATCTCATTCTTCATCCGTGAGAAGAGGCTCTTCTTACTCCAGTTCCATGAGTTCCCATAGTAGGGGATCATCATCTTCTTCTCACTCCTCATCAGTTAGAAGAGGATCTTCCTACTCTAGTTCCATGTCCTCTCATTCCAGGGGATCTAGTAGTTCTTCACACTCTTCTTCTGTGAGGCGTGGATCCTCTTATAGTTCTTCTATGTCT.

[0063] The obtained target gene sequence is entrusted to GenScript Biotech Corporation for gene synthesis, and the synthesized gene is connected into pPicZαA plasmid to obtain pPicZαA-XVII-β1 plasmid.

[0064] 2) Preparation of yeast expression strain

[0065] The pPicZαA-XVII-β1 linearized with Pme I was transformed into Pichia pastoris X-33 competent cells, and the transformants were screened with the blasticidin resistance as a screening marker, to obtain a yeast expression strain.

[0066] 2. Induced expression of target protein

[0067] (1) A single colony of the constructed yeast expression strain was picked and added to 5 mL of YPD liquid medium (1% yeast extract, 2% peptone, and 2% glucose), and cultured at 30°C, 200 rpm for 48 h for activation;

[0068] (2) The culture was transferred into a 500 mL triangular flask (containing 200 mL of YPD medium) at a 1% inoculation amount, and cultured at 30°C, 200 rpm for 24 h as a seed for the upper tank;

[0069] (3) A BSM medium was prepared in a 5 L fermenter, sterilized at 121°C for 20 min, and cooled to 30°C, and then the pH was adjusted to 5.0. The seed prepared in (2) was added to the fermenter by flame inoculation for fermentation culture;

[0070] (4) When the OD 600 of the culture reached 70, 50% glycerol was added, and the OD 600 was maintained at about 120, and the addition of glycerol was stopped. When the dissolved oxygen rebounded to 100%, methanol was added for induction;

[0071] (5) During the induction, the dissolved oxygen was controlled to be no less than 30%, and the pH was about 5.0. The induction was performed for 40 h, and the fermentation was ended. The culture liquid was centrifuged at 12000 rpm for 2 min, and the supernatant was collected. The protein yield and purity were detected by the BCA method and SDS-PAGE method.

[0072] 3. Collagen purification

[0073] The obtained fermentation liquid of the engineering bacteria was separated from the bacteria liquid and bacteria body using a Thermo Fisher table centrifuge, and the supernatant was collected. The collected supernatant was passed through a 10KD ultrafiltration membrane. The buffer was configured according to the characteristics of the protein: 25mM / L potassium phosphate buffer (A liquid, pH 6.0), and 20mM / L potassium phosphate buffer + 1mol / L Nacl (B liquid, pH 6.0) as the eluent. The collected supernatant was adjusted in pH, filtered, and then loaded onto an MMC hydrophobic cation exchange chromatography column. Before loading, the column was equilibrated with A liquid. After loading, 25% B liquid was used to wash the impurities, and finally B liquid was used for elution. The obtained protein was freeze-dried to obtain XVII2606.

[0074] The recombinant collagen proteins of fragments with 5 (XVII2605) and 7 (XVII2607) repeated times were prepared by the same method, and were used for comparison of hair growth function evaluation.

[0075] Example 2

[0076] Evaluation of hair growth function of recombinant collagen obtained in Example 1

[0077] A comparative test of hair growth function was performed using the recombinant collagen in Example 1 and a commercially available type XVII collagen.

[0078] 1. Test grouping and dosage

[0079] A commercially available collagen (8 mg / mL) was used as a positive control group, and XVII2606 (8 mg / mL), XVII2605 (8 mg / mL), and XVII2607 (8 mg / mL) in Example 1 were used as test groups, and a physiological saline negative control group was also set up, with 10 mice in each group.

[0080] 2. Test method

[0081] Fifty 7-week-old C57 mice were randomly divided into 5 groups, with 10 mice in each group. One day before the test, the hair on the back skin of the mice in the range of about 2 cm x 4 cm was shaved short using a pet hair clipper, and an appropriate amount of depilatory cream was applied. After about 1 min, the depilatory cream was wiped off using a wet cotton ball to depilate the mice. The skin of the depilated mice was pink in color, smooth in surface, and free of ulceration and melanin deposition. The day of depilation was recorded as day 0, and the day after depilation was recorded as day 1. From day 1, the mice in each group were applied with different drugs once a day, 0.1 mL each time, for 15 consecutive days. From the 3rd day after application, the length of the longest root of the newly grown hair in the depilation area of each mouse in each group was measured every 3 days using a vernier caliper, and the average value was calculated as the hair growth length of the mouse. After 15 days, the area of the depilation area was taken with the skin, and the hair on the skin was carefully pulled out with tweezers. Finally, the skin tissue in the experimental area was fixed with 10% formaldehyde, and 4 pieces of tissue were taken continuously along the longitudinal section of the hair follicle, each 1 cm long, for routine tissue dehydration, paraffin embedding, HE staining, and light microscope observation. The number of new hair follicles in the dermis layer of the mouse skin tissue was counted in 5 fields of view at 40 times magnification, and the average number was calculated.

[0082] 3. Statistical processing

[0083] The experimental data were expressed as mean ± standard deviation (x ± SD), and statistical analysis was performed using the statistical software package SPSS 22.0. The t-test was used for comparison between the drug administration group and the negative control group, and P < 0.05 indicated that the difference was significant, and P < 0.01 indicated that the difference was very significant.

[0084] 4. Results and analysis

[0085] 4.1 Effect on the length of mouse hair

[0086] The effects of different doses of XVII2606 and commercially available collagen XVII on the hair length of mice are shown in Table 1.

[0087] Table 1 Effects of different doses of XVII2606 and commercially available collagen XVII on the hair length of mice (unit: mm)

[0088]

[0089] Note: ** represents P<0.01 compared with the negative control group, and ## represents P<0.01 compared with the positive control group.

[0090] As shown in Table 1, commercially available collagen XVII and XVII2605, XVII2606 and XVII2607 in the application can all significantly promote the hair growth of mice, and the hair growth length has a significant difference compared with the negative control group from the 6th day. The drug effect of XVII2606 in the application has a good correlation with the dose of the drug, and the hair growth length of XVII2606 in the application has a significant difference compared with the positive control group from the 6th day, indicating that the effect of XVII2606 in the application on promoting hair growth is better than that of commercially available collagen XVII, and the hair growth effect of 6 times is better than that of 5 times and 7 times, that is, XVII2606 in the application has a better effect on promoting hair growth.

[0091] 4.2 Effects on the number of new hair follicles in the dermis layer of the skin tissue of mice

[0092] The effects of XVII2605, XVII2606, XVII2607 and commercially available collagen XVII on the number of new hair follicles in the dermis layer of the skin tissue of mice are shown in Table 2.

[0093] Table 2 Effects of XVII2605, XVII2606, XVII2607 and commercially available collagen XVII on the number of new hair follicles in the dermis layer of mice

[0094]

[0095]

[0096] Note: ** represents P<0.01 compared with the negative control group, and ## represents P<0.01 compared with the positive control group.

[0097] As shown in Table 2, compared with the negative control group, the commercially available collagen XVII type XVII and the XVII2605, XVII2606 and XVII2607 of the present application can significantly increase the number of new hair follicles in the dermis of the mice in the administration group, and the XVII2606 of the present application has the greatest effect on the number of new hair follicles in the dermis of the mice, indicating that the XVII2606 of the present application can strengthen the nutrition of hair follicles, promote hair growth and regeneration, and the effect is significantly better than that of the commercially available collagen XVII type XVII.

[0098] The above description is merely preferred embodiments of the present application but not for limiting the present application. For those skilled in the art, the present application can have various modifications and changes. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A recombinant collagen of type XVII, characterized in that, The amino acid sequence of the XVII type recombinant collagen is shown as SEQ ID NO.

2.

2. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the XVII type recombinant collagen of claim 1.

3. An expression cassette comprising, The expression cassette comprises the nucleic acid molecule of claim 2.

4. An expression vector, characterized by, The expression vector contains the expression cassette of claim 3.

5. A host cell, characterized in that, The host cell comprises the XVII type recombinant collagen of claim 1, or the nucleic acid molecule of claim 2, or the expression cassette of claim 3, or the expression vector of claim 4.

6. A method for producing a recombinant collagen of type XVII, characterized by, Comprise: The XVII type recombinant collagen is expressed by the host cell of claim 5, and then separated and purified, so as to obtain the XVII type recombinant collagen.

7. Use of the recombinant collagen XVII according to claim 1 for the preparation of a product for promoting hair growth, characterized in that, The product is a drug, a cosmetic or a medical device.

8. Use according to claim 7, characterized in that, The product is a cosmetic and a medical device.

9. A hair growth promoting product, characterized by, Comprise the XVII type recombinant collagen of claim 1.

Images