CAR molecules, CAR cells, CAR drug compositions and their applications

Abstract

The present application relates to the field of biomedical technology, and specifically to CAR molecules, CAR cells, CAR pharmaceutical compositions and their applications. The CAR molecule includes an extracellular domain, a transmembrane domain, and an intracellular domain; the extracellular domain includes an antigen binding domain and a multimerization / dimerization domain in sequence. The present application transforms the extracellular structure to improve the polymerization ability of the CAR molecule, which helps to improve the activation efficiency of CAR immune cells, promote the formation of stable and orderly immune synapses, and thus enhance the anti-tumor function of CAR immune cells.

Description

Technical Field

[0001] The present application relates to the field of biomedicine technology, and specifically to CAR molecules, CAR cells, CAR pharmaceutical compositions and their applications. Background Art

[0002] Malignant tumors are one of the diseases with the highest morbidity and mortality in the world, and it is imperative to develop new tumor treatments.

[0003] In recent years, immunotherapy represented by chimeric antigen receptor modified T (CART) cell therapy has achieved great success and has become a new hot spot in the field of tumor treatment. However, some shortcomings of CAR T cells themselves have greatly limited the long-term benefits of CAR T therapy, such as the lack of CAR T cells' ability to recognize and kill tumor cells with low antigen expression, and the difficulty of CAR T cells to be maintained in the body for a long time due to exhaustion. The current optimization research mainly focuses on the intracellular signaling domain, and there is a lack of systematic research on the optimization of the extracellular structure of the CAR molecule membrane. Therefore, there is an urgent need to develop better CAR T cell drugs.

[0004] Changes in the CAR molecular structure have an important impact on T cell activation efficiency, downstream signaling pathways, and T cell differentiation phenotypes. How to optimize the CAR molecular structure to give T cells better anti-tumor function is the basis for expanding the clinical application of CAR T therapy and is also a hot topic in the current field. Current optimization research mainly focuses on the intracellular signaling domain, and there is a lack of systematic research on the optimization of the extracellular structure of the CAR molecule. Summary of the invention

[0005] In view of this, the present invention provides CAR molecules, CAR cells and CAR pharmaceutical compositions and their applications. This application improves the polymerization ability of CAR molecules by modifying the extracellular structure of the membrane, which helps to improve the activation efficiency of CAR immune cells, promote the formation of stable and orderly immune synapses, and thus enhance the anti-tumor function of CAR immune cells.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] In a first aspect, the present invention provides a CAR molecule, which comprises an extracellular domain, a transmembrane domain, and an intracellular domain;

[0008] The extracellular domain includes the antigen binding domain and the multimerization / dimerization domain.

[0009] In the embodiments of the present invention, the antigen binding domain and the multimerization / dimerization domain may be directly connected or connected via a connecting sequence, which is not specifically limited in the present invention.

[0010] In an embodiment of the present invention, the multimerization / dimerization domain is selected from the group consisting of the following polypeptide fragments: FKBP polypeptide, FRB polypeptide, calcineurin polypeptide, cyclophilin polypeptide, bacterial DHFR polypeptide, PYL1 polypeptide, ABI1 polypeptide, GIB1 polypeptide, GAI polypeptide, and / or variants thereof.

[0011] In a specific embodiment of the invention, the multimerization / dimerization domain comprises a FKBP polypeptide.

[0012] In a specific embodiment of the present invention, the amino acid sequence of the FKBP polypeptide includes at least one of the following sequences:

[0013] 1) the amino acid sequence shown in SEQ ID NO: 7;

[0014] 2) an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO:7, for example, an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the amino acid sequence of SEQ ID NO:7.

[0015] Chimeric antigen receptor (CAR) is a cell surface receptor protein that gives immune cells the ability to target specific antigen proteins. Structurally, CAR is composed of three functional domains: extracellular domain, transmembrane domain, and intracellular domain. The extracellular domain (the extracellular region is often a single-chain antibody scFv) is responsible for recognizing and binding to the target antigen; the transmembrane domain can anchor the extracellular domain to the cell membrane. When the antigen is recognized and bound, a stimulation signal is generated and transmitted to the intracellular domain, and immune cells such as T cells are activated and exert effector functions.

[0016] In order to improve the polymerization ability of CAR molecules, the present application adds one or more tandem FK506 binding protein (FKBP) binding domains to its extracellular segment. The following takes the addition of two tandem FKBPs to the extracellular segment of CAR as an example to illustrate the working principle of the present application: the small molecule compound AP1903 has a symmetrical structure and can simultaneously bind to the FKBP sequences on two different CAR molecules, thereby inducing the CAR molecules to form polymers (see the working principle). Figure 1), and named this structure as inducible multimerization CAR (imCAR) molecule. Under normal conditions, imCAR mainly exists in monomeric form (perhaps with a small amount of dimers mediated by the hinge region); when AP1903 is added, imCAR molecules can form multimers, thereby increasing the degree of aggregation of CAR molecules. Changes in the distribution pattern of CAR molecules will have a direct impact on intracellular activation signals, immune synapse structures, lipid rafts, etc., thereby more efficiently inducing activation signals and degranulation effects, achieving better anti-tumor effects.

[0017] The basic principle of the present invention and the mechanism of influence on CAR T cell function are as follows Figure 1 shown.

[0018] In an embodiment of the present invention, the multimerization / dimerization domain comprises at least one polypeptide fragment or at least two tandemly repeated polypeptide fragments.

[0019] Preferably, the multimerization / dimerization domain comprises 1 to 5 polypeptide fragments; for example, 1, 2, 3, 4, 5, etc.

[0020] Preferably, the multimerization / dimerization domain comprises 2 to 4 tandemly repeated polypeptide fragments.

[0021] In an embodiment of the present invention, when the multimerization / dimerization domain includes more than two polypeptide fragments, the polypeptide fragments can be directly connected or connected through amino acid sequences.

[0022] In the embodiment of the present invention, the number of amino acids in the amino acid sequence is 0 to 30, preferably 0 to 20, and more preferably 0 to 15. The amino acid sequence used to connect polypeptide fragments can be any amino acid sequence as long as it can play a connecting role.

[0023] In a specific embodiment of the present invention, the amino acid sequence used to connect the polypeptide fragments is (GGGGS) n , wherein n≥1, such as 1, 2, 3, 4, 5, 10, 20, etc. An exemplary amino acid sequence is shown in SEQ ID NO:8.

[0024] In an embodiment of the present invention, the antigen binding domain comprises at least one of an antibody, an antibody fragment, a single-chain antibody scFv, di-scFv, Fv, Fab, Fab', (Fab')2, a miniantibody, a diabody, a single-domain antibody sdAb, a light chain variable domain VL or VHH.

[0025] In a specific embodiment provided by the present invention, the antigen binding domain is a single-chain antibody scFv. The scFv sequence needs to be designed according to the type of target antigen.

[0026] In embodiments provided herein, the target antigen of the antigen binding domain is selected from the group consisting of: CD19, CD20, epidermal growth factor receptor (EGFR), CD22, CD23, CD28, CD30, CD33, CD35, CD38, CD40, CD42c, CD43, CD44, CD44v6, CD47, CD49D, CD52, CD53, CD56, CD70, CD72, CD73, CD74, CD79A, CD79B, CD80, CD82, CD85A, CD85B, CD85D, CD85H, CD85K, CD96, CD107a, CD112, CD115, CD117, CD120b , CD123, CD146, CD148, CD155, CD185, CD200, CD204, CD221, CD271, CD276, CD279, CD280, CD281, CD301, CD312, CD353, CD362, BCMA, CD16V, CLL-1, Igκ, T RBC1, TRBC2, CKLF, CLEC2D, EMC10, EphA2, FR-a, FLT3LG, FLT3, Lewis-Y, HLA-G, ICAM5, IGHA1 / IgA1, IL-1RAP, IL-17RE, IL-27RA, MILR1, MR1, PSCA, PTC RA, PODXL2, PTPRCAP, ULBP2, AJAP1, ASGR1, CADM1, CADM4, CDH15, CDH23, CDHR5, CELSR3, CSPG4, FAT4, GJA3, GJB2, GPC2, GPC3, IGSF9, LRFN4, LRRN6A / L INGO1, LRRC15, LRRC8E, LRIG1, LGR4, LYPD1, MARVELD2, MEGF10, MPZLI1, MTDH, PANX3, PCDHB6, PCDHB10, PCDHB12, PCDHB13, PCDHB18, PCDHGA3, PEP, SGC B, vezatin, DAGLB, SYT11, WFDC10A, ACVR2A, ACVR2B, anaplastic lymphoma kinase, cadherin 24, DLK1, GFRA2, GFRA3, EPHB2, EPHB3, EPHB4, EFNB1, EPOR, FGFR2, FGFR4, GALR2, GLG1, GLP1R, HBEGF, IGF2R, UNC5C, VASN, DLL3, FZD10, KREMEN2, TMEM169, TMEM198, NRG1, TMEFF1, ADRA2C, CHRNA1, CHRNB4, CHRNA3, CHRNG, DRD4, GABRB3,GRIN3A, GRIN2C, GRIK4, HTR7, APT8B2, NKAIN1, NKAIN4, CACNA1A, CACNA1B, CACNA1I, CACNG8, CACNG4, CLCN7, KCNA4, KCNG2, KCNN3, KCNQ2, KCNU1, PKD1L 2. PKD2L1, SLC5A8, SLC6A2, SLC6A6, SLC6A11, SLC6A15, SLC7A1, SLC7A5P1, SLC7A6, SLC9A1, SLC10A3, SLC10A4, SLC13A5, SLC16A8, SLC18A1, SLC18A3, S LC19A1, SLC26A10, SLC29A4, SLC30A1, SLC30A5, SLC35E2, SLC38A6, SLC38A9, SLC39A7, SLC39A8, SLC43A3, TRPM4, TRPV4, TMEM16J, TMEM142B, ADORA2B, BAI1, EDG6, GPR1, GPR26, GPR34, GPR44, GPR56, GPR68, GPR173, GPR175, LGR4, MMD, NTSR2, OPN3, OR2L2, OSTM1, P2RX3, P2RY8, P2RY11, P2RY13, PTGE3, SS TR5, TBXA2R, ADAM22, ADAMTS7, CST11, MMP14, LPPR1, LPPR3, LPPR5, SEMA4A, SEMA6B, ALS2CR4, LEPROTL1, MS4A4A, ROM1, TM4SF5, VANGL1, VANGL2, C18orf1, GSGL1, ITM2A, KIAA1715, LDLRAD3, OZD3, STEAP1, MCAM, CHRNA1, CHRNA3, CHRNA5, CHRNA7, CHRNB4, KIAA1524, NRM.3, RPRM, GRM8, KCNH4, melanocortin 1 receptor, PT PRH, SDK1, SCN9A, SORCS1, CLSTN2, endothelin-converting enzyme-like-1, lytic phospho-receptor 2, LTB4R, TLR2, neutrophil tyrosine kinase 1, MUC16, B7-H4, ERBB2, HER3, EGFR variant III (EGFRvIII), HGFR, FOLR1, MSLN, CA-125, MUC-1, prostate-specific membrane antigen (PSMA), mesothelin, epithelial cell adhesion molecule (EpCAM), L1-CAM, CEACAM1, CEACAM5, CEACAM6, VEGFR1, VEGFR2, high molecular weight melanoma-associated antigen (HMW-MAA), MAGE-Al,IL-13R-α2, disialylgangliosides (GD2 and GD3), tumor-associated carbohydrate antigens (CA-125, CA-242, Tn and sialyl-Tn), 4-1BB, 5T4, BAFF, carbonic anhydrase 9 (CA-IX), C-MET, CCR1, CCR4, FAP, fibronectin extracellular domain-B (ED-B), GPNMB, IGF-1 receptor, integrin α5β1, integrin αvβ3, ITB5, ITGAX, embigin, PDGF-Rα, ROR1, multimer One or more of ligand glycan 1, TAG-72, tenascin C, TRAIL-R1, TRAIL-R2, NKG2D-ligand, major histocompatibility complex (MHC) molecules presenting tumor-specific peptide epitopes, PR1 / HLA-A2, lineage-specific or tissue-specific tissue antigens, CD3, CD4, CD5, CD7, CD8, CD24, CD25, CD34, CD80, CD86, CD133, CD138, CD152, CD319, endoglin, and MHC molecules.

[0027] In a specific embodiment of the present invention, the target antigen of the CAR molecule is selected from at least one of CD19, CD20, and epidermal growth factor receptor (EGFR).

[0028] In an embodiment of the present invention, the transmembrane domain is selected from one or more transmembrane domains of CD3ζ, CD3ε, CD3γ, CD3δ, CD4, CD5, CD8, CD8a, CD9, CD16, CD22, CD28, CD33, CD37, CD45, CD134, CD137, CD154, ICOS, OX40, DAP10, DAP12, or a truncated sequence thereof.

[0029] In a specific embodiment provided by the present invention, the transmembrane domain is a CD8a transmembrane domain.

[0030] In an embodiment of the present invention, the intracellular domain includes a co-stimulatory domain and an activation domain.

[0031] In an embodiment of the present invention, the co-stimulatory domain is selected from at least one of CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1, CD2, CD7, LIGHT, NKG2C, B7-H3, DAP10, and DAP12.

[0032] In a specific embodiment provided by the present invention, the co-stimulatory domain is 4-1BB.

[0033] In an embodiment of the present invention, the activation domain is selected from at least one of FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD3ζ, CD22, CD79a, CD79b, CD66d, DAP10, and DAP12.

[0034] In a specific embodiment provided by the present invention, the activation domain is CD3ζ.

[0035] In an embodiment of the present invention, the CAR molecule of the present invention further comprises a hinge domain, which is disposed between the multimerization / dimerization domain and the transmembrane domain. The hinge domain and the transmembrane domain together constitute the hinge and transmembrane domain.

[0036] In the embodiment of the present invention, the multimerization / dimerization domain and the hinge domain may be directly connected or connected via a connecting sequence, which is not specifically limited in the present invention.

[0037] In an embodiment of the present invention, the hinge domain is selected from one or more hinge domains of CD28, CD3ε, CD45, CD4, CD5, CD8, CD8a, CD9, CD16, CD22, CD33, CD37, CD134, CD137, ICOS, CD154, or a truncated sequence thereof.

[0038] Preferably, the number of amino acids in the hinge domain is 0-100, preferably 0-80, and more preferably 15-60.

[0039] In a specific embodiment provided by the present invention, the hinge domain is a CD8a hinge domain or a truncated sequence thereof.

[0040] In a preferred embodiment of the present invention, the CAR molecule is sequentially connected by scFV, FKBP domain, CD8a hinge and transmembrane domain, 4-1BB costimulatory domain, and CD3ζ activation domain. Among them, CD8a hinge and transmembrane domain include CD8a hinge domain and CD8a transmembrane domain. The FKBP domain is composed of one or more FKBP fragments, and multiple FKBP fragments can be connected by amino acid sequences.

[0041] In a specific embodiment of the present invention, the CAR molecular structure is: scFV-(FKBP domain) m -CD8a hinge domain (or its truncated sequence) -CD8a transmembrane structure -4-1BB co-stimulatory domain -CD3ζ activation domain. Wherein, m≥1, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.

[0042] In a specific embodiment of the present invention, the CAR molecules include imCAR19, imCAR20, imCAR-EGFR, idCAR19, idCAR20, idCAR-EGFR, imCAR19-T1, imCAR19-T2, idCAR19-T1, and idCAR19-T2.

[0043] Among them, idCAR represents a CAR molecule containing one FKBP polypeptide that can induce dimerization; imCAR represents a CAR molecule containing two FKBP polypeptides that can induce multimerization; T1 represents a CAR molecule with half of the hinge region truncated. T2 represents a CAR molecule with all hinge regions truncated, that is, the molecule does not include the CD8a hinge domain (or its truncated sequence).

[0044] In an embodiment of the present invention, the amino acid sequence of the CAR molecule includes at least one of the following sequences:

[0045] 1) the amino acid sequence shown in any one of SEQ ID NOs: 13, 14, 15, 16, 17, 18, 22, 23, 25, and 26;

[0046] 2) An amino acid sequence that is at least 90% identical to any of the amino acid sequences shown in 1). For example, an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to any of the amino acid sequences shown in 1).

[0047] In a specific embodiment of the present invention, the imCAR molecular structure is: scFV-(FKBP domain)2-CD8a hinge domain-CD8a transmembrane structure-4-1BB co-stimulatory domain-CD3ζ activation domain.

[0048] In a specific embodiment of the present invention, the amino acid sequence of imCAR19 includes at least one of the following sequences:

[0049] 1) the amino acid sequence shown in SEQ ID NO: 13;

[0050] 2) an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 13, for example, an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the amino acid sequence of SEQ ID NO: 13.

[0051] In a specific embodiment of the present invention, the amino acid sequence of imCAR20 includes at least one of the following sequences:

[0052] 1) the amino acid sequence shown in SEQ ID NO: 14;

[0053] 2) an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 14, for example, an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the amino acid sequence of SEQ ID NO: 14.

[0054] In a specific embodiment of the present invention, the amino acid sequence of imCAR-EGFR includes at least one of the following sequences:

[0055] 1) the amino acid sequence shown in SEQ ID NO: 15;

[0056] 2) an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 15, for example, an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the amino acid sequence of SEQ ID NO: 15.

[0057] In a specific embodiment of the present invention, the idCAR molecular structure is: scFV-FKBP domain-CD8a hinge domain-CD8a transmembrane structure-4-1BB co-stimulatory domain-CD3ζ activation domain.

[0058] In a specific embodiment of the present invention, the amino acid sequence of idCAR19 includes at least one of the following sequences:

[0059] 1) the amino acid sequence shown in SEQ ID NO: 16;

[0060] 2) an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 16, for example, an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the amino acid sequence of SEQ ID NO: 16.

[0061] In a specific embodiment of the present invention, the amino acid sequence of idCAR20 includes at least one of the following sequences:

[0062] 1) the amino acid sequence shown in SEQ ID NO: 17;

[0063] 2) an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 17, for example, an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the amino acid sequence of SEQ ID NO: 17.

[0064] In a specific embodiment of the present invention, the amino acid sequence of idCAR-EGFR includes at least one of the following sequences:

[0065] 1) the amino acid sequence shown in SEQ ID NO: 18;

[0066] 2) an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO: 18, for example, an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the amino acid sequence of SEQ ID NO: 18.

[0067] In a specific embodiment of the present invention, the molecular structure of imCAR-T1 is: scFV-(FKBP domain)2-a truncated half sequence of the CD8a hinge domain-CD8a transmembrane structure-4-1BB co-stimulatory domain-CD3ζ activation domain.

[0068] In a specific embodiment of the present invention, the amino acid sequence of imCAR19-T1 includes at least one of the following sequences:

[0069] 1) the amino acid sequence shown in SEQ ID NO: 22;

[0070] 2) an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO:22, for example, an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the amino acid sequence of SEQ ID NO:22.

[0071] In a specific embodiment of the present invention, the imCAR-T2 molecular structure is: scFV-(FKBP domain)2-CD8a transmembrane structure-4-1BB costimulatory domain-CD3ζ activation domain. This molecular structure does not include the CD8a hinge domain or its truncated sequence.

[0072] In a specific embodiment of the present invention, the amino acid sequence of imCAR19-T2 includes at least one of the following sequences:

[0073] 1) the amino acid sequence shown in SEQ ID NO: 23;

[0074] 2) an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO:23, for example, an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the amino acid sequence of SEQ ID NO:23.

[0075] In a specific embodiment of the present invention, the molecular structure of idCAR-T1 is: scFV-FKBP domain-a truncated half sequence of the CD8a hinge domain-CD8a transmembrane structure-4-1BB co-stimulatory domain-CD3ζ activation domain.

[0076] In a specific embodiment of the present invention, the amino acid sequence of idCAR19-T1 includes at least one of the following sequences:

[0077] 1) the amino acid sequence shown in SEQ ID NO: 25;

[0078] 2) an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO:25, for example, an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the amino acid sequence of SEQ ID NO:25.

[0079] In a specific embodiment of the present invention, the idCAR-T2 molecular structure is: scFV-FKBP domain-CD8a transmembrane structure-4-1BB co-stimulatory domain-CD3ζ activation domain. This molecular structure does not include the CD8a hinge domain or its truncated sequence.

[0080] In a specific embodiment of the present invention, the amino acid sequence of idCAR19-T2 includes at least one of the following sequences:

[0081] 1) the amino acid sequence shown in SEQ ID NO: 26;

[0082] 2) an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NO:26, for example, an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the amino acid sequence of SEQ ID NO:26.

[0083] In a second aspect, the present invention provides a polynucleotide encoding the above-mentioned CAR molecule.

[0084] In a specific embodiment of the present invention, the nucleotide sequence encoding the FKBP polypeptide in the CAR molecule includes at least one of the following sequences:

[0085] 1) the nucleotide sequence shown in SEQ ID NO: 34;

[0086] 2) a complementary sequence or a degenerate sequence of the nucleotide sequence shown in SEQ ID NO: 34;

[0087] 3) A nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 34. For example, a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the nucleotide sequence shown in SEQ ID NO: 34.

[0088] In the specific embodiment provided by the present invention, the nucleotide sequence encoding the antigen binding domain is a nucleotide sequence encoding a single-chain antibody scFv. The scFv sequence needs to be designed according to the type of target antigen.

[0089] In a specific embodiment of the present invention, the target antigen of the CAR molecule is selected from at least one of CD19, CD20, and epidermal growth factor receptor (EGFR).

[0090] In an embodiment of the present invention, the nucleotide sequence encoding the CAR molecule includes at least one of the following sequences:

[0091] 1) the nucleotide sequence shown in any one of SEQ ID NOs: 40, 41, 42, 43, 44, 45, 49, 50, 52, and 53;

[0092] 2) a complementary sequence or a degenerate sequence of the nucleotide sequence shown in any one of SEQ ID NOs: 40, 41, 42, 43, 44, 45, 49, 50, 52, and 53;

[0093] 3) A nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in any one of 1) or 2). For example, a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the nucleotide sequence shown in any one of 1) or 2).

[0094] In a specific embodiment of the present invention, the CAR molecules include imCAR19, imCAR20, imCAR-EGFR, idCAR19, idCAR20, idCAR-EGFR, imCAR19-T1, imCAR19-T2, idCAR19-T1, and idCAR19-T2.

[0095] In a specific embodiment of the present invention, the nucleotide sequence encoding imCAR19 includes at least one of the following sequences:

[0096] 1) the nucleotide sequence shown in SEQ ID NO: 40;

[0097] 2) a complementary sequence or a degenerate sequence of the nucleotide sequence shown in SEQ ID NO: 40;

[0098] 3) A nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 40. For example, a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the nucleotide sequence shown in SEQ ID NO: 40.

[0099] In a specific embodiment of the present invention, the nucleotide sequence encoding imCAR20 includes at least one of the following sequences:

[0100] 1) the nucleotide sequence shown in SEQ ID NO: 41;

[0101] 2) a complementary sequence or a degenerate sequence of the nucleotide sequence shown in SEQ ID NO: 41;

[0102] 3) A nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 41. For example, a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the nucleotide sequence shown in SEQ ID NO: 41.

[0103] In a specific embodiment of the present invention, the nucleotide sequence encoding imCAR-EGFR includes at least one of the following sequences:

[0104] 1) the nucleotide sequence shown in SEQ ID NO: 42;

[0105] 2) a complementary sequence or a degenerate sequence of the nucleotide sequence shown in SEQ ID NO: 42;

[0106] 3) A nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 42. For example, a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the nucleotide sequence shown in SEQ ID NO: 42.

[0107] In a specific embodiment of the present invention, the nucleotide sequence encoding idCAR19 includes at least one of the following sequences:

[0108] 1) the nucleotide sequence shown in SEQ ID NO: 43;

[0109] 2) a complementary sequence or a degenerate sequence of the nucleotide sequence shown in SEQ ID NO: 43;

[0110] 3) A nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 43. For example, a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the nucleotide sequence shown in SEQ ID NO: 43.

[0111] In a specific embodiment of the present invention, the nucleotide sequence encoding idCAR20 includes at least one of the following sequences:

[0112] 1) the nucleotide sequence shown in SEQ ID NO: 44;

[0113] 2) a complementary sequence or a degenerate sequence of the nucleotide sequence shown in SEQ ID NO: 44;

[0114] 3) A nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 44. For example, a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the nucleotide sequence shown in SEQ ID NO: 44.

[0115] In a specific embodiment of the present invention, the nucleotide sequence encoding idCAR-EGFR includes at least one of the following sequences:

[0116] 1) the nucleotide sequence shown in SEQ ID NO: 45;

[0117] 2) a complementary sequence or a degenerate sequence of the nucleotide sequence shown in SEQ ID NO: 45;

[0118] 3) A nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 45. For example, a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the nucleotide sequence shown in SEQ ID NO: 45.

[0119] In a specific embodiment of the present invention, the nucleotide sequence encoding imCAR19-T1 includes at least one of the following sequences:

[0120] 1) the nucleotide sequence shown in SEQ ID NO: 49;

[0121] 2) a complementary sequence or a degenerate sequence of the nucleotide sequence shown in SEQ ID NO: 49;

[0122] 3) A nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 49. For example, a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the nucleotide sequence shown in SEQ ID NO: 49.

[0123] In a specific embodiment of the present invention, the nucleotide sequence encoding imCAR19-T2 includes at least one of the following sequences:

[0124] 1) the nucleotide sequence shown in SEQ ID NO: 50;

[0125] 2) a complementary sequence or a degenerate sequence of the nucleotide sequence shown in SEQ ID NO: 50;

[0126] 3) A nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 50. For example, a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the nucleotide sequence shown in SEQ ID NO: 50.

[0127] In a specific embodiment of the present invention, the nucleotide sequence encoding idCAR19-T1 includes at least one of the following sequences:

[0128] 1) the nucleotide sequence shown in SEQ ID NO: 52;

[0129] 2) a complementary sequence or a degenerate sequence of the nucleotide sequence shown in SEQ ID NO: 52;

[0130] 3) A nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 52. For example, a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the nucleotide sequence shown in SEQ ID NO: 52.

[0131] In a specific embodiment of the present invention, the nucleotide sequence encoding idCAR19-T2 includes at least one of the following sequences:

[0132] 1) the nucleotide sequence shown in SEQ ID NO: 53;

[0133] 2) a complementary sequence or a degenerate sequence of the nucleotide sequence shown in SEQ ID NO: 53;

[0134] 3) A nucleotide sequence that is at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 53. For example, a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identical to the nucleotide sequence shown in SEQ ID NO: 53.

[0135] In a third aspect, the present invention provides a vector, which comprises the above-mentioned polynucleotide; the vector is selected from at least one of a plasmid, a bacterium, and a virus.

[0136] Preferably, the vector may use a viral vector that lacks replication ability and cannot replicate itself in transfected cells, such as a retroviral vector (including oncogenic retroviral vectors, lentiviral vectors and pseudotyped vectors), adenoviral vectors, vaccinia virus vectors or HSV vectors.

[0137] In a specific embodiment of the present invention, the vector is a lentiviral vector.

[0138] In a fourth aspect, the present invention further provides a CAR cell, the CAR cell comprising the above-mentioned polynucleotide, and / or vector; the cell is an immune cell;

[0139] Preferably, the immune cells are T cells, NK cells, dendritic cells or macrophages.

[0140] In a specific embodiment of the present invention, the immune cells are T cells.

[0141] In a fifth aspect, the present invention provides a CAR pharmaceutical composition, comprising at least one of the above-mentioned CAR molecules, polynucleotides, vectors, CAR cells, and a bridging factor.

[0142] In an embodiment of the present invention, the bridging factor includes but is not limited to at least one of rapamycin or its analogs, coumermycin or its derivatives, gibberellins or its derivatives, abscisic acid (ABA) or its derivatives, methotrexate or its derivatives, cyclosporin A or its derivatives, FKCsA or its derivatives, trimethoprim (Tmp)-FK506 binding protein (FKBP) synthetic ligand (SLF) or its derivatives.

[0143] In a specific embodiment of the present invention, the bridging factor includes but is not limited to at least one of AP1903, AP20187, AP21967, everolimus, norflulimus, pimecrolimus, rufolimus, tacrolimus, temsirolimus, umimios, and zotarolimus.

[0144] The present invention can induce the polymerized CAR molecules to connect and polymerize to form CAR molecular polymers by adding bridging factors such as AP1903.

[0145] In the above composition, the CAR molecules and / or the CAR molecules in the CAR cells, and the bridging factors, may be present in a separately packaged form or in a polymer form.

[0146] In a sixth aspect, the present invention provides the use of the above-mentioned CAR molecules, polynucleotides, vectors, CAR cells or CAR pharmaceutical compositions in the preparation of anti-tumor drugs.

[0147] In an embodiment of the present invention, the anti-tumor drug is used to prevent and / or treat lung cancer, lymphoma, blood cancer, breast cancer, liver cancer, pancreatic cancer, bile duct cancer, renal cell carcinoma, colorectal cancer, ovarian cancer, gastric cancer, bladder cancer, esophageal cancer, mesothelioma, melanoma, head and neck cancer, thyroid cancer, sarcoma, prostate cancer, glioblastoma, cervical cancer, thymic cancer, myeloma, Merkel cell carcinoma, etc.

[0148] In a seventh aspect, the present invention provides an anti-tumor drug comprising the above-mentioned CAR cells and / or CAR pharmaceutical composition, and pharmaceutically acceptable excipients.

[0149] Compared with the prior art, the present invention has the following beneficial effects:

[0150] 1. The CAR molecular polymer of the present invention can more efficiently induce activation signals and degranulation effects by increasing the phosphorylation of immune receptor tyrosine activation motifs (ITAMs) and forming stable and orderly immune synapses, thereby achieving better anti-tumor effects.

[0151] 2. The CAR molecules and polymers that can induce polymerization in the present invention greatly improve the activation efficiency of CAR T cells and promote the formation of stable and orderly immune synapses, thereby improving the anti-tumor function of CAR T cells. At the same time, CAR molecular polymers can significantly inhibit T cell exhaustion caused by tumor antigen stimulation, further improving the anti-tumor efficacy and providing a better treatment option for tumor patients.

[0152] 3. CAR molecule polymerization significantly reduces the secretion of inflammatory factors. The reduction of inflammatory factors not only helps to reduce the toxic side effects of CAR T therapy, improve safety in clinical applications, and relieve the pain of patients during treatment; at the same time, the function of CAR molecules is strictly regulated by small molecule drugs, and the bridging factors used in the present invention (such as small molecule drugs AP1903) have the advantages of fast metabolism in the body, high sensitivity, and low toxicity. By controlling the dosage of small molecule drugs, precise regulation of CART cell function can be achieved, further improving clinical safety.

[0153] 4. The method of the present invention has the advantages of being easy to operate, stable and reliable, and suitable for industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0154] Figure 1 Schematic diagram showing the working principle of imCAR molecule;

[0155] Figure 2 The structure and infection efficiency of CAR molecules that can induce multimerization are shown;

[0156] In A, the CAR molecule is a CAR molecular structure that does not contain an FKBP polypeptide; the idCAR molecule is a CAR molecule that contains one FKBP polypeptide and can induce dimerization; the imCAR molecule is a CAR molecule that contains two FKBP polypeptides and can induce multimerization;

[0157] In B, vehicle is the negative control group; mCherry is a red fluorescent protein;

[0158] Figure 3 It shows that inducing imCAR19 molecular polymerization increases the first activation signal intensity; Rnod-4 is a calcium ion fluorescent probe;

[0159] Figure 4 It was shown that inducing CAR molecule multimerization increased the degranulation effect of CAR T cells;

[0160] Figure 5 The results showed that inducing CAR molecule multimerization increased the ability of CAR T cells to kill tumor cells;

[0161] Figure 6 The results showed that inducing imCAR molecule multimerization suppressed T cell exhaustion;

[0162] Figure 7 It shows that inducing imCAR molecular multimerization changes the factor expression profile; IFN-gama is interferon gamma; GranzymeB is a serine protease; Perforin is perforin;

[0163] Figure 8 The degranulation function detection of idCAR19 and imCAR19 molecules with different structures is shown;

[0164] Fig. 9 The results show the study on cell affinity mediated by CAR molecular polymers with different structures.

[0165] English and Chinese meanings of the attached pictures:

[0166] Antigen: antigen;

[0167] ITAM: Immunoreceptor tyrosine-based activation motif;

[0168] Lck: lymphocyte protein tyrosine kinase;

[0169] ZAP-70: a tyrosine protein kinase;

[0170] Fyn: a tyrosine protein kinase;

[0171] CD8a hinge and transmembrane domain: CD8a hinge and transmembrane domain;

[0172] Cell membrane: cell membrane;

[0173] FITC: fluorescein isothiocyanate;

[0174] Mean MFI of EGFP(-basal): Mean fluorescence intensity of EGFP (-background);

[0175] EGFP: Enhanced Green Fluorescent Protein;

[0176] Positive rate: positive rate;

[0177] Double positive rate: double positive rate;

[0178] Lysis efficiency: lysis efficiency;

[0179] T Cells Bound: T cell binding;

[0180] Force: affinity. DETAILED DESCRIPTION

[0181] The present invention discloses CAR molecules, CAR cells, and CAR pharmaceutical compositions and their applications. Those skilled in the art can refer to the contents of this article and appropriately improve the process parameters to achieve them. It should be noted in particular that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0182] Terminology explanation:

[0183] FK506 binding protein (FKBP) is a kind of constitutive protein widely present in organisms and highly conserved in evolution. FKBP has been found in many eukaryotic organisms from yeast to humans, and acts as a protein folding chaperone for proteins containing proline residues. Together with cyclophilin, FKBP belongs to the immunophilin family. FKBP is involved in a variety of cellular functions, including protein folding, cell signaling, apoptosis and transcription. They exert their functions by directly binding and changing the conformation of their target proteins, thus acting as molecular switches.

[0184] AP1903 (AP1903) is a dimerizing agent that acts by cross-linking the FKBP domains, initiating dimerization or multimerization of the protein.

[0185] A single-chain antibody fragment (scFv) is an antibody composed of the heavy chain variable region and the light chain variable region of an antibody connected by a short peptide (linker) of 5 to 20 amino acids.

[0186] Inducible dimerization CAR: inducibledimerization CAR, idCAR.

[0187] Inducible multimerization CAR: inducible multimerization CAR, imCAR.

[0188] In the specific embodiments provided by the present invention, the amino acid sequences and nucleotide sequences of scFV, FKBP, CD8a hinge domain, CD8a transmembrane domain, 4-1BB co-stimulatory domain, and CD3ζ activation domain are presented in the sequence table.

[0189] Table 1 Amino acid and nucleotide sequences of CAR molecules or their fragments

[0190]

[0191] The reagents, instruments or biological materials used in the present invention can be obtained through commercial channels.

[0192] The present invention will be further described below in conjunction with embodiments:

[0193] Example 1 Preparation of imCAR molecules

[0194] like Figure 2 As shown in A, the CAR molecule is composed of scFV, two FKBP fragments, CD8a hinge and transmembrane domain, 4-1BB costimulatory domain, and CD3ζ activation domain connected in sequence. The specific preparation method is as follows:

[0195] Take imCAR19 as an example. Gene synthesis of 2*FKBP nucleotide sequence, the 2*FKBP nucleotide sequence is as follows: acgcgtatgagaggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcactacaccgggatgcttgaagatggaaagaaagttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgaggctgggaagaaggggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggcatcatcccaccacatgccactctcgtcttcgatgtggagcttctaaaactggaaactggtg gcggtggctcgggcggtggtgggtcgggtggcggcggatctatgagaggagtgcaggtggaaaccatctccccaggagacgggcgcaccttc cccaagcgcggccagacctgcgtggtgcactacaccgggatgcttgaagatggaaagaaagttgattcctcccgggacagaaacaagcccttt aagtttatgctaggcaagcaggaggtgatccgaggctgggaagaaggggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggcatcatcccaccacatgccactctcgtcttcgatgtggagcttctaaaactggaaact

[0196] Based on the obtained CAR19 plasmid, the 2*FKBP sequence was inserted between the scFV and CD8a hinge domains in the CAR19 molecule using homologous recombination technology. After competent transformation and clone sequencing verification, the target imCAR19 plasmid was obtained.

[0197] The above preparation methods were used to prepare imCAR19, imCAR20, and imCAR-EGFR, respectively.

[0198] Example 2 Preparation of idCAR molecules

[0199] like Figure 2 As shown in A, the CAR molecule is composed of scFV, a FKBP fragment, a CD8a hinge and transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3ζ activation domain. The specific preparation method is as follows:

[0200] Take idCAR19 as an example. Gene synthesize the FKBP nucleotide sequence, and the FKBP nucleotide sequence is as follows: acgcgtatgagaggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcactacaccgggatgcttgaagatggaaagaaagttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgaggctgggaagaaggggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggcatcatcccaccacatgccactctcgtcttcgatgtggagcttctaaaactggaaact

[0201] Based on the obtained CAR19 plasmid, the FKBP sequence was inserted between the scFV and CD8a hinge domains in the CAR19 molecule using homologous recombination technology. After competent transformation and clone sequencing verification, the target idCAR19 plasmid was obtained.

[0202] The above preparation methods were used to prepare idCAR19, idCAR20 and idCAR-EGFR respectively.

[0203] Comparative Example 1 Preparation of CAR molecules

[0204] like Figure 2 As shown in A, the CAR molecule is composed of scFV, CD8a hinge and transmembrane domain, 4-1BB co-stimulatory domain, and CD3ζ activation domain connected in sequence. The specific preparation method is as follows:

[0205] The CAR19-T2A-EGFP nucleotide sequence was fully synthesized, wherein the 5' end contained a BamH I restriction site GGATCC, and the 3' end contained a Sal I restriction site GTCGAC.

[0206] The full sequence of the CAR19 molecule is:

[0207] atggccttaccagtgaccgccttgctcctgccgctggccttgctgctccacgccgccagggccggacatccagatgacaca

[0208] gactacatcctccctgtctgcctctctgggagacagagtcaccatcagttgcagggcaagtcaggacattagtaaatatttaa

[0209] attggtatcagcagaaaccagatggaactgttaaactcctgatctaccatacatcaagattacactcagggtcccatcaagg

[0210] ttcagtggcagtgggtctggaacagattattctctcaccattagcaacctggagcaagaagatattgccacttacttttgccaa

[0211] cagggtaatacgcttccgtacacgttcggaggggggaccaagctggagatcacaggtggcggtggctcgggcggtggt

[0212] gggtcgggtggcggcggatctgaggtgaaactgcagggtcaggacctggcctggtggcgccctcacagagcctgtcc

[0213] gtcacatgcactgtctcaggggtctcattacccgactatggtgtaagctggattcgccagcctccacgaaagggtctggagt

[0214] gggctggagtaatggggtagtgaaaccacatactataattcagctctcaaatccagactgaccatcatcaaggacaactc

[0215] caagagccaagttttcttaaaatgaacagtctgcaaactgatgacacagccatttactactgtgccaaacattattactacgg

[0216] tggtagctatgctatggactactggggccaaggaacctcagtcaccgtctcctcaacgcgtaccacgacgccagcgccgc

[0217] gaccaccaacaccggcgcccaccatcgcgtcgcagcccctgtccctgcgcccagaggcgtgccggccagccggcgggg

[0218] ggcgcagtgcacacgaggggctggacttcgcctgtgatatctacatctgggcgcccttggccgggacttgtggggtcctt

[0219] ctcctgtcactggttatcaccctttactgctctagaaaacggggcagaaagaaactcctgtatatattcaaacaaccatttatga

[0220] gaccagtcaaactactactactcaagagagatgggctgtaggctccgatttccagaagaagaagagggagtgaactgga

[0221] attcagagtgaagttcagcaggagcgcagacgcccccgcgtaccagcagggccagaaccagctctataacgagctcaat

[0222] ctaggacgaagagaggtacgatgttttggacaagagacgtggccgggaccctgagatgggggaaagccgagaag

[0223] gaagaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaa

[0224] ggcgagcgccggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacg

[0225] ccttcacatgcaggccctgccccctcgc

[0226] The T2A sequence is:

[0227] ggaagcggagagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggacct

[0228] The EGFP sequence is:

[0229] atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccac

[0230] aagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggca

[0231] agctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatg

[0232] aagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaa

[0233] ctacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaa

[0234] ggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcag

[0235] aagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccag

[0236] cagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaa

[0237] gaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagc

[0238] tgtacaagtaa

[0239] The three sequences are directly connected.

[0240] Subsequently, the synthesized CAR19-T2A-EGFP nucleotide sequence was double-digested with BamHI and SALI endonucleases, and the gene sequence A carrying double sticky ends was recovered by gel running.

[0241] The original vector PLVX-EF1a-IRES-puro was purchased from BioVet Biotechnology Co., Ltd., and double-digested with BamHI and SALI endonucleases, and the gene sequence B carrying double sticky ends was recovered by running on a gel.

[0242] Gene sequences A and B were mixed in a ratio of 3:1, T4 ligase was added for ligation at room temperature for 30 minutes, and then 10ul of the product was taken for competent transformation. Three clones were selected for sequencing, and the target CAR19 overexpression vector was obtained after sequencing verification.

[0243] CAR19, CAR20 and CAR-EGFR were prepared respectively using the above preparation methods.

[0244] Note: All CAR molecules in the examples and comparative examples are connected downstream by T2A sequence to express GFP fluorescent protein for the sorting and analysis of CAR T cells.

[0245] Experimental Example 1 Study on the expression and distribution of CAR molecules that can induce multimerization

[0246] 1. Methods for determining infection efficiency and distribution

[0247] CAR T cells were obtained on the second day after lentiviral infection, and the expression of GFP fluorescent protein in the cells was detected by flow cytometry. Cells with positive GFP expression were considered to be CAR T cells with positive CAR expression.

[0248] A fusion protein expression vector of CAR molecule and mCherry fluorescent protein was constructed, and the lentivirus was prepared to infect Jurkat cells, and then the mCherry fluorescent protein-positive Jurkat cells were sorted and purified by flow cytometry. The expression and distribution of CAR-mCherry in Jurkat cells were then directly observed using a fluorescence confocal microscope.

[0249] 2. Experimental Results

[0250] The above examples successfully prepared CAR T-19, idCAR T-19 and imCAR T-19 cells, and the cell infection efficiency was stable between 30-60%. Figure 2 As can be seen from A, the infection efficiency of CAR T-19, idCAR T-19 and imCAR T-19 cells is similar.

[0251] This experiment detected the expression distribution of imCAR19 molecules in Jurkat cells. Figure 2 B shows that under normal conditions, imCAR19 molecules are evenly distributed on the cell membrane in a diffuse state. 30 minutes after the addition of 10 nM concentration of AP1903, it can be seen that the imCAR19 molecules are significantly aggregated and distributed on the cell membrane in a plaque-like state.

[0252] Experimental Example 2 Study on the induction of activation signals by polymerized CAR molecules

[0253] 1. Experimental Methods

[0254] (1) Detection of CAR T cell activation efficiency:

[0255] 1). Western blotting to detect phosphorylation of related kinases:

[0256] After flow sorting CAR T-19 cells on the 5th day of culture, the cells were cultured until the 10th day. After culturing with serum-free medium for 3 hours, they were mixed with Nalm6 cells (human acute B lymphoblastic leukemia cell line) at an effector-target ratio of 1:1. AP1903 was added to the experimental group at a final concentration of 10nM, and the same volume of PBS was added to the control group. After co-culture for different periods of time, the cells were centrifuged at 850g for 30s, and then cell lysis buffer and phosphatase inhibitors were added to extract proteins. After determining the protein concentration, 40μg of protein was loaded to detect the phosphorylation levels of CD3ζ, Zap70, etc.

[0257] 2). Intracellular calcium ion concentration detection:

[0258] Method 1: The sorted CAR T-19 cells were cultured until day 10, and the CAR T cells were counted. 1×10 5CAR T cells were cultured in serum-free medium for 3 hours, and then Rhod-4 calcium ion fluorescent probe with a working concentration of 5mM was added for incubation for 1 hour, and the fluorescence signal intensity of the calcium ion probe was detected by a multifunctional microplate reader, which was counted as the control at time 0, with an excitation wavelength of 540nm and an emission wavelength of 590nm. Then, an equal amount of Nalm6 cells was added to the CAR T cells, and AP1903 with a final concentration of 10nM was added to the experimental group, and the same volume of PBS was added to the control group. At different time points of co-culture, the fluorescence signal intensity of the calcium ion probe was detected by a multifunctional microplate reader, and the signal changes were statistically calculated.

[0259] Method 2: Use lentiviral infection to prepare a stable expression of calcium-dependent GFP protein (jGCaMP7s), which includes a circular arrangement of GFP (cpGFP) fused to calmodulin (CaM) and a calmodulin binding peptide from myosin light chain kinase (Rs20, also known as M13). Calmodulin-dependent conformational changes and its interaction with M13 and GFP regulate the GFP chromophore environment and affect fluorescence. Therefore, the concentration changes of intracellular calcium ions can be reflected by detecting the signal intensity of GFP.

[0260] Based on this cell line, Jurkat cells overexpressing CAR molecules were prepared in this experimental example. Jurkat-CAR cells were counted, and after culturing with serum-free medium for 12 hours, equal amounts of Nalm6 cells were added to mix with Jurkat-CAR cells. AP1903 with a final concentration of 10 nM was added to the experimental group, and the same volume of PBS was added to the control group. At different time points of co-culture, the signal intensity changes of GFP in Jurkat cells were detected by flow cytometry.

[0261] 2. Experimental Results

[0262] Figure 3 To induce the polymerization of imCAR19 molecules to increase the intensity of the first activation signal. CAR T-19 cells were mixed with Nalm6 cells at a ratio of 1:1, (A, B). The addition of AP1903 did not affect the increase in intracellular calcium ion concentration of CAR T-19. The addition of AP1903 induced imCAR19 to form polymers, which significantly increased the intracellular calcium ion concentration, and the increase in calcium ions lasted longer. (C). After 10 minutes of antigen stimulation, the phosphorylation level of T cell activation-related kinases was detected. The results showed that inducing the polymerization of imCAR19 molecules can significantly increase the phosphorylation level of related kinases, and the phosphorylation level of Zap70 is particularly significant. RFU (relative fluorescence unit, relative fluorescence intensity unit), *p≤0.05, **p≤0.01.

[0263] By adding AP1903 to induce imCAR molecules to form polymers, the results of calcium ion concentration detection show that after inducing imCAR molecular polymerization, the activation signal generated by CAR T cells is stronger and lasts longer. The relevant kinase phosphorylation detection 10 minutes after antigen stimulation showed that inducing imCAR molecular polymerization significantly increased the phosphorylation level of key kinases in T cell activation-related pathways.

[0264] Experimental Example 3 Functional Study of CAR Molecules that Can Induce Multimerization - Degranulation Effect

[0265] 1. Experimental Methods

[0266] Flow cytometry was used to detect the expression of CD107a, which is an indicator of degranulation effect. The experimental steps for degranulation effect detection are as follows: On the 10th day of CAR T cell culture, CAR T cells were counted and co-cultured at a ratio of effector to target = 1:1 (1×10 5 Cells were added to each 96-well plate), tumor cells included: Nalm6 (human acute B lymphoblastic leukemia cell line), Raji (human lymphoma cells), A549 (human non-small cell lung cancer cells) overexpressing human CD19, and AP1903 was added at a final concentration of 10nM to induce imCAR molecules to form polymers. 15μl of CD107a antibody was added, and after co-culture for 4 hours, the expression of CD107a in CAR T cells was detected.

[0267] 2. Experimental Results

[0268] Figure 4 It shows that inducing CAR molecular multimerization improves the degranulation effect of CAR T cells. After CAR T-19 and imCAR T-19 cells were co-cultured with Nalm6 (A), Raji (B), A549-CD19 (C), and imCAR T-20 cells were co-cultured with Raji (D) for 4 hours, the expression of CD107a in CAR T cells was detected. (E). Statistical results show that the addition of AP1903 does not change the CD107a positivity of CAR T-19 cells, but can significantly increase the CD107a positivity of imCAR T-19 and imCAR T-20. **p≤0.01.

[0269] It can be seen that the degranulation effect of CAR T cells can be effectively enhanced by adding AP1903 to induce imCAR molecules to form polymers.

[0270] Experimental Example 4 Functional Study of CAR Molecules that Can Induce Multimerization - Tumor Killing Effect

[0271] 1. Experimental Methods

[0272] The method for detecting tumor killing efficiency is as follows: GFP-positive CAR T cells are purified by flow cytometry, and on the 10th day of culture, CAR T cells are counted and co-cultured with tumor cells carrying luciferase (firefly luciferase) according to different effector-target ratios (1:1 to 1:20). Tumor cells include: Nalm6 (human acute B lymphoid leukemia cell line), Raji (human lymphoma cells), A549 (human non-small cell lung cancer cells), and AP1903 with a final concentration of 10nM is added to the experimental group to induce imCAR molecules to form polymers, and an equal volume of PBS solution is added to the control group. After 24 or 48 hours of co-culture, luciferin, a luciferase substrate, is added, and the killing efficiency of tumor cells is calculated by measuring the chemiluminescence intensity using a multifunctional microplate reader.

[0273] 2. Experimental Results

[0274] Figure 5 It was shown that inducing CAR molecular multimerization improves the ability of CAR T cells to kill tumor cells. At different effector-target ratios, CAR T-19 and imCAR T-19 cells were co-cultured with Nalm6 (A), A549-CD19 (B), and Raji (C) for 24 hours. The addition of AP1903 did not affect the killing efficacy of CAR T-19 cells, but it could significantly improve the killing function of imCAR T-19. (D) ImCAR T-20 in monomer form had almost no killing effect on Nalm6 (low expression of CD20) under the condition of E:T = 1:5. When AP1903 was added to induce imCAR T-20 to form multimers, the killing efficiency could be increased to about 50% (48 hours). E:T (effector:target, effector-target ratio), *p≤0.05, **p≤0.01.

[0275] It can be seen that the addition of AP1903 to induce imCAR molecules to form polymers can effectively improve the killing ability of CAR T cells against tumor cells, especially the killing ability of tumor cells with low antigen density. Experimental Example 5 Functional study of CAR molecules that can induce polymerization - T cell exhaustion

[0276] 1. Experimental Methods

[0277] 1). Detection of CAR T cell exhaustion status under tumor antigen stimulation:

[0278] ImCAR T-19 cells were cultured normally until the 7th day, and then co-cultured with Nalm6 cells at an effector-target ratio of 1:5. IL-2 was not added during the co-culture process, and AP1903 was added to the experimental group at a final concentration of 10 nM. After 2 days of co-culture (Nalm6 cells were basically completely eliminated), the culture medium was replaced with normal medium containing IL-2 and continued to be cultured for 3 days, and then the PD-1, TIM-3, LAG-3 and CD107a (after tumor cells were re-stimulated) of T cells were detected.

[0279] 2) Detection of CAR T cell differentiation and exhaustion phenotype under normal culture system:

[0280] On the third day after viral infection, AP1903 (experimental group) at a working concentration of 10 nM was added to the normal CAR T culture system every day, and cultured until the 12th day after viral infection, and the expression of CD45RO, CD62L, and CCR7 in imCAR T cells and ordinary CAR T cells was detected to evaluate whether the induction of CAR molecule polymerization and changes in CAR molecular structure would affect the differentiation state of T cells during the culture process. At the same time, the detection of PD-1, TIM-3, LAG-3, and CD107a (after tumor cell stimulation) was used to detect whether CAR molecule polymerization would change the differentiation state and exhaustion phenotype of T cells during the culture process.

[0281] 2. Experimental Results

[0282] Figure 6 It shows that inducing imCAR molecular multimerization inhibits T cell exhaustion. (A). Schematic diagram of in vitro tumor cell stimulation-induced CAR T cell exhaustion experiment. (BE). During co-culture, the addition of AP1903 had no effect on the expression of PD-1, TIM-3 and LAG-3 in CAR T-19 cells, but significantly reduced the expression of PD-1, TIM-3 and LAG-3 in imCAR T-19 cells. (F). The addition of AP1903 during co-culture significantly improved the degranulation function of imCAR T-19 cells during secondary tumor stimulation. (G). There was no significant difference in the CD8 ratio and differentiation phenotype of CAR T-19 and imCAR T-19 cells cultured normally to day 13. *p≤0.05, **p≤0.01.

[0283] It can be seen that the in vitro T cell exhaustion experiment confirmed that inducing CAR molecule polymerization can significantly inhibit the exhaustion of CAR T cells.

[0284] Experimental Example 6 Functional Study of CAR Molecules that Can Induce Multimerization - Secretion of Inflammatory Factors

[0285] 1. Experimental Methods

[0286] The cytokine detection method is as follows: GFP-positive CAR T cells were purified by flow cytometry, and on the 10th day of culture, the CAR T cells were counted and co-cultured with Nalm6 tumor cells at an effector-target ratio of 1:2. AP1903 with a final concentration of 10 nM was added to the experimental group to induce the imCAR molecule to form multimers, and an equal volume of PBS solution was added to the control group. After 24 hours of co-culture, the supernatant was collected by centrifugation, and the levels of factors such as IL-2, IL-4, IL-6, IFN-γ, IL-10, granzyme-B and perforin were detected using the LEGENDplex multifactor detection kit.

[0287] 2. Experimental Results

[0288] Figure 7 It was shown that inducing imCAR molecular multimerization changed the factor expression profile. CAR T-19 and imCAR T-19 cells were mixed and cultured with Nalm6 at a ratio of 1:2 for 24 hours. The results of multifactor detection showed that the addition of AP1903 did not affect the factor secretion of CART-19 cells; after the addition of AP1903 to induce imCAR19 molecular multimerization, the cytokine secretion level was significantly increased, but the overall level was still significantly lower than that of conventional CAR T cells. *p≤0.05, **p≤0.01.

[0289] It can be seen that regardless of whether AP1903 is added to induce CAR molecule polymerization, the factor secretion level of imCART-19 is significantly lower than that of conventional CAR T cells. This suggests that imCAR molecules may give CAR T cells a more "energy-saving" tumor-killing mode. In addition, we also detected the cytokine secretion of idCAR T-19, and the results showed that the secretion level of inflammatory factors of idCAR T-19 was also significantly lower than that of conventional CAR T-19.

[0290] Experimental Example 7 Study on the anti-tumor efficacy of CAR molecular polymers with different structures

[0291] 1. Experimental Methods

[0292] In order to screen for more effective imCAR19 molecules, three imCAR19 molecules with different hinge lengths and imCAR19 molecules with the FKBPs sequence transferred into the membrane were constructed. As a control, different idCAR19 molecules were also constructed.

[0293] GFP-positive CAR T cells were purified by flow cytometry. On the 10th day of culture, CAR T cells were counted and co-cultured with tumor cells Nalm6 at a 1:1 effector-target ratio. AP1903 with a final concentration of 10 nM was added to the experimental group to induce imCAR molecules to form polymers, and an equal volume of PBS solution was added to the control group. After 4 hours of co-culture, the expression of CD107a was detected by flow cytometry to evaluate the degranulation effect of different CAR T cells. To detect the killing ability of CAR T cells, we co-cultured CAR T cells with Nalm6 tumor cells at a 1:10 effector-target ratio for 24 hours, and counted the remaining live Nalm6 cells by flow cytometry to calculate the killing efficiency of CAR T cells on Nalm6 cells.

[0294] Table 2 Modification types of imCAR19 and idCAR19 molecules

[0295] Group Hinge region type idCAR19 Complete hinge region sequence idCAR19-T1 The hinge region is truncated in half idCAR19-T2 The hinge region is completely truncated idCAR19-IN1 Transfer of the FKBP sequence from the outside of the membrane to the inside of the membrane upstream of 4-1BB imCAR19 Complete hinge region sequence imCAR19-T1 The hinge region is truncated in half imCAR19-T2 The hinge region is completely truncated imCAR19-IN1 Transfer of the FKBP sequence from the outside of the membrane to the inside of the membrane upstream of 4-1BB

[0296] 2. Experimental Results

[0297] Figure 8 The degranulation function detection of idCAR19 and imCAR19 molecules with different structures is shown. (A). Based on the original idCAR19 and imCAR19, the hinge region outside the membrane was truncated by half or completely, and idCAR19-T1, idCAR19-T2 and imCAR19-T1, imCAR19-T2 were constructed respectively; the FKBP sequence was transferred from the outside of the membrane to the upstream of 4-1BB inside the membrane, and idCAR19-IN1 and imCAR19-IN1 were constructed respectively. (B). After co-culture with Nalm6, the detection results of CD107a showed that the structure with half hinge truncated (idCAR19-T1 and imCAR19-T1) had the best degranulation function, and the hinge region truncated completely (idCAR19-T2 and imCAR19-T2) significantly reduced the degranulation effect of CAR T cells. When the FKBP sequence is located outside the membrane, the addition of AP1903 to induce the CAR molecules to form dimers or polymers can significantly improve the degranulation effect, but when FKBP is located inside the membrane, the addition of AP1903 will not produce significant changes. (C). Complete truncation of the hinge region has a greater impact on the killing function of CAR T cells. After adding AP1903, the tumor killing ability of idCAR T-19T2, imCAR T-19, imCAR T-19T1 and imCAR T-19T2 will be significantly improved. When the FKBP sequence is located inside the membrane, the addition of AP1903 instead impairs the anti-tumor function of idCAR T-19IN1 and has no significant effect on imCAR T-19IN1. **p≤0.01.

[0298] Experimental Example 8 Study on Cell Affinity Mediated by CAR Molecular Polymers with Different Structures

[0299] The affinity between CAR T cells and tumor cells was detected using the Z-MOVI instrument from Lumicks.

[0300] 1. Experimental Methods

[0301] 1. Dilute the 0.01% poly-lysine (PLL) stock solution 1:5 in sterile PBS to obtain a concentration of 0.002%.

[0302] 2. Add 80 μL of 0.002% PLL solution to the glass chip and let it stand at room temperature for 10 minutes. Then let it stand in a dry incubator at 37°C for 1 hour and use a syringe to aspirate air every 10 minutes to completely dry it to ensure that no liquid remains.

[0303] 3. Add preheated PBS to the chip, let it sit for 5 minutes, then remove it. Repeat this step 3 times.

[0304] 4. Harvest Nalm6 cells and adjust their density to 1.8 × 10 8 cells / mL.

[0305] 5. After adding 20 μL of the prepared cell suspension to the chip reservoir, open the valve to allow the cells to enter the chip chamber, then close the valve to allow the cells to settle and attach to the coating.

[0306] 6. Incubate the chip and cells in a cell culture incubator at 37°C for 0.5 hours to allow the Nalm6 cells to completely adhere to the glass chip.

[0307] 7. Then rinse the non-attached cells with complete medium.

[0308] 8. Add 20 μL of CAR T cells to the chip storage chamber at a density of 1.8×10 7 The valve was opened to allow CAR T cells to enter the glass chip chamber covered with a monolayer of Nalm6 cells, and the timer was started.

[0309] 9. After 3 minutes of co-culture at room temperature, the CAR T cells that were not bound to the Nalm6 cells were washed away with complete culture medium. Then, 0-1000pN ultrasonic vibration force was applied. The CAR T cells that detached from the Nalm6 cells were tracked in real time using a high-resolution camera.

[0310] 10. The affinity of CAR T cells to tumor cells was evaluated by drawing the detachment curve of CAR T cells from Nalm6 cells and counting the number of CAR T cells that were still attached after being subjected to 1000pN ultrasonic vibration force.

[0311] 2. Experimental Results

[0312] like Fig. 9 As shown, the addition of AP1903 had no significant effect on the affinity of CAR T-19 cells and Nalm6 cells. In the absence of AP1903, the affinity of imCAR T-19 cells for Nalm6 cells was significantly lower than that of conventional CAR T-19 cells. When AP1903 was added, the affinity of imCAR T-19 cells for Nalm6 cells was significantly improved and significantly higher than that of conventional CART-19 cells. (A) Primary CAR T cells (B) Jurkat T cells overexpressing CAR molecules. **p≤0.01.

[0313] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A CAR pharmaceutical composition, characterized in that: Comprising at least one of a CAR molecule, a polynucleotide encoding a CAR molecule, a vector containing a polynucleotide encoding a CAR molecule, a CAR cell containing a polynucleotide encoding a CAR molecule, and a bridging factor AP1903; The CAR molecule includes an extracellular domain, a transmembrane domain, and an intracellular domain in sequence; The extracellular domain includes an antigen binding domain and a multimerization / dimerization domain in sequence; The multimerization / dimerization domain is connected to the transmembrane domain; The multimerization / dimerization domain is a FKBP polypeptide; The multimerization / dimerization domain comprises at least two tandemly repeated polypeptide segments.

2. The CAR pharmaceutical composition according to claim 1, characterized in that The antigen binding domain is an antibody.

3. The CAR pharmaceutical composition according to claim 1, characterized in that The antigen binding domain comprises at least one of an antibody fragment, a single-chain antibody scFv, a di-scFv, Fv, Fab, Fab', (Fab')2, a diabody, a single-domain antibody sdAb or a VHH.

4. The CAR pharmaceutical composition according to claim 1, characterized in that The antigen binding domain is a minibody.

5. The CAR pharmaceutical composition according to claim 1, characterized in that The target antigen of the antigen binding domain is selected from the group consisting of: CD19, CD20, epidermal growth factor receptor (EGFR), CD22, CD23, CD28, CD30, CD33, CD35, CD38, CD40, CD42c, CD43, CD44, CD44v6, CD47, CD49D, CD52, CD53, CD56, CD70, CD72, CD73, CD74, CD79A, CD79B, CD80, CD82, CD85A, CD85B, CD85D, CD85H, CD85K, CD96, CD107a, CD112, CD115, CD117, CD120b, CD123, CD14 6. CD148, CD155, CD185, CD200, CD204, CD221, CD271, CD276, CD279, CD280, CD281, CD301, CD312, CD353, CD362, BCMA, CD16V, CLL-1, TRBC1, TRBC2, CKL F, CLEC2D, EMC10, EphA2, FR-a, FLT3LG, FLT3, Lewis-Y, HLA-G, ICAM5, IGHA1 / IgA1, IL-1RAP, IL-17RE, IL-27RA, MILR1, MR1, PSCA, PTCRA, PODXL2, PTPR CAP, ULBP2, AJAP1, ASGR1, CADM1, CADM4, CDH15, CDH23, CDHR5, CELSR3, CSPG4, FAT4, GJA3, GJB2, GPC2, GPC3, IGSF9, LRFN4, LRRN6A / LINGO1, LRRC15, L RRC8E, LRIG1, LGR4, LYPD1, MARVELD2, MEGF10, MPZLI1, MTDH, PANX3, PCDHB6, PCDHB10, PCDHB12, PCDHB13, PCDHB18, PCDHGA3, PEP, SGCB, vezatin, DAGL B, SYT11, WFDC10A, ACVR2A, ACVR2B, anaplastic lymphoma kinase, cadherin 24, DLK1, GFRA2, GFRA3, EPHB2, EPHB3, EPHB4, EFNB1, EPOR, FGFR2, FGFR4, GALR2, GLG1, GLP1R, HBEGF, IGF2R, UNC5C, VASN, DLL3, FZD10, KREMEN2, TMEM169, TMEM198, NRG1, TMEFF1, ADRA2C, CHRNA1, CHRNB4, CHRNA3, CHRNG, DRD4, GABRB3, GRIN3A, GRIN2C,GRIK4, HTR7, APT8B2, NKAIN1, NKAIN4, CACNA1A, CACNA1B, CACNA1I, CACNG8, CACNG4, CLCN7, KCNA4, KCNG2, KCNN3, KCNQ2, KCNU1, PKD1L2, PKD2L1, SLC5 A8, SLC6A2, SLC6A6, SLC6A11, SLC6A15, SLC7A1, SLC7A5P1, SLC7A6, SLC9A1, SLC10A3, SLC10A4, SLC13A5, SLC16A8, SLC18A1, SLC18A3, SLC19A1, SLC26A 10. SLC29A4, SLC30A1, SLC30A5, SLC35E2, SLC38A6, SLC38A9, SLC39A7, SLC39A8, SLC43A3, TRPM4, TRPV4, TMEM16J, TMEM142B, ADORA2B, BAI1, EDG6, GP R1, GPR26, GPR34, GPR44, GPR56, GPR68, GPR173, GPR175, LGR4, MMD, NTSR2, OPN3, OR2L2, OSTM1, P2RX3, P2RY8, P2RY11, P2RY13, PTGE3, SSTR5, TBXA2R, A DAM22, ADAMTS7, CST11, MMP14, LPPR1, LPPR3, LPPR5, SEMA4A, SEMA6B, ALS2CR4, LEPROTL1, MS4A4A, ROM1, TM4SF5, VANGL1, VANGL2, C18orf1, GSGL1, ITM2A, KIAA1715, LDLRAD3, OZD3, STEAP1, MCAM, CHRNA1, CHRNA3, CHRNA5, CHRNA7, CHRNB4, KIAA1524, NRM.3, RPRM, GRM8, KCNH4, melanocortin 1 receptor, PTPRH, SDK1, SC N9A, SORCS1, CLSTN2, endothelin-converting enzyme-like-1, lytic phospho-receptor 2, LTB4R, TLR2, neutrophil tyrosine kinase 1, MUC16, B7-H4, ERBB2, HER3, EGFR variant III (EGFRvIII), HGFR, FOLR1, MSLN, CA-125, MUC-1, prostate-specific membrane antigen (PSMA), mesothelin, epithelial cell adhesion molecule (EpCAM), L1-CAM, CEACAM1, CEACAM5, CEACAM6, VEGFR1, VEGFR2, high molecular weight melanoma-associated antigen (HMW-MAA), MAGE-Al, IL-13R-α2,Disialoganglioside GD2, disialoganglioside GD3, CA-125, CA-242, Tn, 4-1BB, 5T4, BAFF, carbonic anhydrase 9 (CA-IX), C-MET, CCR1, CCR4, FAP, fibronectin extracellular domain-B (ED-B), GPNMB, IGF-1 receptor, integrin α5β1, integrin αvβ3, ITB5, ITGAX, embigin, PDGF-Rα, ROR1, One or more of syndecan 1, TAG-72, tenascin C, TRAIL-R1, TRAIL-R2, NKG2D-ligand, major histocompatibility complex MHC molecule presenting tumor-specific peptide epitopes, PR1 / HLA-A2, CD3, CD4, CD5, CD7, CD8, CD24, CD25, CD34, CD80, CD86, CD133, CD138, CD152, CD319, and endoglin.

6. The CAR pharmaceutical composition according to claim 1, characterized in that The target antigen of the antigen binding domain is Igκ.

7. The CAR pharmaceutical composition according to claim 1, characterized in that The target antigen of the antigen binding domain is sialyl-Tn.

8. The CAR pharmaceutical composition according to claim 1, characterized in that The transmembrane domain is selected from one or more transmembrane domains of CD3ζ, CD3ε, CD3γ, CD3δ, CD4, CD5, CD8, CD8a, CD9, CD16, CD22, CD28, CD33, CD37, CD45, CD134, CD137, CD154, ICOS, OX40, DAP10, and DAP12.

9. The CAR pharmaceutical composition according to claim 1, characterized in that The intracellular domain includes a co-stimulatory domain and an activation domain; The co-stimulatory domain is selected from at least one of CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1, CD2, CD7, LIGHT, NKG2C, B7-H3, DAP10, and DAP12; The activation domain is selected from at least one of FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD3ζ, CD22, CD79a, CD79b, CD66d, DAP10, and DAP12.

10. The CAR pharmaceutical composition according to claim 1, characterized in that The CAR molecule further comprises a hinge domain, wherein the hinge domain is disposed between the multimerization / dimerization domain and the transmembrane domain; The hinge domain is selected from one or more hinge domains of CD28, CD3ε, CD45, CD4, CD5, CD8, CD8a, CD9, CD16, CD22, CD33, CD37, CD134, CD137, ICOS, and CD154.

11. The CAR pharmaceutical composition according to claim 1, characterized in that The amino acid sequence of the CAR molecule comprises: The amino acid sequence shown in any one of SEQ ID NOs: 13, 14, 15, 16, 17, 18, 22, 23, 25, and 26.

12. The CAR pharmaceutical composition according to claim 1, characterized in that The nucleotide sequence encoding the CAR molecule includes at least one of the following sequences: 1) the nucleotide sequence shown in any one of SEQ ID NOs: 40, 41, 42, 43, 44, 45, 49, 50, 52, and 53; 2) a complementary sequence or a degenerate sequence of the nucleotide sequence shown in any one of SEQ ID NOs: 40, 41, 42, 43, 44, 45, 49, 50, 52, and 53; 3) A nucleotide sequence having at least 90% identity with the nucleotide sequence shown in any one of 1) or 2).

13. The CAR pharmaceutical composition according to claim 1, characterized in that The vector is selected from at least one of plasmid, bacteria and virus.

14. The CAR pharmaceutical composition according to claim 1, characterized in that The CAR cell is an immune cell; The immune cells are T cells, NK cells, dendritic cells or macrophages.

15. Use of the CAR pharmaceutical composition according to any one of claims 1 to 14 in the preparation of anti-tumor drugs.

16. The use according to claim 15, characterized in that The anti-tumor drug is used to prevent and / or treat one of lung cancer, lymphoma, blood cancer, breast cancer, liver cancer, pancreatic cancer, bile duct cancer, renal cell carcinoma, colorectal cancer, ovarian cancer, gastric cancer, bladder cancer, esophageal cancer, mesothelioma, melanoma, head and neck cancer, thyroid cancer, sarcoma, prostate cancer, glioblastoma, cervical cancer, thymic cancer, myeloma, and Merkel cell carcinoma.

17. An anti-tumor drug, characterized in that: Comprising the CAR pharmaceutical composition according to any one of claims 1 to 14, and pharmaceutically acceptable excipients.

Images